ID: 979565797

View in Genome Browser
Species Human (GRCh38)
Location 4:122152709-122152731
Sequence AGGATGGCAAAGGAATATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 318}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565797_979565805 9 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565797_979565803 8 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565803 4:122152740-122152762 GCCCTGGCACCTATAAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
979565797_979565799 -8 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126
979565797_979565810 23 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565810 4:122152755-122152777 AACCGAGGGTTGGAGGTCAGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
979565797_979565808 16 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565808 4:122152748-122152770 ACCTATAAACCGAGGGTTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 72
979565797_979565807 13 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565797 Original CRISPR AGGATGGCAAAGGAATATGA AGG (reversed) Intronic
901179061 1:7327495-7327517 AGGAAAGCAAAGGAATAAGGTGG + Intronic
902643122 1:17779358-17779380 AGGGTGGCAAAGGAATTTAATGG - Intronic
903269325 1:22177888-22177910 AGGAAGGCAAAGAAGTAAGAGGG - Intergenic
905333013 1:37220919-37220941 TGGAAGATAAAGGAATATGAAGG + Intergenic
905495752 1:38384522-38384544 AGGATGGCAGAGGAGAAAGATGG - Intergenic
906090763 1:43177512-43177534 AGGCTAGGAAAGGAATTTGAGGG + Intronic
906414358 1:45608643-45608665 GGGATGGAAAAGGTAGATGAGGG + Intronic
907124385 1:52036490-52036512 AGGATGGCAGAGGCAGAAGAGGG + Intronic
907554030 1:55329145-55329167 AGGAAGGCAAGGGACTGTGAGGG + Intergenic
908640296 1:66215595-66215617 GGGATGGAAGAGCAATATGATGG + Intronic
909526966 1:76635732-76635754 AGGAGGGCAAAGCCACATGATGG - Intergenic
909952882 1:81740066-81740088 ATGATGTCAAAGGAAGATGAGGG + Intronic
910257367 1:85260990-85261012 ATGTTGGCAGAGGAAAATGATGG + Intergenic
910817318 1:91304934-91304956 AGGATGCCAAAACAATTTGATGG - Intronic
912131084 1:106601292-106601314 AAGATGGCTAAAGAAAATGAAGG + Intergenic
912356831 1:109061163-109061185 AGAGTGGCAAATGAACATGATGG - Intergenic
913417043 1:118620022-118620044 AGGATTAAAAAGGAATGTGAAGG - Intergenic
916828063 1:168462724-168462746 AGGATGGAAAAGGAAGATGAAGG - Intergenic
917347999 1:174048823-174048845 AGGATGGCAAAATAATGTCAAGG + Intergenic
918506464 1:185260074-185260096 AGGATGGGAAAGGAAAACAATGG + Intronic
919083034 1:192889212-192889234 AGGATTGGAATGGAAGATGAAGG + Intergenic
919364736 1:196643750-196643772 AGAATGGCTAAGCAATCTGAAGG + Intergenic
919579839 1:199357829-199357851 GGCATGGCCAAGGAATATGCCGG - Intergenic
919645300 1:200088884-200088906 AGGATGGCCAAGGATTAAAATGG - Intronic
919739632 1:200973963-200973985 AGGAAGGGAAAGGAAGAAGAAGG + Exonic
921113875 1:212067953-212067975 AGAACGGAAAAGGAAGATGAAGG - Intronic
921324576 1:213978185-213978207 AGGAGGGCAAAGGAGAAGGACGG + Intergenic
921783907 1:219203040-219203062 AGATTGGAAAAGAAATATGAAGG + Intronic
921796345 1:219348814-219348836 AGGATGGCAAAGGAAGTTCTAGG - Intergenic
923800940 1:237207569-237207591 AGAAGGGCAAAAGAAGATGAAGG - Intronic
1063303052 10:4870205-4870227 GGGAGGGTAAAGGAACATGAAGG - Intergenic
1063826102 10:9899322-9899344 AGGTTGTCAAAGGAATTTGAAGG + Intergenic
1064314877 10:14245998-14246020 ATGATGGCAAAGGCAGATGACGG - Intronic
1066285258 10:33959679-33959701 AAGGTGGCAAAGGAAGTTGATGG - Intergenic
1066530731 10:36335968-36335990 ATGATGGCAAAGGTATATACAGG - Intergenic
1066550539 10:36551811-36551833 AGGATGGCTTAGGAATTTGGTGG + Intergenic
1066561764 10:36677423-36677445 AGGATGGTAAAGACATAGGATGG + Intergenic
1066740716 10:38516851-38516873 AGGAGGGCAATGGAATAGAATGG + Intergenic
1068196361 10:53722265-53722287 GGAATGACAAAAGAATATGAAGG + Intergenic
1070754999 10:78986550-78986572 AGGATGGAACTGGATTATGATGG + Intergenic
1071957438 10:90774679-90774701 AGGATGGCAGAGTAAAAAGATGG - Intronic
1072762820 10:98071852-98071874 AGGCTGGCAAAGTAGTTTGAAGG + Intergenic
1072931855 10:99671819-99671841 CAGATGGTAAAGGAACATGAAGG - Intronic
1073739594 10:106391861-106391883 AGTATGGCAAAGGATACTGAAGG - Intergenic
1075546733 10:123360748-123360770 AGGAAGTCAATGGAAAATGAAGG + Intergenic
1078010290 11:7568304-7568326 AGGATGGCAAAGAAAAAAGATGG - Intronic
1079596079 11:22249041-22249063 AGATTAGCAAGGGAATATGATGG + Intronic
1079935946 11:26616530-26616552 AGACAGGCAAAGGAAAATGAAGG + Intronic
1080441849 11:32301825-32301847 AGGATGCCATCTGAATATGATGG + Intergenic
1081335531 11:41861429-41861451 AGGAAGGCAAAGGTTTTTGAAGG - Intergenic
1081379025 11:42392405-42392427 AGGCTGGAAAGAGAATATGATGG - Intergenic
1083208710 11:61169181-61169203 AGGATGGCAAGGCAACAAGAAGG + Intergenic
1083860718 11:65418578-65418600 ACGTTGGCAAAGGCATTTGAGGG - Intergenic
1084452950 11:69250909-69250931 ATGCTGGGAAAGGAACATGAGGG + Intergenic
1085041496 11:73328937-73328959 AGGATGGAGAAGGAAGAAGAGGG + Intronic
1085232506 11:74984624-74984646 AAGATGGCACAGGAATATCGGGG - Intergenic
1085665125 11:78408238-78408260 AGGATGGCAAAAGGACATAAAGG + Intronic
1086103385 11:83125004-83125026 AGGAGGGCAAAGGAGTAGAAGGG - Intergenic
1086138841 11:83471732-83471754 AGAATGGGAAAGGAAGATGTAGG + Intronic
1087220028 11:95536821-95536843 AGGATGGCAGAGCAATAGAAAGG - Intergenic
1088051408 11:105519578-105519600 ATGGTGGCAAAGGAATGTGGTGG + Intergenic
1088888591 11:114027124-114027146 AAAATGGCAAAGGGATCTGAGGG + Intergenic
1089313790 11:117577046-117577068 AGAATGGCAATGGAGTGTGATGG + Intronic
1091711413 12:2743186-2743208 AAGGTGGCAAAGGAGGATGACGG + Intergenic
1092020113 12:5194750-5194772 AGGTTGGCATAGGAAAAGGAGGG - Intergenic
1092802901 12:12188373-12188395 AGGAAGGGAAAGAAAAATGAAGG + Intronic
1093978735 12:25452452-25452474 AGGATTGCAAAGGAGCATGGGGG - Intronic
1096039625 12:48502119-48502141 CCGATGGCAAAGGCACATGAGGG - Intergenic
1098273057 12:68787776-68787798 AACATGGGAAAGGAAAATGATGG - Intronic
1098368666 12:69734573-69734595 AGGATGGTAAAGCCACATGATGG + Intergenic
1100250905 12:92822548-92822570 TGGAAGCCAAAGGAATAGGAAGG - Intronic
1100777451 12:97989120-97989142 AGGAAGGGAAAGGAAAAGGAAGG + Intergenic
1101294841 12:103411142-103411164 AGGCTGGCAAATGAATCTGCAGG - Intronic
1101503420 12:105325465-105325487 AGCATTGCAATGGAATATGGTGG + Intronic
1106008845 13:25798376-25798398 GGGAGGGCACAGGAACATGATGG + Intronic
1107885117 13:44868704-44868726 ATGATGGCAATGGGTTATGATGG - Intergenic
1107999376 13:45892394-45892416 AGGAGGGCACAGGGAGATGAAGG - Intergenic
1109159308 13:58952081-58952103 AGAATGGAAAATGAATCTGAGGG + Intergenic
1112602718 13:100872616-100872638 TTGAAGGCAAAGGAATAAGAAGG - Intergenic
1113186417 13:107691138-107691160 AGAATGTCAAATGAAGATGAAGG + Intronic
1116879972 14:50156616-50156638 ATGATCGCAAAGGGAAATGAAGG + Intronic
1116899628 14:50349492-50349514 AGGATGGCAGAGGGAGATGACGG + Intronic
1117227616 14:53679147-53679169 AGGAGGGCAAACCATTATGATGG - Intergenic
1119559372 14:75578355-75578377 CGGGTGGCAAATGAATATGAGGG + Intergenic
1119964423 14:78898164-78898186 AGCATGGCAAAGGAAAATGTTGG + Intronic
1120185416 14:81388777-81388799 GGGATGGAAAAGGAATATCCCGG + Intronic
1121066042 14:90965916-90965938 AGTATGAGAAAGGAAAATGATGG + Intronic
1121463111 14:94097176-94097198 AGGAAGGCAAAGGAAGACAAAGG + Intronic
1123774090 15:23560794-23560816 AGAATGTCAAATGAAAATGATGG - Intergenic
1124471009 15:29985751-29985773 TGGATGGCAGAGAAATTTGATGG - Intergenic
1124986025 15:34615078-34615100 AGGATAGAAAATGACTATGATGG + Intergenic
1125436071 15:39646079-39646101 AGGATGGCTAAGGACGAAGAGGG + Intronic
1126024151 15:44429944-44429966 AGGATTGCATAGGAATGTCAGGG + Intronic
1126428032 15:48550524-48550546 AGCAGGGCAAAGGGAAATGAGGG - Intronic
1126879879 15:53083101-53083123 AGGATGGATCAGGAATAAGAAGG + Intergenic
1127114663 15:55713563-55713585 ATGATGGCAAAGAAAGCTGATGG - Intronic
1127328477 15:57917118-57917140 AAGATGCCAAGGGAAGATGAAGG + Intergenic
1127665520 15:61142313-61142335 AAAATGGAAAAGGAAGATGAAGG - Intronic
1128147263 15:65338675-65338697 AGGACGCCTAAGGAATATGCAGG - Intronic
1128725811 15:69987845-69987867 AAGATGGAAATGGAATATGCAGG - Intergenic
1129685615 15:77684710-77684732 AGGATGGCCAAGGAAATGGATGG + Intronic
1131002378 15:88949264-88949286 TGGATGCCAACGGAACATGAAGG + Intergenic
1131071778 15:89470751-89470773 AGGATGGCAAAGAAACAGCATGG - Intergenic
1133693309 16:8236739-8236761 AGGTAGGTAGAGGAATATGAAGG - Intergenic
1133814042 16:9182944-9182966 AGGATGGGAAGGGGAGATGATGG + Intergenic
1134812963 16:17182838-17182860 AGGATTACAAAGGAATTTGAAGG + Intronic
1135652003 16:24214367-24214389 TGGATGGCAAAGGCATGAGATGG - Intronic
1135943558 16:26843672-26843694 GGGATGGCAAAAGAAGCTGAAGG - Intergenic
1136869342 16:33791075-33791097 AGTATGGCAAAGGAGTATTGGGG + Intergenic
1137984367 16:53095116-53095138 GGGAAGGCAAAGTAATAGGAAGG - Intronic
1138021650 16:53488381-53488403 AGGCTGACAAGGGAGTATGAGGG + Intronic
1140941679 16:79726972-79726994 AGGAAGGCAATGTAATATAATGG + Intergenic
1203102831 16_KI270728v1_random:1324993-1325015 AGTATGGCAAAGGAGTATTGGGG - Intergenic
1143442105 17:6983011-6983033 TGGATGATAAAGGAATATGGGGG - Intronic
1144090393 17:11851018-11851040 AGGATGGGAAATGACTAAGAAGG + Intronic
1144236513 17:13266249-13266271 AGGATGGTCAAGTGATATGAGGG + Intergenic
1145697993 17:26804892-26804914 TGGAAGGGAAAGGAATATAATGG + Intergenic
1147371463 17:39995777-39995799 AGGAGGGCAGAGGAATGGGATGG + Intronic
1147539513 17:41345452-41345474 AGAATGGCAAATTCATATGAAGG - Intergenic
1147736987 17:42645559-42645581 TGAATGGCAAAGAAAAATGAAGG + Intergenic
1148544476 17:48506877-48506899 ATGCTGTCAAAGGAGTATGAAGG + Intergenic
1149281495 17:55110296-55110318 AACATGGCAAAGGAAAATTAAGG - Intronic
1203198543 17_KI270729v1_random:254374-254396 TGGAAGGCAAAGGAATAGAATGG + Intergenic
1203201556 17_KI270729v1_random:279809-279831 AGGATTGGAAAGGAATAGAATGG + Intergenic
1203208148 17_KI270730v1_random:55133-55155 TGGAAGGCAAAGGAATAGAATGG + Intergenic
1203211150 17_KI270730v1_random:80505-80527 AGGATTGGAAAGGAATAGAATGG + Intergenic
1152979684 18:264909-264931 AGGATGCCAGAGGAAAATGAGGG + Intronic
1155830242 18:30507771-30507793 AGGATGGGAAAGGAAGAAAAGGG + Intergenic
1158364108 18:56711463-56711485 AAAATGGTAAAGAAATATGAAGG - Intronic
1158718909 18:59906054-59906076 GGGATGGCAAAGGAGTCTGAAGG + Intergenic
1158737316 18:60097970-60097992 AGAAAGGCACAGGGATATGAGGG - Intergenic
1158980109 18:62751758-62751780 GGGAAGGCAAAGGACTATGTGGG + Intronic
1159482705 18:69010799-69010821 AGAATTGCAAATGAAGATGATGG + Intronic
1159925283 18:74263636-74263658 ATGATGGAAATGGAATATAAAGG - Intronic
1161877673 19:6924509-6924531 TGGATTGCAAAGGATAATGAAGG + Intronic
1164614062 19:29655601-29655623 AGGCTGGCAAAGTCATCTGAAGG - Intergenic
1167431430 19:49457239-49457261 AGGATGAGAAAGAAATATGGAGG + Intronic
1168014432 19:53560893-53560915 TGTATGGCAAAGGAAAATTAAGG - Intronic
925870865 2:8269259-8269281 AGAATGTCACAGGAAGATGAAGG + Intergenic
925874035 2:8296933-8296955 TGGTTGACACAGGAATATGAAGG - Intergenic
925889957 2:8425594-8425616 AGGATGGAAAAGGAGTATGAGGG + Intergenic
927461103 2:23298793-23298815 ATGATGACAAAGGGATATGAGGG - Intergenic
928527599 2:32158329-32158351 AGGATTTGAAAGGAATATGTAGG - Intergenic
928660761 2:33499830-33499852 ACCATGTCAAAAGAATATGATGG + Intronic
928958481 2:36896865-36896887 ATGATGGCAAAGAAAAATAAGGG + Intronic
929351830 2:40965624-40965646 AGGATGGGAAAGGAAGTGGATGG - Intergenic
929404046 2:41620670-41620692 AGGATGGCTTAGCAATAAGAGGG + Intergenic
929919535 2:46162365-46162387 AGGATGGCAAAGAGAAAGGATGG + Intronic
930275798 2:49309899-49309921 AGTACTGCAAAGGGATATGAGGG + Intergenic
930603177 2:53465579-53465601 TGGATGGCAAAGGGAAATTAAGG - Intergenic
930855006 2:56005942-56005964 AGGATAATAAAGGAATATTACGG - Intergenic
931006246 2:57852903-57852925 AGGATGGGAAAGGAAGAGAAAGG + Intergenic
932579567 2:72984656-72984678 AGGCTTGCTAGGGAATATGAGGG + Intronic
933307830 2:80624060-80624082 AGCATGACAAAGAAAAATGAAGG - Intronic
933384596 2:81593813-81593835 AGGCTGGGAAAGGAATATTAGGG + Intergenic
938175442 2:129122917-129122939 AGGATGGAAAACAAATTTGAGGG - Intergenic
938275786 2:130020523-130020545 AGGAGAGCAAAGGACAATGAAGG - Intergenic
938326728 2:130411244-130411266 AGGAGAGCAAAGGACAATGAAGG - Intergenic
938363216 2:130710215-130710237 AGGAGAGCAAAGGACAATGAAGG + Intergenic
938439589 2:131316798-131316820 AGGAGAGCAAAGGACAATGAAGG + Intronic
939825690 2:147012822-147012844 AGGAGGGCAAAGGACTAGGTTGG - Intergenic
939960062 2:148558583-148558605 AGGCTGGCAAAGGAAGGCGAGGG + Intergenic
940028599 2:149236112-149236134 AGGAAGAAAAAGCAATATGAAGG + Intergenic
941087091 2:161130665-161130687 AGGATGGGAAGGGAAAAGGAGGG - Intergenic
942934834 2:181542165-181542187 AGGGGGGCAAAGCAATAGGATGG + Intronic
943176978 2:184489077-184489099 AGGATGGCACAGGAATAAGCAGG + Intergenic
945397574 2:209338985-209339007 AGGAATACAAATGAATATGATGG - Intergenic
946833333 2:223747022-223747044 AGGAAGGAAAAGGAAAAGGAAGG + Intergenic
947337067 2:229098333-229098355 AGGAGGGGAAAGGAATATTATGG + Intronic
948138377 2:235654194-235654216 AGGATGACAAAGGCCCATGAAGG + Intronic
1169717178 20:8632851-8632873 AGGATGGCATAGGCTTTTGAAGG + Intronic
1170645989 20:18196347-18196369 GGGATTGCAATGGAATATAAGGG + Intergenic
1170787066 20:19476872-19476894 AGGAGGGCAAAAGAATCAGAGGG - Intronic
1171078692 20:22155695-22155717 AAGATGGGAAAGGAATTTTATGG + Intergenic
1171335287 20:24379965-24379987 AGGAGGGCAAATGAATAAGAAGG - Intergenic
1172169434 20:32920167-32920189 AGAATGGCAGAAGAATATGTTGG + Intronic
1172647246 20:36478370-36478392 GGGAGGGGAAAGGACTATGAAGG + Intronic
1173070306 20:39758121-39758143 AGGATGGCAGGGAAAAATGAAGG - Intergenic
1173169453 20:40712081-40712103 AGGAGGGGAAGGGAAGATGAAGG + Intergenic
1174934013 20:54847599-54847621 AGATTGGCAAAGGTATATGGAGG + Intergenic
1175284409 20:57828481-57828503 AGCATGGCATTGGAATATAAAGG + Intergenic
1176529150 21:7944706-7944728 AGGAGGGCAATGGAATGTAATGG - Intergenic
1176938584 21:14896744-14896766 AGGATAGCAAAGGAAAATATTGG + Intergenic
1178671124 21:34592516-34592538 TAGATGGCAAAGTAATATCATGG + Intronic
1180581310 22:16841344-16841366 ATGATGGCAAAGAAAAATAAGGG + Intergenic
1181824073 22:25499514-25499536 GGGAGGGCAAAGGAACATAAAGG - Intergenic
1181832376 22:25571191-25571213 GGGATGGCACAGGAAAACGAGGG - Intronic
1182910733 22:33982065-33982087 AGGATGGAACAGGAAGAGGAGGG + Intergenic
1184480811 22:44745819-44745841 AGTATGGTAAAGGCATTTGAGGG + Intronic
949486278 3:4542514-4542536 AGGGTGACAAACGAGTATGAGGG + Intronic
949656576 3:6227455-6227477 AAGATGGCAAACCAAAATGAGGG + Intergenic
950396048 3:12734812-12734834 AGGATGGCATGGGATTCTGAAGG + Intronic
951371001 3:21847759-21847781 CTGATTGCAAAGGAATAAGAGGG - Intronic
951580265 3:24155653-24155675 AGTATGACAAAGGAAAATGATGG - Intronic
952148437 3:30559419-30559441 ATGAGGAGAAAGGAATATGAAGG + Intergenic
953311131 3:41880493-41880515 AGAATGTCAGAAGAATATGATGG - Intronic
953691548 3:45124177-45124199 AGAATTGCAAAGAAATAGGATGG - Intronic
956738733 3:72258770-72258792 AGGATGACAAAGAAATAGGAAGG + Intergenic
956800524 3:72753774-72753796 AGCATAGCTATGGAATATGACGG + Intronic
956986741 3:74710165-74710187 AGTGTGGCAAAGGAAAATGATGG - Intergenic
957622804 3:82616701-82616723 AGTATGACATTGGAATATGAAGG - Intergenic
957701067 3:83713456-83713478 TGGATGGGAAAAGAATAAGACGG - Intergenic
958713281 3:97744833-97744855 AGAATGGCATAGGAGTATGAAGG + Intronic
960455827 3:117870278-117870300 AGGATGACATAGGGAAATGATGG + Intergenic
960684412 3:120282744-120282766 AGGACGGCCATAGAATATGAGGG + Intronic
961009702 3:123427413-123427435 AGAGTGGCCAAGGAATATGGTGG - Intronic
963855891 3:150252979-150253001 AAGATTGCAAAGAAATACGAAGG + Intergenic
964231163 3:154469670-154469692 AGGATCCAAAAGGAATATGGAGG - Intergenic
964383619 3:156124083-156124105 AGAATGGCTAAGCAATATTATGG - Intronic
965035936 3:163438051-163438073 GGGATTGCTAAGTAATATGATGG - Intergenic
965439065 3:168690999-168691021 AGGATGGAAATGGAATCAGATGG + Intergenic
965617930 3:170613653-170613675 ATGATGGCAAAACAATATGATGG + Intronic
965620353 3:170636878-170636900 AGGTTGGCAATGGAAGAGGAGGG - Intronic
967892205 3:194371478-194371500 AGGATGGAAGAGGAAAAAGAGGG - Intergenic
969641046 4:8398986-8399008 CGGATGGAAAAGGAGCATGATGG - Intronic
970270946 4:14346836-14346858 ATGATTGCAAATGAATCTGAAGG + Intergenic
970818750 4:20188852-20188874 AGGATGGAAGAGGAAGAGGAGGG + Intergenic
970898412 4:21130133-21130155 AGTATGGCTTAGGGATATGAGGG - Intronic
972860141 4:43158381-43158403 AGGATGGAAAAGGAAAAGAAAGG - Intergenic
973263826 4:48190774-48190796 AGGCTGGCAAATGTAAATGATGG + Intronic
973911833 4:55589597-55589619 AGGATGGGAGATGAATAGGAGGG - Intronic
974217025 4:58861478-58861500 AGGATTGAAAATGAATATCAAGG - Intergenic
974722197 4:65754952-65754974 TGGATGGCAACGGAAAATTATGG + Intergenic
976108131 4:81641320-81641342 AGCATGGTAAAGGAAAAGGAGGG - Intronic
976988538 4:91333461-91333483 GGGATAGCAAATGAATATGATGG - Intronic
977399032 4:96508990-96509012 AGGAGGGCAGAGGAAGATGGTGG + Intergenic
977433359 4:96960896-96960918 AGGATGGGGAAGGAATATGGAGG - Intergenic
977922352 4:102659635-102659657 AGGATGGTAAAGAAATCTGATGG - Intronic
978277335 4:106967831-106967853 AGGAAGGCAAAGAAAGAAGAGGG + Intronic
978400624 4:108326544-108326566 ATGATGGAACGGGAATATGAAGG + Intergenic
979475443 4:121151655-121151677 ATTATGGCAATGGAATATGCTGG + Intronic
979565797 4:122152709-122152731 AGGATGGCAAAGGAATATGAAGG - Intronic
979936185 4:126699093-126699115 ATTATGGCAAAAGAATATAATGG + Intergenic
980099711 4:128529457-128529479 AGGCTGGCAAAGGTAGATCATGG + Intergenic
980521298 4:133938952-133938974 GGGAAGGCAAAGGAATGTAAAGG - Intergenic
980875637 4:138659392-138659414 AGGAGGGCAAAGGAGTGTGAGGG + Intergenic
982216799 4:153089519-153089541 AGAAAGGCAAAGGAACATAAGGG + Intergenic
984147203 4:176077241-176077263 AGGATAGAAAAGGTACATGATGG + Intronic
985772516 5:1821792-1821814 AGGAAGGCCAAGGAATGTCAAGG - Intergenic
985772544 5:1821933-1821955 AGAATGGCCAAGGAATGTCAAGG - Intergenic
987300844 5:16597087-16597109 AGGCTGGCAAATGCATATAATGG + Intronic
988230454 5:28471506-28471528 AGGATGGTGAAGCAAAATGAAGG - Intergenic
988679647 5:33472378-33472400 AGGAAGGCAGAGGAAAATGGGGG - Intergenic
989666204 5:43857383-43857405 AGGAAGGCATAGACATATGAAGG - Intergenic
990349414 5:54900741-54900763 AAGATGGCAGAGGAATAGAAGGG - Intergenic
991441381 5:66653545-66653567 AGCATGGCAACAGATTATGAAGG - Intronic
992372155 5:76154297-76154319 GAGAAGGCAAGGGAATATGAAGG - Intronic
993316631 5:86415202-86415224 AAGCAGGCAAAGAAATATGATGG + Intergenic
993832329 5:92775668-92775690 AGGATGTTAAGGGAATTTGAAGG + Intergenic
994722084 5:103392102-103392124 AAGATGGCAATGGAATATTAAGG + Intergenic
994757036 5:103806571-103806593 AGGATAGCATAAGAATATGGAGG + Intergenic
995861873 5:116649310-116649332 TGGATGACAAAAGAATAAGATGG + Intergenic
996416918 5:123220589-123220611 AACAAGGCAAAGGAATATGAAGG - Intergenic
996652814 5:125901629-125901651 AGGATGGCAGAACAACATGATGG + Intergenic
997499140 5:134357732-134357754 AGGATGGCAGAGGGATAGGATGG - Intronic
999583954 5:153070141-153070163 AGGAAGGGGTAGGAATATGAGGG - Intergenic
999638648 5:153648894-153648916 TACATGGCAAAGGAAAATGAAGG + Intronic
1000012784 5:157248435-157248457 AGTATGGCACATGAAAATGAGGG - Intronic
1000231838 5:159322888-159322910 AGGAAAGCAAAGGAAAATGGAGG + Intronic
1001142729 5:169158681-169158703 GGGAGGGCAAAGGAACATAAAGG + Intronic
1001405147 5:171471086-171471108 AGGATGGCAGAGCAAAGTGATGG + Intergenic
1003513208 6:6798855-6798877 TGGCTGGCAAAGGAAGATGGTGG + Intergenic
1004583554 6:16977624-16977646 AGGATAGCAAAGGAAGCAGATGG + Intergenic
1006146990 6:31965547-31965569 GGGATGGGAATGGGATATGAAGG + Intronic
1007108809 6:39301280-39301302 AGGATGACGAAGGAATAGGAGGG - Intronic
1007138202 6:39543310-39543332 AGGAAGGAAAAGGAATGTGAGGG + Intronic
1007836666 6:44679068-44679090 AGGACGGCAGAGGAAGATGCTGG - Intergenic
1008360043 6:50606363-50606385 ACAATGGCAGAGGAATGTGATGG + Intergenic
1008493077 6:52106148-52106170 AGGAGGGAAAAGGATTCTGAAGG + Intergenic
1011372719 6:86655346-86655368 GGGAGAACAAAGGAATATGAAGG + Intergenic
1012910878 6:105116430-105116452 AAGATGGTAAAGGAGTAAGAGGG - Intronic
1012990667 6:105922602-105922624 AGGAAGGCAAAGGAAGAAGGGGG + Intergenic
1013489767 6:110634769-110634791 TTGATGACAAAGTAATATGATGG + Intronic
1013991105 6:116254199-116254221 AAGAAGACAAAGGAATACGATGG - Intronic
1014209844 6:118696868-118696890 AGGATGGCAAAGCAAAAAGATGG - Intronic
1014846706 6:126286654-126286676 AGAAAGGCCAAGGAATCTGAGGG - Intergenic
1015486803 6:133780895-133780917 AGGAAGGGAAAGAAAAATGAAGG + Intergenic
1015690563 6:135917494-135917516 AGGATTCCAAAGAAATATAATGG - Intronic
1015830782 6:137366303-137366325 TGGATGGGAAAGGCAAATGAAGG + Intergenic
1016247609 6:142002533-142002555 AAGATAGAAAAGTAATATGATGG + Intergenic
1017104623 6:150875732-150875754 AGGATGGCAGCGGAGTATGGTGG + Intronic
1019146451 6:169978298-169978320 AGGATGGCAGAGGAAAAAGCTGG + Intergenic
1021968223 7:25943076-25943098 AGGATGGCAGAGGAAAAAGATGG + Intergenic
1021975397 7:26007085-26007107 AGGATGGCAAGGGAAGAGGCTGG + Intergenic
1022893117 7:34721109-34721131 GGGAGGGTAAAGGAATAGGATGG + Intronic
1023811696 7:43916960-43916982 AGGAGGAGAAAGGAATAAGAAGG - Intronic
1026167296 7:67921829-67921851 AGGATGGCAATGGAATTTATAGG + Intergenic
1026485356 7:70814797-70814819 ATGATGGCACAGGAATATGAAGG + Intergenic
1028738175 7:94241480-94241502 AGCAAGTCAAAGGAATTTGAAGG + Intergenic
1029297792 7:99555232-99555254 AGAATGCCAAATGAAGATGAGGG + Intronic
1030207930 7:106968566-106968588 AGGATGACAAAGGAGTCTTAGGG + Intergenic
1031795674 7:126172064-126172086 AGGATGGCAAGGGATTACTATGG - Intergenic
1034096754 7:148415737-148415759 AGGCAGGCAATGGAATATAATGG + Exonic
1034850782 7:154491522-154491544 CCAATGGCAAAGGAAGATGATGG - Intronic
1036229767 8:6989901-6989923 AGGTTGACAAAGGCAGATGAGGG - Intergenic
1036232218 8:7009004-7009026 AGGTTGACAAAGGCAGATGAGGG - Intronic
1036517448 8:9458023-9458045 AGGAAGGCAAGGGCAGATGACGG - Intergenic
1038153422 8:24963691-24963713 AGGATGCCATAGGAATCAGATGG - Intergenic
1038524202 8:28259392-28259414 AGGATCGCAAAAGAATCAGATGG + Intergenic
1039965870 8:42283360-42283382 AGCATGGCAAAGGGAAATTAAGG + Intronic
1040725838 8:50380000-50380022 AGGATGGCAGAGAAATTGGAGGG + Intronic
1040751281 8:50712227-50712249 AGGATGGACATGGAATTTGAGGG + Intronic
1041290658 8:56305109-56305131 AGGATGGTTAAAGAATTTGAGGG - Intronic
1041537675 8:58945046-58945068 AGGGTGGCAAAGGAAGTGGAAGG + Intronic
1042782046 8:72502179-72502201 AGGATGGCAAAAGGCTGTGAGGG + Intergenic
1044851975 8:96437338-96437360 AGTGTGGCAAAGGGATATGCAGG - Intergenic
1045367271 8:101488276-101488298 AGGATAGTAAAAGAACATGAAGG + Intergenic
1047168538 8:122466899-122466921 ATGTTGGCAAAGCAATGTGAGGG - Intergenic
1047805465 8:128355048-128355070 AGAAAGGCTAAGGAATATCAAGG - Intergenic
1047866201 8:129026998-129027020 GGGATAGAAATGGAATATGAGGG + Intergenic
1048182453 8:132208612-132208634 AGTAAGGGAAAGGAATATCAGGG + Intronic
1048189778 8:132277493-132277515 AGGATGCCAAATCAATCTGAAGG + Intronic
1049491214 8:142904106-142904128 AGGATTGCAAAGGTCCATGAGGG - Intronic
1049492066 8:142910677-142910699 AGCATGGGAAAGGAATAAGGGGG - Exonic
1050344927 9:4676865-4676887 AGGAAGGGAAAGGAAAAGGAGGG - Intergenic
1051178947 9:14390434-14390456 GATATGTCAAAGGAATATGAGGG + Intronic
1051797233 9:20886137-20886159 TGGATGGCAAAGGACAAAGATGG - Intronic
1051959569 9:22741860-22741882 AGAAGGGCAAAGGAATAAAATGG + Intergenic
1052728236 9:32256199-32256221 AAGATGGCAAAAGAATTTGTGGG - Intergenic
1052943031 9:34145477-34145499 AGGATGGCAAAGCAACGAGATGG + Intergenic
1053326963 9:37162360-37162382 AAGATCACAAAGGAACATGAGGG - Intronic
1053505432 9:38639006-38639028 AGGAAGGGAGAGGACTATGATGG - Intergenic
1055632660 9:78239201-78239223 AGGATGGACAAGCAATATGTAGG - Intronic
1055870773 9:80876669-80876691 AGGAGAGCAAAGAAATGTGATGG + Intergenic
1056809367 9:89752381-89752403 AGGGTGGGGAAGGAATATGTGGG + Intergenic
1056998904 9:91489397-91489419 AGGGTGGGAAAGGAATAGGAAGG + Intergenic
1057138430 9:92711498-92711520 AGCATGGAAAAGGAATAGGAAGG - Exonic
1057690566 9:97280475-97280497 AGGATGGTGAAGGCACATGATGG - Intergenic
1057714847 9:97484383-97484405 AAGCTGGCAAAGGAACAGGATGG - Intronic
1060500189 9:124147384-124147406 GGGATGGCAGATGAAGATGAAGG + Intergenic
1061105916 9:128530299-128530321 AAGAGGGCTAAGGAAGATGATGG - Intronic
1203729420 Un_GL000216v2:77397-77419 AGGAATGCAATGGAATATAATGG - Intergenic
1203348547 Un_KI270442v1:57214-57236 AGGATGGAAATGGAATAGCAAGG + Intergenic
1187047607 X:15662869-15662891 AGGCAGGCCAAGGAATATGTGGG - Intronic
1187079268 X:15969226-15969248 AGGATGAAAAAGGAGAATGAAGG - Intergenic
1187653185 X:21435017-21435039 AGCATGATAAAGGAACATGAAGG - Intronic
1188437847 X:30182957-30182979 AAGAAGGCAAAAGAATATAATGG + Intergenic
1188511609 X:30942279-30942301 AGGATGGCCAAGGAATATAGGGG - Intronic
1188730896 X:33645466-33645488 AGGATGAGAAAGGAAGAGGAAGG + Intergenic
1189127834 X:38466851-38466873 AAAATGGCAAAGAAATCTGAAGG - Intronic
1190405679 X:50085046-50085068 AGGATGGCTCAGGAAAATGATGG - Intronic
1190552629 X:51600227-51600249 AGGATGGCAAAGGGACAGGTTGG + Intergenic
1190623370 X:52311485-52311507 TGGTTGGGAAAGGATTATGATGG - Intergenic
1190804653 X:53823959-53823981 AGGAGGGCAGAGGAAGATGGTGG + Intergenic
1190962388 X:55265236-55265258 AGGATGGCAAGTGAACAAGAGGG + Intronic
1191860811 X:65665565-65665587 GGGAAGGCAAAGGAAGAGGATGG + Intronic
1191861030 X:65667033-65667055 AGGATGGGTAGGAAATATGATGG + Intronic
1191912739 X:66168297-66168319 AGGAGGGAAAAGGAAGAGGAAGG + Intronic
1193642516 X:84028653-84028675 AGGTTGGCAGAGCAAGATGATGG + Intergenic
1194976931 X:100405938-100405960 AAGATGGGAAAGGGAGATGAGGG - Intronic
1195768914 X:108327667-108327689 GGTATTACAAAGGAATATGAGGG + Intronic
1196595756 X:117543667-117543689 AGGCTGGCAAAGGAAGGTGGGGG - Intergenic
1197638944 X:128947087-128947109 TGGAGGGCAAAGGAAGAGGAGGG - Intergenic
1197686380 X:129443547-129443569 AGGATGGCTTAGGAAGATGAAGG + Intergenic
1198488277 X:137110332-137110354 AGGATGAAAAAGCAGTATGAAGG - Intergenic
1199147706 X:144389352-144389374 AGGATGGCTAAGTAATAGAAAGG - Intergenic
1199963387 X:152797598-152797620 AGAAGGGTAAAGGGATATGAAGG - Intergenic
1201197928 Y:11512418-11512440 TGGAATGCAAAGGAATATAATGG + Intergenic
1201584039 Y:15541215-15541237 AGAATTGCAAAGGAAAATTAAGG + Intergenic