ID: 979563392

View in Genome Browser
Species Human (GRCh38)
Location 4:122125662-122125684
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979563389_979563392 18 Left 979563389 4:122125621-122125643 CCATTTGTATATTTGTAGTATTT No data
Right 979563392 4:122125662-122125684 AGGTGCCTAAGAGGCAGAGTTGG No data
979563388_979563392 25 Left 979563388 4:122125614-122125636 CCTATGTCCATTTGTATATTTGT No data
Right 979563392 4:122125662-122125684 AGGTGCCTAAGAGGCAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr