ID: 979563389

View in Genome Browser
Species Human (GRCh38)
Location 4:122125621-122125643
Sequence AAATACTACAAATATACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979563389_979563392 18 Left 979563389 4:122125621-122125643 CCATTTGTATATTTGTAGTATTT No data
Right 979563392 4:122125662-122125684 AGGTGCCTAAGAGGCAGAGTTGG No data
979563389_979563393 19 Left 979563389 4:122125621-122125643 CCATTTGTATATTTGTAGTATTT No data
Right 979563393 4:122125663-122125685 GGTGCCTAAGAGGCAGAGTTGGG No data
979563389_979563391 9 Left 979563389 4:122125621-122125643 CCATTTGTATATTTGTAGTATTT No data
Right 979563391 4:122125653-122125675 CTATTTTTAAGGTGCCTAAGAGG No data
979563389_979563390 -2 Left 979563389 4:122125621-122125643 CCATTTGTATATTTGTAGTATTT No data
Right 979563390 4:122125642-122125664 TTATTTTCACTCTATTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979563389 Original CRISPR AAATACTACAAATATACAAA TGG (reversed) Intergenic
No off target data available for this crispr