ID: 979565796

View in Genome Browser
Species Human (GRCh38)
Location 4:122152694-122152716
Sequence TATGAAGGAGTCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565796_979565805 24 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565796_979565799 7 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126
979565796_979565807 28 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565796_979565803 23 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565803 4:122152740-122152762 GCCCTGGCACCTATAAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565796 Original CRISPR TATGAAGGAGTCGCCGCCGC AGG (reversed) Intronic
901927705 1:12577420-12577442 TATGAGGGAGTCACCACCCCAGG + Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1067243607 10:44517485-44517507 TTTGAAGGAGTGGCTGCCGGAGG - Intergenic
1090279115 11:125441115-125441137 CATGAAGGAGACGCTGCTGCTGG + Intergenic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1123441488 15:20295128-20295150 TATGGAGCAGTGGCCGCCGCCGG + Intergenic
1132727971 16:1346965-1346987 TGTGAAGGAGTCCTCCCCGCCGG + Intronic
1136719718 16:32310392-32310414 TATGGAGCAATCGCCGCCGCTGG - Intergenic
1136724757 16:32348791-32348813 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1136843083 16:33554831-33554853 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG + Intergenic
1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203006713 16_KI270728v1_random:207377-207399 TATGGAGCAATCGCCGCCGCTGG + Intergenic
1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1203153248 16_KI270728v1_random:1855129-1855151 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1142623660 17:1179728-1179750 TCTGACCGAGCCGCCGCCGCGGG - Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151357983 17:73571676-73571698 TAAGAAGGCGTAGCCCCCGCTGG - Intronic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1162199416 19:9009888-9009910 AATGAGCAAGTCGCCGCCGCAGG - Intergenic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1165657872 19:37549688-37549710 GATGAAGGAGTGCCCGCCTCAGG - Intergenic
925167526 2:1727275-1727297 TCTGAAGGAGGGGCAGCCGCTGG - Intronic
926233404 2:11021764-11021786 TATGAAGGAGTAGTCGAGGCTGG + Intergenic
926654556 2:15387095-15387117 TCTGAAGGAGTCGCCCAGGCTGG + Intronic
934321401 2:91974835-91974857 TATGGAGCAGTCGTCGCCGCCGG + Intergenic
946767804 2:223056197-223056219 TATGAAGAAGAGGCTGCCGCAGG - Intronic
1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
961530888 3:127539763-127539785 TATGAAGGTGGCCCCGTCGCAGG + Intergenic
963870400 3:150409098-150409120 AAGGAAGGAGGAGCCGCCGCGGG + Exonic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
984647869 4:182238852-182238874 TATGAATGAGTCACCGCGGTAGG - Intronic
991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG + Exonic
1025168638 7:56735953-56735975 TGAGAAGGAGTCGCCGAGGCTGG + Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039618153 8:38973625-38973647 TATGAAGGACTGGCTGCCGCAGG - Exonic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1045362170 8:101442843-101442865 AATGAAGGAGTCTCTGCCTCTGG + Intergenic
1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG + Intergenic
1060738792 9:126083987-126084009 AATGAAGGAGTCTCAGCCACAGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic