ID: 979561924

View in Genome Browser
Species Human (GRCh38)
Location 4:122110444-122110466
Sequence TCAGAGGGTCCTAACGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979561917_979561924 3 Left 979561917 4:122110418-122110440 CCATGAGATTATATCCCACACCT 0: 20
1: 427
2: 1742
3: 1926
4: 1301
Right 979561924 4:122110444-122110466 TCAGAGGGTCCTAACGCCCACGG No data
979561916_979561924 23 Left 979561916 4:122110398-122110420 CCAACTTAAAAAACGGCGCACCA No data
Right 979561924 4:122110444-122110466 TCAGAGGGTCCTAACGCCCACGG No data
979561915_979561924 27 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561924 4:122110444-122110466 TCAGAGGGTCCTAACGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979561924 Original CRISPR TCAGAGGGTCCTAACGCCCA CGG Intergenic
No off target data available for this crispr