ID: 979565189

View in Genome Browser
Species Human (GRCh38)
Location 4:122146462-122146484
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 5, 1: 25, 2: 61, 3: 146, 4: 433}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565189_979565197 17 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565197 4:122146502-122146524 CTTTTTGCAGAAGATGTGGGAGG No data
979565189_979565198 18 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565198 4:122146503-122146525 TTTTTGCAGAAGATGTGGGAGGG No data
979565189_979565200 22 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565200 4:122146507-122146529 TGCAGAAGATGTGGGAGGGGTGG No data
979565189_979565199 19 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565199 4:122146504-122146526 TTTTGCAGAAGATGTGGGAGGGG No data
979565189_979565196 14 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565196 4:122146499-122146521 ATTCTTTTTGCAGAAGATGTGGG No data
979565189_979565195 13 Left 979565189 4:122146462-122146484 CCCACAATCACTGCACTCTCCTT 0: 5
1: 25
2: 61
3: 146
4: 433
Right 979565195 4:122146498-122146520 GATTCTTTTTGCAGAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565189 Original CRISPR AAGGAGAGTGCAGTGATTGT GGG (reversed) Intergenic
902708765 1:18224453-18224475 AAGCAGAGTGAAGTGATAGAAGG - Intronic
903227966 1:21904529-21904551 GAGGAGAGTGCAGGGACTCTGGG - Intronic
903401746 1:23057869-23057891 GAGGAGACTGCAGTGAGTGGAGG - Intronic
903642447 1:24869193-24869215 AAGGAGAGTGTTGGGATGGTGGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
905619924 1:39435949-39435971 AAGGAGAGTGAAATGAGTCTTGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907108182 1:51902951-51902973 AAGCAGACTGCAGAGATTTTAGG + Intergenic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
908478865 1:64517418-64517440 AAGGAGAATTAAGTGAGTGTGGG + Intronic
908554891 1:65248082-65248104 CTGGAGCGAGCAGTGATTGTGGG + Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910574010 1:88737780-88737802 AAGGAGAGGGAAGTGAGTGCAGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910745794 1:90573393-90573415 TAGAAGGGTGCAGTGATTCTTGG - Intergenic
910800391 1:91139059-91139081 AAGGAGAGTCCAGAGAGTGGTGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
911986997 1:104639498-104639520 AACTAGAATGCAGTAATTGTTGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912855581 1:113166184-113166206 AAGGTGACTGAAGTGATTGAAGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913561244 1:120022532-120022554 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
913636883 1:120771070-120771092 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
914281830 1:146181942-146181964 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914542874 1:148632880-148632902 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914623762 1:149438363-149438385 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915555339 1:156657957-156657979 AAGGAGAGGGCAGGGACTTTAGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917169557 1:172155913-172155935 CAGTAGAGTGCAGTGACTGAGGG + Intronic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918290891 1:183106955-183106977 AAAGAGACTGCACTGGTTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919857840 1:201717781-201717803 AAGTAGAGTGCAGAGAGTATAGG - Intronic
920040621 1:203093278-203093300 AAGAAGACAGCAGGGATTGTTGG - Intronic
921329396 1:214020400-214020422 AAGGAGGGGGCAGTGGTTTTGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922922562 1:229318854-229318876 AAAGAGAGTGCAGTGCTGGCCGG - Intergenic
923215645 1:231845685-231845707 AAGGTGAGTGAAGTGATGGATGG + Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924481583 1:244439954-244439976 CAGGAGAATGCAGTGATCATAGG - Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063056348 10:2509088-2509110 AGGGAGAGTGGAGTGAATCTTGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071125953 10:82335064-82335086 AAGGACAGTGGGCTGATTGTTGG - Intronic
1071250005 10:83808378-83808400 AAGGAAAGGGCAGTGCCTGTCGG - Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072844398 10:98813484-98813506 ATGGAGAAGGCAGTGATTTTGGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074765759 10:116698958-116698980 AAGGAGGGAGCAGTGAAGGTGGG - Intronic
1075085768 10:119413490-119413512 AAGCAGAGTGGAGAGATTGCAGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077577476 11:3395562-3395584 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077603975 11:3594680-3594702 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077890280 11:6413305-6413327 GAGCACAGTGCAGTGTTTGTTGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079527086 11:21403701-21403723 AAGGAGAGAGCAGTCTTTGATGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080096879 11:28418775-28418797 AGGCAAAGTGCAGTGAATGTGGG + Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081825738 11:46049612-46049634 AAGGAGAGTGCTGTGACAGGTGG - Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082559353 11:54600422-54600444 AAGCTGAGAGCAGTGCTTGTAGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083817533 11:65144049-65144071 AAGAAGTGTGCATTGAATGTGGG + Intergenic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1084226427 11:67717497-67717519 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084229427 11:67740344-67740366 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084259872 11:67969272-67969294 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1084812899 11:71625980-71626002 AAGGGCAGTTCAGTGAATGTAGG + Intergenic
1084845871 11:71899352-71899374 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1086540049 11:87898306-87898328 AAGTAGAGTGCAGAGGTTGAGGG - Intergenic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087104412 11:94395838-94395860 AAGGAGAGAGGAGTAATTGCAGG - Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1087902026 11:103651603-103651625 CAGTAGAGTGCAGTGATTAAAGG + Intergenic
1088098378 11:106126402-106126424 TAGGAGAGAGAAGTGATTCTAGG + Intergenic
1088854816 11:113739023-113739045 AAGGTGAGTGTAGTCTTTGTGGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1088946990 11:114524293-114524315 AAGGAGAAGGCAGTGAGTATTGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090242761 11:125195658-125195680 AATGAGAGTGAAGTTCTTGTGGG + Intronic
1092434077 12:8432434-8432456 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092681854 12:10992128-10992150 AAGCAGAGTTCAATGATTGAAGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1094226251 12:28049423-28049445 CTGGAGAGTGGAGTGATTTTTGG + Intergenic
1094633897 12:32204808-32204830 AAGGGGAATGCAGTGATACTTGG + Intronic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095747591 12:45676785-45676807 AAGTAGAGGGTAGTGATTCTGGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096199543 12:49671877-49671899 AAGGAGAGGGCACTAAATGTGGG + Intronic
1098601325 12:72334822-72334844 GAGGAGGGTGCAATGATTGAGGG + Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1102437452 12:112936444-112936466 AAGGAGGGAGCAGTGAGGGTGGG - Intergenic
1103470946 12:121180634-121180656 AAAGAGAGGGTAGTGATTGGAGG - Intronic
1106141061 13:27012066-27012088 AAGGAGAGTGAAGTGAATGGAGG + Intergenic
1106825456 13:33515483-33515505 AAGGAAAGTGCAGAGATAGCTGG + Intergenic
1106953010 13:34905885-34905907 ATGGACAGTGGAGGGATTGTAGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108623290 13:52204540-52204562 CAGAAGAGAGCAGTGAGTGTTGG - Intergenic
1108663439 13:52606497-52606519 CAGAAGAGAGCAGTGAGTGTTGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109923727 13:69106199-69106221 AAGCAGAGTGACGTGAGTGTGGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111947706 13:94682869-94682891 AAGGAGATTGTAGTGTTTGGTGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113446273 13:110370130-110370152 AAAGAGAGTGATGTGATTCTAGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115181106 14:30626665-30626687 TAGGAGAGTCCAGTGACAGTGGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117052187 14:51872021-51872043 CAGGTGAGTGCAGTGGTTGAAGG + Intronic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117464009 14:55974357-55974379 CAGGAGAATGCAGAGAATGTGGG + Intergenic
1117499315 14:56336533-56336555 AAAGAGAATGAAGTGATTATAGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118011599 14:61615633-61615655 AAGGAAAGTGAAATGATGGTGGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118654231 14:67930089-67930111 AGGTAAAGTGCACTGATTGTAGG + Intronic
1118764198 14:68899228-68899250 AAGGGGAGTGCTGTGTGTGTGGG - Intronic
1121875217 14:97445288-97445310 TAGAAGAGGGCAGTCATTGTAGG - Intergenic
1122593625 14:102873163-102873185 CAGGTGAGTGCAGTGATTTGAGG + Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126640149 15:50816273-50816295 AAGGAGTGGGCAGTGGTTTTAGG + Intergenic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128212421 15:65912036-65912058 AATGAGAGGGCAGTGAGTGGGGG + Intronic
1129280584 15:74481617-74481639 AAGGAGGGTGCAGGGAGAGTTGG + Intergenic
1130367452 15:83253236-83253258 AACAAGAGTGCAGTGATTAGGGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132892743 16:2212323-2212345 AAGTGGAGTGCTGTGACTGTGGG + Exonic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134796165 16:17038963-17038985 AAGGAGAATGTAGTGCATGTGGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140317274 16:73911308-73911330 AGGTAGAGTGCAGTCAATGTGGG + Intergenic
1140625296 16:76787035-76787057 AAGGTGGGTGCAGGGATTATGGG - Intergenic
1141644550 16:85360279-85360301 AAGAAGGGTGCAGAGGTTGTGGG + Intergenic
1141933952 16:87224104-87224126 CAGCAGAGTGCAGAGATAGTTGG - Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143418444 17:6768965-6768987 AAGGAGAGTTGAGAGAATGTGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146686552 17:34845168-34845190 ATGCAGAGTGCAGTGATGCTAGG - Intergenic
1147412908 17:40266628-40266650 AAGATAAGTGAAGTGATTGTTGG + Intronic
1147497416 17:40930113-40930135 GAGAAGAGTGCACTCATTGTTGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155792525 18:29992009-29992031 GATGAGAATGCAGTGATGGTAGG - Intergenic
1155986785 18:32238565-32238587 AAAGACAGTGCAGTCACTGTTGG + Intronic
1156234133 18:35184812-35184834 AAGGAGAGTGGAGAGATCCTAGG + Intergenic
1157157856 18:45285391-45285413 AAGTATAGTGCAGTGACTGATGG - Intronic
1157275461 18:46308146-46308168 AAGGAGAGTGCAATGGATATTGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157912207 18:51627107-51627129 AAGCAGTGTGCAGTGATGGAGGG - Intergenic
1157948966 18:52012809-52012831 AAGCAGAATGCAGTGAATTTTGG - Intergenic
1158591418 18:58782070-58782092 AAGGAGAGTGAGCTGGTTGTTGG - Intergenic
1158716482 18:59884797-59884819 AAGGAGAATGGAGTGGTTGGTGG - Intergenic
1159106143 18:64003286-64003308 AATGACAATGCAGTGATTGATGG + Intronic
1159122695 18:64189381-64189403 AAGAAGAGTGTACTGTTTGTTGG + Intergenic
1159435286 18:68408564-68408586 CAGGAGAGAGCAGGGAGTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1162749241 19:12818281-12818303 AAGAAGAGGGCAGTGAGAGTAGG + Intronic
1163080893 19:14941397-14941419 AAGGATATTGCAGTCATTCTGGG + Intergenic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1163767342 19:19170893-19170915 AAGGAGAGGGAAGTGGTTGGTGG - Intronic
1164019830 19:21290779-21290801 AAGGAGAATGGCGTGAATGTGGG + Intronic
1164032281 19:21418474-21418496 AAGGTCAGTGGAGTGATGGTTGG - Intronic
1164731627 19:30509719-30509741 AAGAAAAGTGTACTGATTGTGGG - Intronic
1166390641 19:42407175-42407197 AAGGAGGGCGCAGTGCTTGATGG + Exonic
1167990541 19:53357249-53357271 AAGGAGGTTGCAGTGAGTGGAGG + Intergenic
1168292689 19:55364491-55364513 AAGGAGAGAGGTGGGATTGTGGG - Exonic
925290078 2:2741635-2741657 AAGGTGAGTGCAGGGAGAGTGGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925699059 2:6614370-6614392 ACGGAGAGTGCTGTGAGTGTGGG - Intergenic
925735264 2:6958256-6958278 AAGCAAAGTGGAGTGATTGAAGG + Intronic
925786259 2:7434118-7434140 TAGGAGTGTGCAGTGGATGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930049357 2:47202657-47202679 AAATAGAGTCTAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930606188 2:53495908-53495930 AAGGATAATGCAATGAGTGTTGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935767462 2:106383277-106383299 AAGGAGAGTGGAGTGCGTTTTGG - Intergenic
935805632 2:106744835-106744857 AAGGAAAATGAAGTGAGTGTTGG - Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
938404865 2:131026099-131026121 AAGGACAGAGCAGACATTGTAGG + Intronic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
938821693 2:134966876-134966898 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
940468568 2:154064074-154064096 ATGGAGAGGCCAGTGATTATAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940807697 2:158206468-158206490 AAGCAGAGTGCTGAGATTGATGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941865858 2:170333674-170333696 AAGGAGAGTGAAGCCATTTTAGG - Intronic
942399361 2:175585047-175585069 AAGGAGAGTACAGATATTGAGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943760170 2:191599556-191599578 AAGGAGAGGGCAGAGAGTTTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946968819 2:225069112-225069134 CAGGAGAGTGAAGTGAATGGGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947958784 2:234217363-234217385 AAGGAGGCTGCAGCCATTGTTGG + Intergenic
948103043 2:235390546-235390568 TAGGAGAGTCAAGTGAATGTGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169024804 20:2360740-2360762 AATTAGAGTGCAGTGACTTTAGG - Intergenic
1169807909 20:9578235-9578257 AATGAGTGTGCAGGGATTGCTGG + Intronic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169967274 20:11232068-11232090 AAGGAGGGTGCAGGGACTTTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170427835 20:16252987-16253009 AAGGATGGGGAAGTGATTGTTGG - Intergenic
1170613860 20:17934090-17934112 AAGGAGAGTCCAGTTAGTGAAGG - Intergenic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174049288 20:47756711-47756733 AAGGAGGTTGCAGTGAGTGGAGG - Intronic
1174566451 20:51468276-51468298 AAGTAGATTGCATAGATTGTAGG - Intronic
1174673818 20:52333910-52333932 AAGGAGAGTGCAGAGAATCAGGG + Intergenic
1174690932 20:52503813-52503835 AAGAAGAGTGTGGTGACTGTGGG + Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175207345 20:57321612-57321634 AAGGAGAGTGCAGTGTGGGGAGG - Intergenic
1175485970 20:59346558-59346580 GAGGAGAGGGCTGTGCTTGTGGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175940116 20:62533899-62533921 GAGGAGGGTGCAGTGTCTGTGGG + Intergenic
1176657064 21:9596575-9596597 AACGATAATGCACTGATTGTTGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177222330 21:18210291-18210313 AGGGGAAGTGCCGTGATTGTGGG - Intronic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
950454196 3:13082935-13082957 AAGGAGCCAGCAGTGAGTGTGGG - Intergenic
950801197 3:15552974-15552996 AGGGAGAGTGCCGTAACTGTGGG - Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951837248 3:26996923-26996945 CAGGAGAGTCCAGTGGTGGTGGG + Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957074826 3:75593695-75593717 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957486029 3:80864337-80864359 AAGGGGAGTGCAGGGGTTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959361493 3:105399319-105399341 AAAGCTAGTGCAGTGATTGTTGG + Intronic
959653362 3:108773171-108773193 AAGGACAGTGCAGGGAATGCAGG - Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960818339 3:121697959-121697981 AAGGAAAGTGAAGTGCTTGAGGG - Exonic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
961033652 3:123627377-123627399 CATGAAAGTTCAGTGATTGTCGG - Intronic
961276380 3:125730436-125730458 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
961505932 3:127370459-127370481 AACGAAAGTGCAATGATTGGGGG - Intergenic
961875118 3:130016582-130016604 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961878057 3:130039294-130039316 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962674923 3:137748754-137748776 AAGAAGAGTTCAATTATTGTTGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964253588 3:154749446-154749468 AAGGAGAATGCAATGATTATGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964630171 3:158801859-158801881 AAAGACAGTGCAGTAATTGGTGG + Exonic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965264052 3:166518184-166518206 AGGGAAAGTGCAGTTACTGTGGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967439566 3:189491109-189491131 TAGGAGAGTGAAGTCTTTGTAGG + Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968339983 3:197947445-197947467 AAGGAAAGTGCAGTTGTAGTTGG - Intronic
968990272 4:3906330-3906352 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969018426 4:4121333-4121355 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969023114 4:4151520-4151542 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969730695 4:8955563-8955585 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969735557 4:8987385-8987407 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969794777 4:9518840-9518862 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
970747361 4:19315518-19315540 AAGCAGAGAGCAATCATTGTAGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971456659 4:26851458-26851480 AAGGAGAGTGGACTGATTCCAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972579054 4:40379169-40379191 GAGGACAGTGCAGTGATTATGGG + Intergenic
972708592 4:41570901-41570923 AAGGAGAGTGCAGAAATAGGAGG + Intronic
972726444 4:41749928-41749950 AAGGAGCGAGCAGTGATTTGTGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974266905 4:59597704-59597726 AAGGATAGTGCAGGGACTGTGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976748328 4:88428391-88428413 ATGGAAGGTGGAGTGATTGTAGG - Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983008845 4:162520093-162520115 AAAGACAGTGCTGTGATTGGAGG - Intergenic
983249491 4:165327913-165327935 AAGGAGACTGGAGTGAAGGTGGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983411392 4:167402971-167402993 AAAGAGAGGGCAGTGTTAGTCGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985023624 4:185717294-185717316 AAGAAAAGGGCAGTGATTGCTGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988335428 5:29902310-29902332 AAAGAAAGTGCAGTGATTCAAGG + Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989127926 5:38074874-38074896 AAGAAGAGTTCAGTGAATATTGG - Intergenic
989278311 5:39613372-39613394 AAGTTGAGTGCAGTGCTTGCTGG + Intergenic
990348266 5:54890346-54890368 AAGGAGAGTGGAGCAATTCTAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992657112 5:78921909-78921931 AAGGAAGGTGTAGCGATTGTGGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993999070 5:94756303-94756325 AAGAAGTCTTCAGTGATTGTTGG + Intronic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994818912 5:104623010-104623032 AAGGAGTGTGGAGTAAATGTTGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
999078123 5:148816822-148816844 AAGGAAAGTGCTGTGAATGGAGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000149577 5:158486330-158486352 TAGGAGAGTGAAGGGCTTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1002894366 6:1367714-1367736 AAGGAGACTGCTGTGAGTGGAGG - Intergenic
1003249709 6:4415498-4415520 AAGGGGAATGCAGTAATTCTTGG + Intergenic
1004708295 6:18145149-18145171 TAGCATAGTGCAGTGATTTTAGG - Intronic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007021743 6:38528117-38528139 AGGCAGAGTGTAGTGACTGTGGG + Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011029163 6:82902581-82902603 AAGGACAGAGCAGTGATTGCAGG + Intronic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012737430 6:102967886-102967908 AAAGAGAGTGAATGGATTGTAGG - Intergenic
1012875545 6:104721355-104721377 GAGGAGAGGGGAGTGATGGTGGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1014540737 6:122672873-122672895 AATGAAAGTGCAGTAATTCTTGG - Intronic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016731527 6:147432913-147432935 TAGAAAAGTGCAGTGATTTTGGG - Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019981852 7:4627503-4627525 GAGGAGAGTGGAGTAAGTGTGGG + Intergenic
1020310164 7:6861244-6861266 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020313102 7:6884384-6884406 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021383398 7:19996959-19996981 ACTGAGACTGCAGTGATGGTTGG - Intergenic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1026328950 7:69335556-69335578 GAGGAGAATGCAGGAATTGTTGG - Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028242488 7:88438160-88438182 AAGGAGTGGGCAGTGGTTGAGGG - Intergenic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029076914 7:97942041-97942063 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1035817287 8:2554821-2554843 AAGCAGAGTGCACTGTTTGGAGG + Intergenic
1036240862 8:7079927-7079949 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
1036902292 8:12679428-12679450 AAGGGCAGTTCAGTGAATGTAGG - Intergenic
1037245839 8:16833883-16833905 AAAGAAAGTGCAGAGACTGTGGG + Intergenic
1038993924 8:32900640-32900662 AAGATGAGTGCAGAGATTGGGGG - Intergenic
1041289090 8:56291347-56291369 AAGGACAGTGCAGGGAGTGGTGG + Intergenic
1041852353 8:62405565-62405587 ACGGAGAGAGCAGTGATTATGGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043557606 8:81450599-81450621 AAGGGTAGTGCAGGAATTGTGGG - Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044149320 8:88754849-88754871 AAGGACAATTCAGTGAGTGTGGG - Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1044987900 8:97771157-97771179 AAGGAGAGTTCAGAGATTAGAGG + Intergenic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045599095 8:103693185-103693207 AGGGAGAGTTTAGTAATTGTGGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048456479 8:134583156-134583178 AAGGTAAGTGCAGTGATGGAGGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051229920 9:14945379-14945401 AAAGAGAAAGCAGTGATTATGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051599772 9:18861361-18861383 AAGGAGACTGCATTGGTTTTAGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052246116 9:26337407-26337429 AAGGGAAGTTCAGTGGTTGTTGG + Intergenic
1052742564 9:32407435-32407457 AAGGAGAGTGAAGTGACATTAGG - Intronic
1053650585 9:40164747-40164769 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1053755153 9:41299177-41299199 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054331095 9:63756518-63756540 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1054533998 9:66211455-66211477 ATGGAGAGTGAAGTCATTGGAGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056081866 9:83103166-83103188 AAGCTGAGTGAAGTGTTTGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1057084509 9:92196686-92196708 AAGGAAAGTGAAGTGAGTGTAGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057990437 9:99763086-99763108 AAGGAGTGTGGTGTGCTTGTAGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058915070 9:109557648-109557670 AAGGAGAGGGCAGTGAGTCGAGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1061502608 9:131012659-131012681 AAGGAGAGGCCTGGGATTGTCGG + Intronic
1202798469 9_KI270719v1_random:149438-149460 ATGGAGAGTGAAGTCATTGGAGG - Intergenic
1203634788 Un_KI270750v1:100149-100171 AATGATAATGCACTGATTGTTGG - Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1187549571 X:20288512-20288534 AAGGAAAATGGAGTGTTTGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190708714 X:53050186-53050208 AAGGACAGTGAAGTGGTGGTGGG + Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192223233 X:69211505-69211527 AAGGTGAGTCCAGTGAGGGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192843385 X:74880829-74880851 AAGGAGAGAGCAGTGTATATGGG - Intronic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194665539 X:96673699-96673721 AAGGAGAGTGTAGAGTTTATGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196025063 X:111033434-111033456 AAGGTGAGTGCAGTCAATGTGGG - Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199916495 X:152347343-152347365 AAGGATAGTGGAGTGGTTGAGGG + Intronic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic