ID: 979563388

View in Genome Browser
Species Human (GRCh38)
Location 4:122125614-122125636
Sequence ACAAATATACAAATGGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979563388_979563390 5 Left 979563388 4:122125614-122125636 CCTATGTCCATTTGTATATTTGT No data
Right 979563390 4:122125642-122125664 TTATTTTCACTCTATTTTTAAGG No data
979563388_979563391 16 Left 979563388 4:122125614-122125636 CCTATGTCCATTTGTATATTTGT No data
Right 979563391 4:122125653-122125675 CTATTTTTAAGGTGCCTAAGAGG No data
979563388_979563393 26 Left 979563388 4:122125614-122125636 CCTATGTCCATTTGTATATTTGT No data
Right 979563393 4:122125663-122125685 GGTGCCTAAGAGGCAGAGTTGGG No data
979563388_979563392 25 Left 979563388 4:122125614-122125636 CCTATGTCCATTTGTATATTTGT No data
Right 979563392 4:122125662-122125684 AGGTGCCTAAGAGGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979563388 Original CRISPR ACAAATATACAAATGGACAT AGG (reversed) Intergenic
No off target data available for this crispr