ID: 979565799

View in Genome Browser
Species Human (GRCh38)
Location 4:122152724-122152746
Sequence GCCATCCTTACCTACAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565797_979565799 -8 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126
979565796_979565799 7 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565799 Original CRISPR GCCATCCTTACCTACAGCCC TGG Intronic
901473104 1:9471233-9471255 GCCCTCCTCACCTCCAGCTCCGG - Intergenic
904419793 1:30384321-30384343 TCCATCCCTCCCGACAGCCCAGG - Intergenic
908221162 1:62008021-62008043 GCCATCATTTCCCAAAGCCCTGG - Intronic
913189509 1:116401600-116401622 GCTTTCCTTTCCTACTGCCCTGG + Exonic
915300240 1:154947572-154947594 GCCATGCTACCCCACAGCCCAGG + Intronic
918917612 1:190665031-190665053 GCCATGCTTACCTACACCATGGG + Intergenic
1065679243 10:28212233-28212255 GCCACCCTCACCTTCTGCCCTGG - Intronic
1070600691 10:77864392-77864414 GTCATCCTCACCTACAACTCAGG + Intronic
1070600698 10:77864446-77864468 GTCATCCTCACCTACAACTCAGG + Intronic
1070814015 10:79312133-79312155 GCCATCCTTCCCTGTGGCCCCGG - Intronic
1073771678 10:106741903-106741925 ACCAGCCTTACCTACAGGCCAGG - Intronic
1075635364 10:124026932-124026954 GCCCTCCTTCCCTCCAGCCTAGG - Intronic
1076167155 10:128291950-128291972 GCCTTCCTTACCTTGAGGCCTGG - Intergenic
1076848213 10:133080375-133080397 CCCTGCCTTACCCACAGCCCTGG - Intronic
1078064622 11:8069950-8069972 GCCATCCTGCCCCACATCCCAGG - Intronic
1079135076 11:17771821-17771843 GCCTTCCTTACCTACATCGAGGG + Exonic
1084187917 11:67484847-67484869 GCCATCCTCATCTCCAGCCTGGG + Intronic
1084607473 11:70180963-70180985 GCCATCCTAGCCTGCAGGCCTGG - Intronic
1087289905 11:96309380-96309402 TTCATTCTTACCTACAGCCATGG + Intronic
1090954528 11:131502607-131502629 GGCATCCTGACCCACACCCCAGG + Intronic
1092280346 12:7093146-7093168 CGCATCCTTAGCTTCAGCCCTGG - Intronic
1093966410 12:25331670-25331692 GACACCCTTACCTGCAGTCCTGG - Intergenic
1094669909 12:32560018-32560040 GCCATCCTTCACTAGACCCCGGG + Intronic
1097072239 12:56363534-56363556 GCCATCCTTGAATACAGTCCTGG + Intergenic
1098986145 12:77014619-77014641 GCCTTCCTTACTCACCGCCCAGG - Intergenic
1102797307 12:115700021-115700043 GCCTTCGTTACCTATAGGCCAGG - Intergenic
1112501380 13:99945966-99945988 CCCACCCTTACCTCCAGCCTTGG + Intergenic
1113185030 13:107678411-107678433 GCCATCGTTACCCACAGACATGG + Intronic
1122832174 14:104403829-104403851 GCCATCCCCACCCACATCCCTGG - Intergenic
1127855644 15:62951267-62951289 ACCATCCTTAGAAACAGCCCAGG - Intergenic
1129525703 15:76212738-76212760 GCCAGCCTTGCCCACAGCACTGG + Intronic
1131060428 15:89400550-89400572 GCCCTCCATACCCACCGCCCAGG - Intergenic
1133137457 16:3721811-3721833 CCCACCCTTAACTAAAGCCCAGG - Intergenic
1134829393 16:17311073-17311095 CCCTTCCTTGCCTTCAGCCCAGG + Intronic
1136499389 16:30662542-30662564 GCCATCCTGCCCCACAGCCTCGG + Exonic
1137842082 16:51650039-51650061 GCAATCCCTCCTTACAGCCCGGG + Intergenic
1139390581 16:66604714-66604736 GCCCTCCTTCCGCACAGCCCGGG + Exonic
1141670980 16:85491557-85491579 GCCCTCCTTGCCCACAGGCCAGG - Intergenic
1143004752 17:3822763-3822785 GTCACGTTTACCTACAGCCCTGG - Intronic
1144177921 17:12726198-12726220 GCCATCATTCCCTACAGCGAGGG + Intronic
1145755362 17:27386231-27386253 CCCATCCTTACCTAAGCCCCTGG + Intergenic
1146462626 17:33058212-33058234 GCCTGCCTTACCTACCTCCCAGG - Intronic
1146948851 17:36892047-36892069 GCCTTCCTTACCTGCTGCCATGG - Intergenic
1147586351 17:41655751-41655773 GCCACCCACACCTTCAGCCCGGG - Intergenic
1149211256 17:54304132-54304154 TCCCTCGTTACCTAGAGCCCAGG + Intergenic
1151854164 17:76709952-76709974 GCCCAGCTTACCTACAACCCGGG + Intronic
1152351325 17:79785471-79785493 GCCCACCTTGCCTTCAGCCCTGG + Exonic
1152701122 17:81820152-81820174 GCCTTGCCTACCTACAGCCGGGG - Intergenic
1153805033 18:8704170-8704192 GCCAGCCTGTCCTCCAGCCCTGG - Intergenic
1156293838 18:35772853-35772875 CCCATCCTCTCCTTCAGCCCTGG + Intergenic
1160509492 18:79445243-79445265 GCCCACCTTACCCACAGCCCAGG - Intronic
1161454672 19:4364000-4364022 GCCACCCTCACCTCCAGCCTCGG - Intronic
1161852537 19:6745124-6745146 GCCTTCCTTCCCTCCAGTCCGGG - Intronic
1161992575 19:7693187-7693209 ACCATCCCTACCAACAGCCCTGG + Intronic
1163454740 19:17399838-17399860 TTCATCCTCACCAACAGCCCCGG - Intergenic
1164178864 19:22802295-22802317 GCCACCCTCCCCTACACCCCAGG + Intergenic
1166311927 19:41967695-41967717 GCCTTCCTGTCCTACTGCCCCGG - Exonic
1166318177 19:42000319-42000341 GCCATCCCTATCTCCTGCCCGGG - Intronic
1167602343 19:50461707-50461729 GCCATCCTGCCCCACAGCCCAGG + Intronic
925435082 2:3830042-3830064 AACATCCTTATCTACAGCCCAGG - Intronic
925672348 2:6324847-6324869 GTCATCCTCACCTCCAGCCCTGG + Intergenic
925757905 2:7151642-7151664 GGAATCCTTACCCCCAGCCCTGG - Intergenic
929862731 2:45693374-45693396 GCCATTCTCACCTCCAGCCCTGG - Intronic
934464713 2:94250495-94250517 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
934552934 2:95273084-95273106 ACCATCCTGAACTACTGCCCTGG + Intergenic
947771909 2:232676741-232676763 GCCAGCCTTCCCCACAGTCCTGG - Intronic
947913586 2:233818201-233818223 GCCATCCTTCCCTCCAGGGCAGG - Intronic
948464571 2:238146015-238146037 GCCATCAAGACCCACAGCCCAGG + Intronic
1169850874 20:10049429-10049451 GCCTTCCTTAGCCACAGCCCTGG - Exonic
1173759644 20:45548242-45548264 GCTTTCCTTTCCTACAGCCATGG + Intergenic
1175229778 20:57466381-57466403 GCCCTCCCTACATCCAGCCCTGG + Intergenic
1175933876 20:62506251-62506273 GCCAGCCTCCCCTACTGCCCAGG + Intergenic
1176143868 20:63556948-63556970 GCCTTCCTTACCCACCTCCCTGG + Intergenic
1180080753 21:45486548-45486570 ACCCTCGTTACCTCCAGCCCTGG - Intronic
1180585869 22:16889641-16889663 ACCATCCTTTCCTGCAGCCTGGG - Intergenic
1181636690 22:24177908-24177930 GCCATCCTCACCCACACCCCAGG - Intronic
1183160499 22:36110129-36110151 GCAATCCATACCTCCAGTCCAGG + Intergenic
1183697464 22:39431302-39431324 GCAATCCTGGCCGACAGCCCTGG - Exonic
1184797867 22:46742232-46742254 GCCATCCTCCACTTCAGCCCAGG - Intergenic
950189131 3:10964387-10964409 GCCATCCTCACTTACAGGCCAGG - Intergenic
950505582 3:13392512-13392534 ACCATCCTCACCTAATGCCCTGG - Intronic
950643513 3:14363521-14363543 GGCATCCTCACCTCCAGCACAGG - Intergenic
950772510 3:15323549-15323571 GCAATTCTTGCCTACATCCCTGG - Intronic
954190891 3:48959796-48959818 GCCTTCCTGTCCTACAGTCCAGG - Intronic
954536466 3:51362663-51362685 GCCATCCTTACCTCGGGCACTGG - Exonic
958739086 3:98046539-98046561 GCCATCTTGACCTCTAGCCCAGG - Intergenic
961158915 3:124705648-124705670 GCCATCCTTACCTGGAGGCCTGG + Intronic
961365878 3:126398934-126398956 TCCATCCATTCCTGCAGCCCTGG + Intronic
961944387 3:130670976-130670998 GCCATCCCAACCTACAGCAGAGG - Intronic
962457622 3:135579475-135579497 ACCATCAATACATACAGCCCAGG + Intergenic
967951660 3:194845872-194845894 GTCATCATTAACTCCAGCCCAGG - Intergenic
969899432 4:10335302-10335324 GCCATGCTGACCTACAGCTTGGG + Intergenic
969929599 4:10617864-10617886 CACATCTTTCCCTACAGCCCAGG - Intronic
979565799 4:122152724-122152746 GCCATCCTTACCTACAGCCCTGG + Intronic
988486556 5:31672492-31672514 GCCAACCCCACCTCCAGCCCAGG + Intronic
997319061 5:132963248-132963270 GCCCTTCTTACCTCCAGTCCCGG + Exonic
1003804554 6:9712599-9712621 GCCATCTTTATCTAGAACCCAGG + Intronic
1005759875 6:28958252-28958274 GCCAGCTCCACCTACAGCCCCGG + Intergenic
1006088711 6:31615409-31615431 GCCCTCCTAGCCCACAGCCCAGG - Intronic
1006315874 6:33291254-33291276 ACCCTCCTTGCCAACAGCCCTGG + Intronic
1006575140 6:35039701-35039723 CCCTTCCTTCTCTACAGCCCTGG - Intronic
1008613357 6:53204350-53204372 GTCAGCCTCACCTGCAGCCCTGG - Intergenic
1011888363 6:92126190-92126212 GTCAGCCTTCCCTACAGCCTTGG + Intergenic
1019262629 7:90129-90151 GAAATCCTTCCCTACAGCCAAGG + Intergenic
1020008076 7:4792687-4792709 GCCAGCCTTTCCTGCGGCCCCGG - Intronic
1024127804 7:46318585-46318607 GACATCATGACCTACAGCCGTGG - Intergenic
1024246829 7:47477140-47477162 GCCATACTTACCGACATCCCAGG - Intronic
1025017159 7:55449029-55449051 GCCACCCTAGCCAACAGCCCGGG - Intronic
1025195486 7:56929103-56929125 GCCATCTTTACCTCCAGGCTAGG + Intergenic
1025676466 7:63647836-63647858 GCCATCTTTACCTCCAGGCTAGG - Intergenic
1026565034 7:71482764-71482786 CCCACCCTTCCCTGCAGCCCTGG - Intronic
1029812954 7:103067665-103067687 GGCTTCCTTACCTACATGCCTGG - Intronic
1035469889 7:159102955-159102977 TCCATCCTTGCCGGCAGCCCTGG - Intronic
1038423769 8:27451565-27451587 ACCATCCTTGCCCACCGCCCAGG + Intronic
1044955074 8:97471615-97471637 AACTTCCTTCCCTACAGCCCAGG + Intergenic
1046901626 8:119529746-119529768 GCCATTCTTGACTACAACCCAGG + Intergenic
1048257988 8:132920154-132920176 GCCACCCATACATACAGTCCTGG - Intronic
1049090923 8:140512701-140512723 GCCATGTTTTCCTAGAGCCCAGG + Intronic
1049525941 8:143127036-143127058 GCCATCCATCCGAACAGCCCTGG - Intergenic
1049691889 8:143965135-143965157 GCCTTCCTTTCCTGCAGCACTGG + Intronic
1051252975 9:15180908-15180930 GCCATACTTACCTACAGTTTTGG - Intronic
1053694801 9:40627257-40627279 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1053941786 9:43257634-43257656 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1054270040 9:63012865-63012887 ACCATCCTTTCCTGCAGCCTTGG + Intergenic
1054306045 9:63426481-63426503 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1054404787 9:64750457-64750479 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1054438411 9:65235949-65235971 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1054491993 9:65785999-65786021 ACCATCCTTTCCTGCAGCCTTGG + Intergenic
1060209974 9:121703929-121703951 GCCATTATTACCTAGAGCACAGG + Intronic
1062189998 9:135243029-135243051 GGCATCCAGACCTGCAGCCCAGG - Intergenic
1202777246 9_KI270717v1_random:860-882 ACCATCCTTTCCTGCAGCCTTGG - Intergenic
1185791444 X:2930603-2930625 CACATCCCTACCTCCAGCCCAGG + Intergenic
1186694132 X:12011597-12011619 GTCATCCAAACCTCCAGCCCTGG - Intergenic
1188020114 X:25148023-25148045 ACCATCCTCACCTACCCCCCAGG + Intergenic
1190194647 X:48306762-48306784 AGCATCCTTACCTGTAGCCCTGG + Intergenic
1196807978 X:119605720-119605742 ACCTTCCTCACCTGCAGCCCAGG + Exonic
1199971277 X:152863708-152863730 GCCATCCTAAGCTGCAGGCCAGG + Intronic
1199976391 X:152897338-152897360 TCCATCCTTAGCCCCAGCCCAGG + Intergenic
1200038909 X:153351848-153351870 GCCTGCCCTACCTGCAGCCCTGG + Exonic