ID: 979565798

View in Genome Browser
Species Human (GRCh38)
Location 4:122152719-122152741
Sequence GCTGTAGGTAAGGATGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565798_979565813 27 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565813 4:122152769-122152791 GGTCAGTGGCAAAGTCTGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 218
979565798_979565805 -1 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565798_979565814 28 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565814 4:122152770-122152792 GTCAGTGGCAAAGTCTGGAAGGG 0: 1
1: 0
2: 6
3: 29
4: 236
979565798_979565807 3 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565798_979565812 23 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565812 4:122152765-122152787 TGGAGGTCAGTGGCAAAGTCTGG 0: 1
1: 0
2: 4
3: 126
4: 1142
979565798_979565810 13 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565810 4:122152755-122152777 AACCGAGGGTTGGAGGTCAGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
979565798_979565808 6 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565808 4:122152748-122152770 ACCTATAAACCGAGGGTTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 72
979565798_979565803 -2 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565803 4:122152740-122152762 GCCCTGGCACCTATAAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565798 Original CRISPR GCTGTAGGTAAGGATGGCAA AGG (reversed) Intronic
900464389 1:2817986-2818008 GCTATAGGGAAGCATGGGAAGGG - Intergenic
900765353 1:4501261-4501283 ACTTTGGGGAAGGATGGCAAGGG + Intergenic
901046251 1:6397620-6397642 CCTGTTTTTAAGGATGGCAATGG + Intergenic
902359978 1:15937138-15937160 GGTGTAGGGAAGGAAGGCAAAGG - Intronic
902528253 1:17073568-17073590 GTTGGACATAAGGATGGCAATGG + Intronic
907235409 1:53041797-53041819 CCTGTAGGAAAGGATGACATCGG + Intronic
910151413 1:84151407-84151429 GCTGAAGGTTGGGATGGCAGTGG + Intronic
910210483 1:84787619-84787641 GCTGTGGGAGAGGACGGCAATGG + Intergenic
910820057 1:91336391-91336413 GATGGAGGTAAGGAGGGAAAGGG - Intronic
912299327 1:108497806-108497828 ACTGTAGGTAAAGATGTAAAAGG - Intergenic
913679545 1:121176032-121176054 GCTGGAGGTTAGGATGGCTGTGG - Intronic
914031378 1:143963678-143963700 GCTGGAGGTTAGGATGGCTGTGG - Intronic
914158069 1:145104285-145104307 GCTGGAGGTTAGGATGGCTGTGG + Intronic
915055675 1:153127073-153127095 GGTGTAGGTGAGGATGACACAGG + Intergenic
915327347 1:155087110-155087132 GCAGTGGACAAGGATGGCAAGGG + Exonic
915551064 1:156634693-156634715 GTTGGAGGTAAGGATGTCCAGGG - Intergenic
915677134 1:157542337-157542359 GCAGTAGGTAAGAAAGGCACGGG - Intronic
916034123 1:160905960-160905982 GGTGGAGGAAAGGAGGGCAATGG - Intergenic
916281550 1:163057158-163057180 TCTGGAGGGAAGGAAGGCAAGGG - Intergenic
917918366 1:179727433-179727455 ACTGTAGGTAGGGGTGGTAAGGG + Intergenic
920466850 1:206194577-206194599 GCTGGAGGTTAGGATGGCTGTGG - Intronic
922389419 1:225124234-225124256 GCTGAAGGTTAGGATGGCTGTGG + Intronic
923053015 1:230401945-230401967 GCTGTGGGGAGGGAGGGCAAGGG + Intronic
923338827 1:232991170-232991192 GCTGTATGGAAGGCTGGCCAGGG + Intronic
1062912353 10:1219785-1219807 GGTGAAGATAATGATGGCAATGG + Intronic
1062912406 10:1220125-1220147 GGTGAAGATAATGATGGCAATGG + Intronic
1063538449 10:6908598-6908620 GCTGTAGGAAAGGAGGGCAAGGG - Intergenic
1064114556 10:12567220-12567242 GCTGAAGGAGAGGATGGAAAAGG - Intronic
1065367225 10:24948645-24948667 TCTGTTGATAAAGATGGCAAGGG - Intronic
1066309103 10:34178235-34178257 GCTGTAGGTAATTATGTCAGAGG - Intronic
1067029156 10:42868738-42868760 GCTGGTGGTGAGGATGGAAAGGG - Intergenic
1068579931 10:58728083-58728105 GCTGAAGGTTAGGATGGCTGTGG + Intronic
1070768555 10:79069734-79069756 GCTGGATTTCAGGATGGCAAGGG + Intronic
1071509751 10:86254042-86254064 GCTGTAGGTCTGGGTGGCAAGGG - Intronic
1074918890 10:117986840-117986862 GCAGTGGGTAAGGAGGGCACGGG + Intergenic
1076107241 10:127833291-127833313 TCTGTAAGTAAGGGTGGCCATGG + Intergenic
1078694850 11:13620736-13620758 GCTGAAGTGAAGGATGGCCAGGG - Intergenic
1079085594 11:17442724-17442746 GATGGAGGTATAGATGGCAAAGG + Exonic
1080463446 11:32475541-32475563 CCTGGAGGTTAGCATGGCAATGG + Intergenic
1080967147 11:37225505-37225527 GCTGTAAGTACTGATGGCAGTGG - Intergenic
1082816597 11:57513910-57513932 GCTGGGGGGAGGGATGGCAAAGG - Intronic
1085345783 11:75767519-75767541 GCTGTAGGTCAGGAGGGCAGTGG - Intronic
1088754848 11:112877316-112877338 GCTGTAGGAAAGCCTGTCAAAGG - Intergenic
1088816192 11:113422684-113422706 GCTGTAGTAAAGGAAGCCAAGGG + Intronic
1089249857 11:117150710-117150732 GCTGTATTTGAGGATGGCAAGGG + Intronic
1091460338 12:639568-639590 GCCATAGGTTAGGGTGGCAATGG - Intronic
1093131803 12:15400511-15400533 GAACTAGGTAAGGATGGCAGTGG - Intronic
1093687132 12:22070016-22070038 TCTGGATGTAAGGATGGGAATGG - Intronic
1095657944 12:44693132-44693154 GCTGAAGGTTAGGATGGCTGTGG - Intronic
1096804225 12:54130530-54130552 GTTGGAGATAAGGATAGCAAAGG - Intergenic
1097260264 12:57715912-57715934 GCTGTAGGGAAGGGTGACAGAGG - Exonic
1099243969 12:80172517-80172539 CCTGCAGGTCAGGAGGGCAATGG + Intergenic
1099251194 12:80257008-80257030 GATGTAGGTAAGGATGAGAAGGG + Intronic
1099969772 12:89488898-89488920 GCTCTGGGTATGGTTGGCAAAGG - Intronic
1100760224 12:97798917-97798939 GCAGAAGGAAAGGTTGGCAAAGG + Intergenic
1101647576 12:106645372-106645394 GCTCTGGGTAAGGGCGGCAAGGG - Intronic
1102077583 12:110072457-110072479 GGTGTTGGAAATGATGGCAAAGG + Intronic
1103011802 12:117463764-117463786 GCTGTAGGTGGGGATGGGAATGG + Exonic
1104236006 12:126937072-126937094 GCTGTAGGTAATTTTGGAAAAGG + Intergenic
1104362331 12:128145709-128145731 GCTGGAGGACAGGATGGGAACGG + Intergenic
1105572431 13:21615731-21615753 TCTCTAGGGAAGGATGGAAATGG - Intergenic
1107283369 13:38761959-38761981 GCTGTAGGCAAGAGGGGCAAAGG + Intronic
1107446099 13:40471583-40471605 GCTGTGGATTAGGGTGGCAACGG + Intergenic
1107833884 13:44398214-44398236 GCTGTGGGGAAGGCTGGCCAGGG - Intergenic
1108127875 13:47264170-47264192 GTTGTAGGTGAGGATGGGGAAGG + Intergenic
1110735646 13:78933332-78933354 GCTGAAGGTTGGGATGGCTATGG - Intergenic
1110995712 13:82106443-82106465 GCTGAAGGTAAGGATGGCTGTGG + Intergenic
1112571190 13:100595071-100595093 GCTGTAGGTAATATTGGAAAAGG - Intergenic
1113903798 13:113810026-113810048 GGTGTAGGTAAGGCTGAGAATGG - Intronic
1115929348 14:38473237-38473259 TCTGAAGGTAAGGATGAGAAAGG - Intergenic
1116387645 14:44351150-44351172 GTTGTAGGTAGAGATGGCATAGG - Intergenic
1117540004 14:56737773-56737795 GCTCTACCTAAGGGTGGCAAGGG - Intergenic
1119001437 14:70885630-70885652 GTTGGAGGGAATGATGGCAATGG - Intergenic
1119599367 14:75964741-75964763 CCTGTAGGTAAGGACTCCAAAGG + Intronic
1124669664 15:31627059-31627081 GCTGAAGGTTAGGGTGGCTATGG + Intronic
1126443924 15:48720769-48720791 GATGTAGGAAAGGATAGCAGTGG - Intronic
1126578666 15:50222168-50222190 GCTGTAAGTAAAGATCACAAAGG - Intronic
1128027477 15:64450531-64450553 GCTGTGGGCAATGATGGTAAGGG - Intronic
1128706648 15:69841799-69841821 ACTGAAGGTAAAGAAGGCAACGG - Intergenic
1129525702 15:76212733-76212755 GCTGTGGGCAAGGCTGGCAGAGG - Intronic
1129609628 15:77042984-77043006 ACTGTGGGTCAGGCTGGCAAAGG - Exonic
1130565428 15:84990380-84990402 GCTGGGGGTAAGAATGGAAAGGG - Intronic
1130899716 15:88198245-88198267 GCAGTGGGTAAGGATGGGAAGGG - Intronic
1131391230 15:92050525-92050547 GATGTGGGTAATGAGGGCAAGGG - Intronic
1131394538 15:92076229-92076251 GCTGGAGGTGAGGTTGGAAAGGG + Intronic
1133018886 16:2957443-2957465 GTTGCTGGCAAGGATGGCAAAGG + Intergenic
1133782364 16:8949538-8949560 TTTGGAGGTAAGGATGGCAGCGG - Intronic
1134704515 16:16293059-16293081 GCTGCAGGGAAGGCTGGAAAAGG + Intronic
1134963027 16:18419055-18419077 GCTGCAGGGAAGGCTGGAAAAGG - Intronic
1134967322 16:18501654-18501676 GCTGCAGGGAAGGCTGGAAAAGG - Intronic
1135834908 16:25816377-25816399 GCTGGAGGTACAGATGGCAAAGG - Intronic
1137390603 16:48078271-48078293 GCAGTAGGGAGGGAAGGCAAGGG + Intergenic
1138141980 16:54576609-54576631 GGTATTGGTAAGGCTGGCAAAGG - Intergenic
1139171165 16:64631187-64631209 GCTGTAGCTAAGAATGCCACAGG - Intergenic
1142432669 16:90038669-90038691 GGTGCAGGTGAGGATGGAAACGG - Intronic
1144546338 17:16199527-16199549 GGTGGAGGGAAGGATGGGAAAGG - Intronic
1147320407 17:39642497-39642519 GCTGTAGGGAAGGGTGTAAATGG + Intronic
1150663572 17:67108592-67108614 GCTGGAGGTGAGGATGGTGATGG + Exonic
1152795285 17:82303442-82303464 TCTGTGGGTAAGGAAGGAAAGGG + Intergenic
1156181974 18:34615422-34615444 GCTGAAGGTTAGGGTGGCTATGG - Intronic
1160231526 18:77052909-77052931 GGAGTAGGTTAGGACGGCAAGGG - Intronic
1160242649 18:77133951-77133973 GCTGAAGGTGAGGAGGGAAAAGG + Intergenic
1161962845 19:7532226-7532248 CCTGTGGGCAAGGATGGCACAGG + Intronic
1162270250 19:9608632-9608654 GCTGGAAGTAAGGTTGGTAAGGG + Exonic
1163753212 19:19090962-19090984 GCTGCAGCTCAGGAAGGCAAAGG - Intronic
925362292 2:3288048-3288070 GCTGTAGGTAAGGTTGTCGCAGG + Intronic
926596569 2:14796801-14796823 GCTGTAGGTAGCCATGGAAAAGG - Intergenic
927338536 2:21953308-21953330 CCTGTAGGGATGGAGGGCAATGG - Intergenic
929311508 2:40431403-40431425 ACTGTAGGCAAGGAGGGCCATGG + Intronic
930541388 2:52711348-52711370 AGTGTAGGGAAGGATGGTAATGG - Intergenic
931847852 2:66222800-66222822 CCTCCAGGTAAGGATGGCAGTGG + Intergenic
934065047 2:88332701-88332723 GCTGCAGGTAAGGGTGGGAATGG + Intergenic
937370596 2:121294819-121294841 GCTCTAGCTCAGGAAGGCAATGG + Intergenic
939652656 2:144784317-144784339 GCTGAAGGTTAGGATGGCTGTGG + Intergenic
942101575 2:172589312-172589334 GGTGTAGGTAAAGATAGCACAGG + Intronic
942781217 2:179645994-179646016 GCTTGAGGTGGGGATGGCAATGG - Intronic
945182542 2:207106756-207106778 GCTGTCGGAAATGATGGTAATGG + Intronic
948638949 2:239360943-239360965 GCTGCAGGTAAGGACAGGAAAGG + Intronic
1168888927 20:1281143-1281165 GCTGTAGGGAATGACGGAAAGGG - Intronic
1170589448 20:17760794-17760816 GCTGTGGGAAAGGATGCCCAAGG - Intergenic
1174151003 20:48486349-48486371 GCTGTGGGCCAGGATGACAAGGG - Intergenic
1181636691 22:24177913-24177935 GGTGTGGGTGAGGATGGCATAGG + Intronic
1181743426 22:24939416-24939438 GCAGTAGGTGAGGATGCCAAAGG + Exonic
1182534217 22:30988116-30988138 GCTGTGGTTAAAAATGGCAAGGG + Intergenic
1183132976 22:35857257-35857279 GCTGCAGGTAAGAATGAAAAAGG + Intronic
1184553039 22:45215319-45215341 GTTGTAGCTAATGCTGGCAAGGG + Intronic
1185112285 22:48906933-48906955 GATGGAGGTAAGGATAGGAATGG - Intergenic
1185136158 22:49073947-49073969 GGTGATGGTAATGATGGCAATGG - Intergenic
950329212 3:12143030-12143052 GCTGTAGGTAGAGAGGGTAATGG + Intronic
950700063 3:14737642-14737664 GCTGAAGGTTAGAGTGGCAATGG + Intronic
951401737 3:22240837-22240859 TGTGTAGGTAAGGAGGGCCAAGG - Intronic
951527049 3:23663524-23663546 ACTATAGATAAGGATAGCAAAGG - Intergenic
951870341 3:27355082-27355104 GCTGTGGGTAATGAAGGTAAAGG + Intronic
956181229 3:66519630-66519652 GGTGGAGGTAAGGATAGAAATGG - Intergenic
956700766 3:71956649-71956671 GCTGTAGGGTAGGATGGGATGGG + Intergenic
960597776 3:119422185-119422207 GCTGTAAGCAATTATGGCAAGGG - Intergenic
960643946 3:119857187-119857209 GCTGAAGGTTAGGGTGGCTATGG + Intronic
961056520 3:123793629-123793651 GCTGTGGGGAAGGATGGGCAGGG - Intronic
961738142 3:129015164-129015186 GCTGCAGGAGAGGATGGGAAAGG - Intronic
961756137 3:129128363-129128385 GGTGTAGGTGAGGATGGGGAAGG - Intronic
962729098 3:138263241-138263263 GCTATAGTGAAAGATGGCAAGGG + Intronic
962875533 3:139533435-139533457 GATGTAAGTAAGGAAGTCAAGGG + Intronic
967025526 3:185560982-185561004 GGTGGAGGAAAGGAGGGCAATGG - Intergenic
968808560 4:2790021-2790043 GCTGACGGTTAGGATGGCGAGGG - Intergenic
969250579 4:5965684-5965706 GCTGTAGGTACAGAAGGCCAAGG + Intronic
975713607 4:77184606-77184628 CCTGTAGGAAAGGATGGCTTTGG + Intronic
977650424 4:99462360-99462382 GCTGTGGGAAAGGAGGGCAAGGG - Intergenic
978690766 4:111506493-111506515 AATGAAGGAAAGGATGGCAATGG + Intergenic
979565798 4:122152719-122152741 GCTGTAGGTAAGGATGGCAAAGG - Intronic
979588495 4:122449436-122449458 GCTGAAGATCAGGATGGAAAAGG + Intergenic
981196994 4:141933288-141933310 GTTGTAGGTAAAAATAGCAAAGG - Intergenic
981406704 4:144379068-144379090 GCAATAGGAAAGGATTGCAATGG - Intergenic
986862481 5:11943580-11943602 GTTGGAGGTATGGAGGGCAATGG + Intergenic
987207314 5:15640908-15640930 GATGCAGGTGAGGAAGGCAAAGG - Intronic
988213602 5:28242503-28242525 TCTGTAGCTAAAGATGGAAAAGG + Intergenic
989521814 5:42411338-42411360 GCAGTAGGAAAGGATTGAAATGG + Intergenic
989522549 5:42418724-42418746 GCCTTGGGTGAGGATGGCAAGGG - Intergenic
993018437 5:82563283-82563305 CCTGAAGGTAAGAATGGCTAAGG - Intergenic
993148375 5:84126761-84126783 ACCCTAGGTAAGGATCGCAAAGG - Intronic
994258642 5:97631059-97631081 GATTTAGGTAAGGCTGGCAATGG + Intergenic
994858245 5:105153791-105153813 GCAGGAGGTAAGAAAGGCAAAGG + Intergenic
994930696 5:106179889-106179911 GCATTATGTAATGATGGCAAGGG - Intergenic
995778864 5:115755053-115755075 ACTGTAGGAGAGGATGGAAATGG - Intergenic
997381900 5:133444367-133444389 GCTGTAGGTAAGGAGGGTGCTGG - Intronic
1000441784 5:161272129-161272151 CCTGTAGGTATGGATGCCTAGGG + Intergenic
1002556871 5:180048747-180048769 GCTGAAGCTACAGATGGCAAAGG - Intronic
1005490719 6:26344670-26344692 GCTGTATGCAAGGAGGACAAAGG + Intergenic
1006634232 6:35450848-35450870 GCTGTAGGTGAGGATGCACAGGG + Intergenic
1006803872 6:36776427-36776449 GCTGGTGGTGAGGATGGGAATGG + Intronic
1007121454 6:39385497-39385519 TCTGAGGTTAAGGATGGCAAGGG - Intronic
1008253186 6:49265432-49265454 GCTGTAGGTAACCTTGGAAAAGG + Intergenic
1009999499 6:70934264-70934286 GCCGTATGTAGGGATGCCAAGGG - Intronic
1010118537 6:72344345-72344367 GCTGCAGGGAAGGAAGGCTAAGG + Intronic
1010760328 6:79715008-79715030 GCTTGAGGGAAGGAGGGCAAAGG + Intergenic
1011227585 6:85124831-85124853 GGTGTGGGTAAGAAGGGCAATGG + Intergenic
1011836598 6:91438770-91438792 GCTGTAGGTCAAAATGGCCAGGG - Intergenic
1013070914 6:106728491-106728513 GCTGTGGGTGGAGATGGCAAGGG - Intergenic
1013857849 6:114595921-114595943 GCTGTGGTTAATGATGGCAGTGG - Intergenic
1014119097 6:117702439-117702461 GCTTTCAGTAAGAATGGCAAAGG - Intronic
1018189698 6:161299585-161299607 GCTGTTGGTCAGGTTGGAAATGG - Intergenic
1022274846 7:28845286-28845308 GCTGCAGGTCAGGATGGCCTTGG - Intergenic
1024127806 7:46318590-46318612 GCTGTAGGTCATGATGTCTAGGG + Intergenic
1028233785 7:88336245-88336267 GCTGCAGGATAGGATGACAAAGG - Intergenic
1030437839 7:109547668-109547690 GATGTAGGTATGGTTGGTAAGGG + Intergenic
1032358343 7:131230714-131230736 ACTGTAGGGAAGGAAGGCACAGG - Intronic
1033051240 7:138006244-138006266 GGTTTCAGTAAGGATGGCAAGGG - Intronic
1039946658 8:42135408-42135430 GCCGTAGGAAGAGATGGCAATGG + Intergenic
1040676769 8:49759412-49759434 GCTGTAGGGAAAGGTGGCCAGGG - Intergenic
1044092047 8:88014474-88014496 GCTGTATATTAGGATGGCAGAGG - Intergenic
1044931864 8:97259302-97259324 GCTGTAGGTGGGGAGGGCAAGGG - Intergenic
1046177589 8:110598665-110598687 GCTGTGGGTCAGGATGGAATTGG + Intergenic
1048824639 8:138412069-138412091 GCAGTCGGGAAGGAGGGCAAGGG + Intronic
1049026519 8:139994448-139994470 GCTGTAGGTTTGGGTGGCTATGG - Intronic
1049040289 8:140107655-140107677 GCAGTAGGTAAGCATGGCCAAGG + Intronic
1050961510 9:11739153-11739175 GCTATGATTAAGGATGGCAATGG - Intergenic
1056043860 9:82695941-82695963 ACTGCAGGTAGGGATGTCAATGG + Intergenic
1058192394 9:101934738-101934760 GTTGTAGGTAAGCATGTAAAGGG - Intergenic
1058969985 9:110072324-110072346 TCTGTGGCTAAGGGTGGCAAGGG + Intronic
1059759004 9:117320737-117320759 ACTGTAGGTAAGGAAATCAAAGG - Intronic
1062715863 9:138009810-138009832 GCTGGAGGTGAGGATGGAACAGG + Intronic
1203786308 EBV:129816-129838 GCTGTGGGTGAGACTGGCAATGG - Intergenic
1186184951 X:7011532-7011554 ACTGGAGGAAAGAATGGCAAAGG - Intergenic
1186728981 X:12387938-12387960 CCTGGAGGTAAGGCTAGCAAAGG - Intronic
1192100383 X:68258109-68258131 ACTCTAGTGAAGGATGGCAAGGG + Intronic
1192160968 X:68787217-68787239 GCTGTAGGTTAGGGAGGCAAAGG + Intergenic
1192790908 X:74380907-74380929 GCTGTAGCTTAGGAGGGCCAAGG - Intergenic
1198363452 X:135917721-135917743 GCTGTAGGTAGTTATGGAAAAGG + Intergenic
1198734992 X:139775697-139775719 GCCCTAGGTAAGGAGGGCAGAGG - Intronic
1200147530 X:153934475-153934497 GCTGCAGGGAAGGAGGGCAGTGG + Exonic
1201573835 Y:15440949-15440971 GGTGTGGGTAGGGATGGCAAGGG + Intergenic