ID: 979565800

View in Genome Browser
Species Human (GRCh38)
Location 4:122152725-122152747
Sequence GCCAGGGCTGTAGGTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 286}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565800_979565803 -8 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565803 4:122152740-122152762 GCCCTGGCACCTATAAACCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
979565800_979565808 0 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565808 4:122152748-122152770 ACCTATAAACCGAGGGTTGGAGG 0: 1
1: 0
2: 0
3: 5
4: 72
979565800_979565812 17 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565812 4:122152765-122152787 TGGAGGTCAGTGGCAAAGTCTGG 0: 1
1: 0
2: 4
3: 126
4: 1142
979565800_979565813 21 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565813 4:122152769-122152791 GGTCAGTGGCAAAGTCTGGAAGG 0: 1
1: 0
2: 0
3: 21
4: 218
979565800_979565815 28 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565815 4:122152776-122152798 GGCAAAGTCTGGAAGGGCCATGG 0: 1
1: 0
2: 1
3: 52
4: 263
979565800_979565810 7 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565810 4:122152755-122152777 AACCGAGGGTTGGAGGTCAGTGG 0: 1
1: 0
2: 0
3: 14
4: 178
979565800_979565807 -3 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565800_979565805 -7 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565800_979565814 22 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565814 4:122152770-122152792 GTCAGTGGCAAAGTCTGGAAGGG 0: 1
1: 0
2: 6
3: 29
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565800 Original CRISPR GCCAGGGCTGTAGGTAAGGA TGG (reversed) Intronic
901856356 1:12046741-12046763 GCCAGGGAGGAAGGGAAGGAAGG - Intergenic
902561511 1:17280473-17280495 GGCGGGGCTGGAGGCAAGGATGG + Intronic
902688882 1:18097158-18097180 GTCAAGGCTGTAGCTAAGAAAGG + Intergenic
903499970 1:23795333-23795355 TCCAGGCCTGCAGGGAAGGAGGG - Exonic
904702446 1:32365981-32366003 GCGTGGGCTGGAGGAAAGGAAGG + Intronic
905441198 1:37997411-37997433 GCCAGGGCTGTAGCCAGGCAGGG - Exonic
905815747 1:40949435-40949457 GCCAGGGAGTGAGGTAAGGAGGG + Intergenic
905825435 1:41022886-41022908 GCAAGGCCTCTAGGTAAGTAGGG - Exonic
906746235 1:48224086-48224108 GGCAGGGCAGTGGGTAGGGAAGG - Intronic
910171294 1:84379833-84379855 CAAAGGGCTGTAGGTAAAGAGGG - Intronic
910216246 1:84847775-84847797 GCCATGGCTGTAGGCCAGGTTGG - Intronic
912521451 1:110247995-110248017 GCCAGGGCTACAGGAAAGGTGGG - Intronic
915615285 1:157033103-157033125 GCTTGGGCTGGAGGTCAGGAGGG - Intronic
916059643 1:161089669-161089691 GCCAGGGAGGGAGGGAAGGAGGG + Intergenic
917793921 1:178518967-178518989 ACAAAGGCTGTAGGTAATGATGG + Intronic
918638060 1:186803525-186803547 GTCAGGGCTGGAAGTAGGGAAGG - Intergenic
921053366 1:211526697-211526719 GCCAGGGCTGGGGCTGAGGAAGG + Intergenic
923185817 1:231572201-231572223 GGAAGGGCTGGAGGAAAGGAAGG - Intronic
1063862894 10:10331454-10331476 GCAAGGGCTGAAGGTAGAGAAGG + Intergenic
1065811793 10:29449648-29449670 GGGAGGGCTTTAGGTAAGGGCGG - Intergenic
1066484336 10:35828752-35828774 GACAGGGTTGTAAGTAAGGATGG + Intergenic
1071676809 10:87662526-87662548 GCCAGGGTTGGAGGTAAGTGAGG - Intronic
1072103160 10:92248460-92248482 GCTAGGGATGTAAGTAGGGAAGG - Intronic
1073611890 10:104952319-104952341 GCAAGGGCTCAGGGTAAGGAAGG - Intronic
1073771677 10:106741902-106741924 GCCTGGCCTGTAGGTAAGGCTGG + Intronic
1074052433 10:109892322-109892344 GCCAGGCCTGTGGGAACGGAGGG - Intronic
1074682484 10:115922052-115922074 CCCAGGGCTGTAGGTCAAGGAGG + Intronic
1075635363 10:124026931-124026953 GCCTAGGCTGGAGGGAAGGAGGG + Intronic
1076167154 10:128291949-128291971 CCCAGGCCTCAAGGTAAGGAAGG + Intergenic
1076583810 10:131532186-131532208 GCTAGGGATGCAGGTCAGGAGGG - Intergenic
1076699999 10:132266671-132266693 GCCAGGGCTGGAGGGGAGGAAGG + Intronic
1076723849 10:132404476-132404498 TCCAGGGCTGTATTTCAGGACGG - Intronic
1076848212 10:133080374-133080396 TCCAGGGCTGTGGGTAAGGCAGG + Intronic
1077077483 11:708106-708128 GCCACTGCTGTTGGTATGGAGGG - Intronic
1077411611 11:2406377-2406399 GCCAGGGCTGGAGGGAAGCCAGG + Intronic
1078418337 11:11184480-11184502 ACCATTGCTGTAGGTAAGGCAGG - Intergenic
1078514475 11:12009874-12009896 GCCAGGGCGGGAAGTTAGGAAGG - Intergenic
1078637964 11:13069464-13069486 GCCAGGGGTGGAGGCTAGGAAGG + Intergenic
1078846320 11:15121966-15121988 TCCAGGGCTGTAGCAAAGTAAGG - Intronic
1079135077 11:17771822-17771844 GCCCTCGATGTAGGTAAGGAAGG - Exonic
1079419432 11:20272332-20272354 GCTAAGGCTATGGGTAAGGAAGG + Intergenic
1079612114 11:22445990-22446012 GCCAGGGCAGTAGAGTAGGAAGG + Intergenic
1080218005 11:29867635-29867657 GGCAGATCTGTAGGCAAGGAAGG + Intergenic
1081963946 11:47158120-47158142 GGCAGGGCTGCAGGCAGGGAGGG - Intronic
1083272532 11:61579700-61579722 GGCGGTGCTGTAGGGAAGGAAGG - Intronic
1084428282 11:69097420-69097442 GCCAGGCATGTCGGGAAGGAGGG + Intergenic
1087970218 11:104471764-104471786 GCCAGGGCTTGAGGGAAGGAGGG + Intergenic
1088058104 11:105610104-105610126 GCCAGGACTGTAGGAGAGGGAGG + Exonic
1089401328 11:118166297-118166319 GCCAGGGCTGCAGGCAAAGCTGG - Exonic
1090235321 11:125142597-125142619 GCCAGTGCTGAAGGTTATGATGG - Intergenic
1090253473 11:125266772-125266794 GCAAGGTCTGGAGGTCAGGACGG + Intronic
1090447115 11:126774043-126774065 CCAAGGGCTGAAGGAAAGGAGGG + Intronic
1091022621 11:132114550-132114572 GCCAGGGGTATGGGAAAGGAAGG - Intronic
1091806364 12:3359336-3359358 GGCAGGGCAGGAGGGAAGGAGGG - Intergenic
1093742363 12:22703527-22703549 GCCAGTGCTGTAGGTAGGAGAGG + Intergenic
1096072384 12:48782541-48782563 GCCAGGGAGGTAGGGATGGAGGG - Intronic
1096237645 12:49940549-49940571 GCCAGAGCTCTAGGGAATGAGGG + Intergenic
1098598547 12:72301803-72301825 GCTAGGACTGTAGGTAGGGTGGG + Intronic
1100544742 12:95590838-95590860 GGCAAGGCTGGAGGTAAGCATGG + Intergenic
1102648909 12:114422836-114422858 GCCAAGGCTCTAGATAAGTAAGG + Intergenic
1103462363 12:121115142-121115164 GCCAGGTAGGTAGGTAAGTAGGG - Intergenic
1110305838 13:73985564-73985586 GCCAGGACTGTAAGTAAAAAGGG - Intronic
1110593514 13:77292631-77292653 GCCAGGGTTATAGGGAGGGATGG + Intronic
1112501381 13:99945967-99945989 ACCAAGGCTGGAGGTAAGGGTGG - Intergenic
1114149525 14:20021678-20021700 GCCAGTGCTGTAAATCAGGATGG + Intergenic
1114556017 14:23562805-23562827 GCCAGGTCTGGAAGTGAGGAGGG - Intronic
1117553162 14:56856451-56856473 GACAGGGCTATTGGTATGGAAGG + Intergenic
1118337120 14:64863043-64863065 ACCAGGGCAGTAGGAATGGAAGG - Intronic
1118723414 14:68609758-68609780 GCCAGGGCTGGAGAAGAGGAAGG - Intronic
1120569911 14:86104969-86104991 GCCAGGGCAGAAGGGAAGGCTGG + Intergenic
1121020961 14:90579927-90579949 GCCAGGGCAGGAGGCAGGGAGGG - Intronic
1121303004 14:92886754-92886776 GCCAGGGCTGCATGCAACGAGGG - Intergenic
1121445172 14:93974049-93974071 GCCAGCCCTGCAGGTGAGGAGGG - Intronic
1121533298 14:94673595-94673617 CCCAGGGCTTGGGGTAAGGAGGG - Intergenic
1121797227 14:96745213-96745235 GCTAGCACTGTAGGGAAGGAGGG - Intergenic
1122760734 14:104023505-104023527 GCCAGGGCTGTCTGTAGGGCTGG + Intronic
1122832173 14:104403828-104403850 GCCAGGGATGTGGGTGGGGATGG + Intergenic
1124006221 15:25797594-25797616 GCCAGTGCTGCAGGTCTGGAGGG + Intronic
1124675974 15:31686182-31686204 CCCAGGGCTGTGGAGAAGGAGGG + Intronic
1130908297 15:88254869-88254891 TCCAGGGTGGTAGGTTAGGAAGG + Intronic
1131060427 15:89400549-89400571 GCCTGGGCGGTGGGTATGGAGGG + Intergenic
1131278471 15:91002040-91002062 GACAAGGCTGCAGGTAAGCAGGG - Exonic
1132618610 16:854180-854202 GTCAGGGCTGTAGTGGAGGAAGG + Exonic
1134829394 16:17311074-17311096 TCCTGGGCTGAAGGCAAGGAAGG - Intronic
1136192092 16:28622797-28622819 GCCAAGGCTGGAGGTAGGCAGGG - Intronic
1138346339 16:56322549-56322571 GCCAGGCCTGAGGGGAAGGAAGG - Intronic
1138552328 16:57754584-57754606 GCCAGGACTGACGGCAAGGACGG - Intronic
1138643445 16:58404929-58404951 GCCTGGGCTGTGGGTCAGCAGGG - Exonic
1139700409 16:68704575-68704597 GCCAGGTCTGCAGGGAGGGAGGG + Intronic
1141670979 16:85491556-85491578 GCCTGGCCTGTGGGCAAGGAGGG + Intergenic
1142338376 16:89505347-89505369 GCCTGGGCTGTGGGAAGGGAAGG - Intronic
1142747433 17:1966912-1966934 GCCAGGCCTGGAGGTGAGGTAGG - Intronic
1143579664 17:7818181-7818203 GCCAGGGCTGTCTGAATGGAGGG - Intronic
1143888554 17:10085006-10085028 GTCAGGCCTGTGGGTCAGGATGG - Intronic
1144170592 17:12656347-12656369 TCCAGGGCTGTGAGTCAGGAAGG - Intergenic
1144789812 17:17851179-17851201 GGCAGGGCCGGCGGTAAGGAAGG + Intronic
1145755363 17:27386232-27386254 CCCAGGGGCTTAGGTAAGGATGG - Intergenic
1145831859 17:27922683-27922705 GCCAGGCCTGGAGGGAAAGATGG + Intergenic
1146269996 17:31478626-31478648 GCCAGGGCTCCAGGGAGGGAGGG - Intronic
1146948850 17:36892046-36892068 TCCATGGCAGCAGGTAAGGAAGG + Intergenic
1147976347 17:44250316-44250338 CCCAGGGCTGTGGGTGGGGAAGG - Exonic
1147983193 17:44287938-44287960 GCCATGGCTCTAGGTAAAGGAGG - Intergenic
1148391287 17:47275012-47275034 GCAAGGGGTATAGGTACGGATGG + Intronic
1148751594 17:49948563-49948585 GCCAGGGTTGTAGAGAGGGAAGG - Intergenic
1149211257 17:54304133-54304155 ACCTGGGCTCTAGGTAACGAGGG - Intergenic
1150819737 17:68425572-68425594 GCCAGAGCTGCAGGTAAGTGAGG + Intronic
1151327808 17:73389699-73389721 GCCAGGGCTGTGAGTGGGGAGGG + Intronic
1151370499 17:73644015-73644037 GCCAGAGCCCAAGGTAAGGAGGG - Exonic
1151730147 17:75906242-75906264 GCCAGGGCTGGGGCAAAGGAGGG - Intronic
1151892963 17:76962027-76962049 GGCAGGGCTGGGGGAAAGGAGGG - Intergenic
1151960129 17:77401410-77401432 GCCTTGGCTGGAGGTGAGGAGGG + Intronic
1152112606 17:78365583-78365605 GCCAGGGCTGCAGCCGAGGAGGG - Intergenic
1152351326 17:79785472-79785494 TCCAGGGCTGAAGGCAAGGTGGG - Exonic
1152420478 17:80190127-80190149 GCCAGGGACTTAGGTGAGGAGGG + Intronic
1152480558 17:80549064-80549086 GCAAGGGCTGTAGCTCTGGAAGG - Intronic
1152582240 17:81171202-81171224 GGCAGGGCTGGAGGCCAGGAGGG + Intergenic
1153805032 18:8704169-8704191 GCCAGGGCTGGAGGACAGGCTGG + Intergenic
1154070957 18:11150477-11150499 GCCAGGAATGTAGGTGCGGAAGG - Intergenic
1156293839 18:35772854-35772876 TCCAGGGCTGAAGGAGAGGATGG - Intergenic
1158107983 18:53906510-53906532 GCCAGGGCTGTGGGTATGTTTGG - Intergenic
1160403633 18:78629446-78629468 GACAGGGCTAGAGGCAAGGAAGG + Intergenic
1160447171 18:78936763-78936785 GCCAGGGATGTGGGTAGGGCAGG + Intergenic
1160509491 18:79445242-79445264 GCCTGGGCTGTGGGTAAGGTGGG + Intronic
1161688625 19:5717637-5717659 GCCAGGGGTGAAGTCAAGGATGG + Intronic
1161852536 19:6745123-6745145 GCCCGGACTGGAGGGAAGGAAGG + Intronic
1161992576 19:7693188-7693210 ACCAGGGCTGTTGGTAGGGATGG - Intronic
1162023293 19:7878816-7878838 TCCAGGCCTGCAGGGAAGGAGGG + Intergenic
1162068237 19:8138370-8138392 TGCAGGGCTGTGGGTGAGGAGGG - Intronic
1163582113 19:18145126-18145148 GCCAGAGCTGTGGATAACGATGG - Exonic
1163602876 19:18259250-18259272 GCCAGGCTTTGAGGTAAGGAGGG + Intronic
1163663671 19:18593307-18593329 GCCAGGGCTGGGGGTGAGAAGGG - Exonic
1164700580 19:30281375-30281397 GACAGGGCTGGAGGCCAGGAAGG - Intronic
1164751585 19:30659286-30659308 GCCAGGGCAGGAGGAAAGGAGGG + Intronic
1166311926 19:41967694-41967716 GCCGGGGCAGTAGGACAGGAAGG + Exonic
1167163099 19:47780296-47780318 GCGAGGGCTGTGGGTGAGGGTGG + Intronic
1167602344 19:50461708-50461730 GCCTGGGCTGTGGGGCAGGATGG - Intronic
1168352553 19:55685048-55685070 GCCAGGGGTGGAGGGAGGGATGG - Intronic
925361605 2:3284107-3284129 GGCACGGCTGCAGGTAAGGTGGG + Intronic
925435493 2:3834093-3834115 GCCAGGGATGGAGGTAGGGGGGG - Intronic
925977968 2:9154299-9154321 GCCAGGGATGGCTGTAAGGAAGG + Intergenic
926195986 2:10763791-10763813 CCCAGGGCTCTAGGCTAGGAGGG - Intronic
926603136 2:14868563-14868585 GCCAAGGTTGTAGGCACGGACGG + Intergenic
927110089 2:19858351-19858373 GGCATGGATGTAGGTGAGGAGGG + Intergenic
927135204 2:20091941-20091963 GCCAGGGCTGCAGGCAAGTGAGG + Intergenic
927700946 2:25268608-25268630 GCCAGGGCTGTGGGGAGGGCAGG - Intronic
927701830 2:25274047-25274069 GTCTGGGCTGTAGGGAAGTACGG - Intronic
927715238 2:25347605-25347627 GCCAGGTCTGGAAGTCAGGAGGG - Intergenic
927842752 2:26455892-26455914 GCTGGGGCTGTAGGCCAGGAAGG + Intronic
927969469 2:27296137-27296159 GCAAGGGCTGTAGGCAAGGCAGG - Intronic
928291284 2:30039512-30039534 GCCAGGGGTGAAGGTCATGAAGG + Intergenic
929562439 2:42964330-42964352 GCCAAGGATGTCGGGAAGGAAGG - Intergenic
929602077 2:43210699-43210721 GCCAGGCCAGCAGGGAAGGAGGG - Intergenic
929862730 2:45693373-45693395 GCCAGGGCTGGAGGTGAGAATGG + Intronic
930870933 2:56170111-56170133 GTCAGGCCTGTAGGTCAGGGCGG - Intergenic
933853155 2:86387000-86387022 GCCAGGGGTTGAGGGAAGGAGGG - Intergenic
934464712 2:94250494-94250516 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
934552935 2:95273085-95273107 CCCAGGGCAGTAGTTCAGGATGG - Intergenic
938371257 2:130769756-130769778 ACCAGGGCTGGAGAAAAGGAGGG - Intergenic
938748034 2:134299429-134299451 GCTAGGCCTGCAGGTAAGGTAGG + Intronic
939780902 2:146446395-146446417 GCCAGGGGTTGAGGTAGGGAGGG - Intergenic
940710659 2:157159831-157159853 ACTAAGGCTGTGGGTAAGGAGGG - Intergenic
942165480 2:173236618-173236640 GCTGGGGCTGTATGTAAGAATGG + Intronic
944919575 2:204397558-204397580 GCCAGGGCTTAAGGGAAGGGAGG + Intergenic
947270825 2:228332842-228332864 GCCAGGGCAGTTGGAAATGAAGG - Intergenic
947771908 2:232676740-232676762 GCCAGGACTGTGGGGAAGGCTGG + Intronic
948695609 2:239731768-239731790 GCCAAGGCTGCTGGGAAGGAAGG + Intergenic
1169544641 20:6638002-6638024 GCCCAGGCAATAGGTAAGGAAGG - Intergenic
1169850873 20:10049428-10049450 CCCAGGGCTGTGGCTAAGGAAGG + Exonic
1170647175 20:18207881-18207903 CCCAGGGCTAGAGATAAGGAAGG + Intergenic
1170736418 20:19017316-19017338 GGCAGGGCTGTGGGACAGGAGGG - Intergenic
1171373430 20:24676104-24676126 GGCAGGGCTGTAGGCAGGCAGGG - Intergenic
1172662800 20:36578954-36578976 GTCAGTGCTGCAAGTAAGGAGGG + Exonic
1173438866 20:43057360-43057382 GGCAGGGAGGTAGGGAAGGAAGG + Intronic
1174188829 20:48725489-48725511 GCCAGGGCTGGCGGCAGGGAAGG + Intronic
1174583049 20:51586251-51586273 GTCAGGGATGGAGGTGAGGATGG + Intergenic
1175229779 20:57466382-57466404 GCCAGGGCTGGATGTAGGGAGGG - Intergenic
1176107307 20:63395545-63395567 GCCCCGGCTGGAGGGAAGGAGGG + Intergenic
1176143869 20:63556949-63556971 GCCAGGGAGGTGGGTAAGGAAGG - Intergenic
1177269834 21:18833226-18833248 GTCAAGGCTGGAGGTAGGGAAGG - Intergenic
1179731863 21:43372618-43372640 GCCAGGGCGGGAGGTGGGGAGGG + Intergenic
1180072803 21:45445120-45445142 GCCAGGACTGGAGGGAGGGAGGG - Intronic
1180080752 21:45486547-45486569 GCCAGGGCTGGAGGTAACGAGGG + Intronic
1180949359 22:19714322-19714344 GCCAGGGCTGTAGGAGGCGAGGG + Intergenic
1181636689 22:24177907-24177929 GCCTGGGGTGTGGGTGAGGATGG + Intronic
1182182378 22:28363461-28363483 GCTAGGGCAGTATGGAAGGAAGG + Intronic
1182472723 22:30558473-30558495 GCCAGGGCTGTCTATAGGGAAGG + Intronic
1182828684 22:33286923-33286945 GCCAGGGGTGCAGGTAGGGCAGG - Intronic
1183559610 22:38561240-38561262 GCCAAGGCTGGAGGTGGGGAGGG - Intronic
1185315766 22:50178484-50178506 GCCAGGGCGCTAGGGAAGGGAGG + Intronic
950044047 3:9938446-9938468 GCCAGGACTGTGTGTGAGGATGG - Intronic
950505581 3:13392511-13392533 TCCAGGGCATTAGGTGAGGATGG + Intronic
950514984 3:13459261-13459283 GCCAGGGATGTAGGGAAAGAGGG + Intergenic
952339328 3:32432323-32432345 GGCAGGGCAGAAGGTATGGAAGG - Intronic
954153718 3:48673160-48673182 GCCAGGGCTGGGGGTAGGTAGGG + Intergenic
954628817 3:52037332-52037354 GCCAGGGCTGTAGCTGGGGCAGG - Intergenic
954716118 3:52527771-52527793 GCCAGGGCTCTGGGTGGGGAGGG - Intronic
954873764 3:53787260-53787282 CCCAGGGCTGTGGGGAAGGTGGG - Intronic
955021676 3:55127742-55127764 GCCAGGGCAGTAGGGGCGGAAGG + Intergenic
960529108 3:118743332-118743354 GTCAGGGCTGGTGGAAAGGAGGG - Intergenic
960844607 3:121994307-121994329 GCCAGGGCTGCAGGGAAAGAAGG + Exonic
960852817 3:122073955-122073977 GACTGGGCTGCAGGAAAGGAAGG - Intronic
960899969 3:122544473-122544495 GGCAGTGCTGTAAGTAAGGAAGG - Intronic
961158916 3:124705649-124705671 ACCAGGCCTCCAGGTAAGGATGG - Intronic
961365879 3:126398935-126398957 GCCAGGGCTGCAGGAATGGATGG - Intronic
962092513 3:132259905-132259927 ACCATGGCTTTAAGTAAGGAGGG - Intronic
962457623 3:135579476-135579498 GCCTGGGCTGTATGTATTGATGG - Intergenic
962837850 3:139204593-139204615 GCTAGGGCTGTAGAGAAGGCTGG - Intronic
968316182 3:197727600-197727622 GTCAGGTCTGCAGGTAAGCATGG + Intronic
969301909 4:6302008-6302030 GCCAGGGCTGCAGGCAGGGTAGG - Exonic
969483109 4:7457327-7457349 GCCAGGACTGCAGGTGGGGAGGG + Intronic
970469751 4:16365526-16365548 GCCAGGGGTGGAGGCAAAGAGGG + Intergenic
971383170 4:26118474-26118496 TCCAGGACTGTAGGCAGGGAAGG + Intergenic
975953533 4:79806033-79806055 GCCAGGGGTGTGGGGAAGAACGG + Intergenic
977716127 4:100185779-100185801 ACAAGGGCTGTAAGTAGGGATGG - Intergenic
979565800 4:122152725-122152747 GCCAGGGCTGTAGGTAAGGATGG - Intronic
985621779 5:959768-959790 CCCAGGGCTGCAGGTGGGGAAGG + Intergenic
985662437 5:1163920-1163942 GGCAGGGCTGCAGGCCAGGAAGG - Intergenic
985760359 5:1745784-1745806 GCCAGGGTTGTGGGAGAGGAAGG + Intergenic
986988973 5:13529569-13529591 GGCAGGGCAGTAGGAGAGGAGGG + Intergenic
987089759 5:14500344-14500366 GCCAGGGCTGGAGAGAATGAGGG - Intronic
988563580 5:32302160-32302182 GCCAGGCCTATAGGAAATGAAGG + Intronic
988961426 5:36375144-36375166 GCTAGGGCTGTAGTTCAGGAGGG + Intergenic
991000203 5:61775178-61775200 CCCATGGCTGTAGGCAGGGAGGG - Intergenic
993281255 5:85927650-85927672 ACGAGGGATGAAGGTAAGGAGGG - Intergenic
995081953 5:108061450-108061472 GCCAGGGCAGCAGGAAAGGCTGG - Intronic
997319062 5:132963249-132963271 GCCGGGACTGGAGGTAAGAAGGG - Exonic
998004019 5:138645266-138645288 GCCTGGGGTGGGGGTAAGGAGGG + Intronic
1001083961 5:168686969-168686991 CCCAGGGCTTCAGGTAAGGCAGG - Exonic
1005007024 6:21297565-21297587 ACCACTGTTGTAGGTAAGGAAGG - Intergenic
1005040881 6:21598999-21599021 GCCACTGCTGGAGGTAAGCATGG - Intergenic
1006315875 6:33291255-33291277 GCCAGGGCTGTTGGCAAGGAGGG - Intronic
1006327394 6:33364921-33364943 TCCAGGCCTGCAGGGAAGGAGGG + Intergenic
1006420514 6:33931074-33931096 GCCAGGGCTATGGTCAAGGATGG + Intergenic
1006575139 6:35039700-35039722 CCCAGGGCTGTAGAGAAGGAAGG + Intronic
1006830835 6:36967300-36967322 GGCAGGCCTGTAGAGAAGGAGGG - Intergenic
1007393957 6:41566713-41566735 GCCAGGGCTGTTGGCTGGGAAGG - Intronic
1008541095 6:52547011-52547033 GCCAAAGCTGGAGGAAAGGAGGG + Intronic
1010444737 6:75937100-75937122 GCCAGGGATGTAGGAGATGATGG + Intronic
1012992310 6:105938562-105938584 TCCAGAGCTGTAGGGAAGGGAGG + Intergenic
1016190758 6:141261460-141261482 GCCAGGGCTGCTTGTAAGAAGGG - Intergenic
1019221062 6:170473205-170473227 GACAGGGCTCTAGGAAAGGATGG - Intergenic
1019361747 7:608608-608630 GGCAGGGCTGTAGGGAGGGCTGG + Intronic
1019361794 7:608738-608760 GGCAGGGCTGTAGGGAAGGCTGG + Intronic
1019361818 7:608803-608825 GGCAGGGCTGTAGGGAGGGCCGG + Intronic
1019361842 7:608868-608890 GGCAGGGCTGTAGGGAAGGCCGG + Intronic
1019361867 7:608933-608955 GGCAGGGCTGTAGGGAGGGCCGG + Intronic
1019361892 7:608998-609020 GGCAGGGCTGTAGGGAGGGCCGG + Intronic
1019667154 7:2257612-2257634 GCCAGGGCTGCAGGGGAAGACGG - Intronic
1022715374 7:32892943-32892965 GCCAAGACTGTAAGTTAGGAAGG - Intronic
1022859835 7:34356408-34356430 GCTGTGGCTGTAGGTGAGGAAGG + Intergenic
1023642877 7:42278528-42278550 GCCAGGGGAGTAGGCAAGAAAGG + Intergenic
1024301816 7:47892750-47892772 GACAGGGCTGCAGGGGAGGATGG + Intronic
1024503126 7:50134948-50134970 GGCAGGGATGAAGCTAAGGAGGG - Intronic
1026565033 7:71482763-71482785 TCCAGGGCTGCAGGGAAGGGTGG + Intronic
1027228247 7:76258265-76258287 GGCCGGGCTGGAGGAAAGGAGGG + Intronic
1029118681 7:98252069-98252091 GCCAGGGCCGTGGGAAAGAATGG - Intronic
1029283133 7:99449502-99449524 ACCAGGGCTGTCAGCAAGGAAGG - Intronic
1029305911 7:99619985-99620007 GCCAAGGCGGTGGGTGAGGAGGG + Exonic
1029392949 7:100287695-100287717 GCCAGAGCTGGAGGGAAGGGGGG - Intergenic
1030190611 7:106806849-106806871 GCCAAGACTTTAGGTAAGAAAGG - Intergenic
1030609758 7:111676326-111676348 GCAAGGGCAGGAGGTAGGGATGG + Intergenic
1034422014 7:150995502-150995524 GCCAGGGTTGGGGGTAAGGCTGG - Intronic
1034477654 7:151296076-151296098 GCCAGGGCAGGAGGAAGGGAGGG + Intergenic
1035021639 7:155804147-155804169 GCCGGGGCGGGAGGGAAGGAGGG - Intronic
1035469888 7:159102954-159102976 GCCAGGGCTGCCGGCAAGGATGG + Intronic
1036662079 8:10715200-10715222 GGCAGGTCTGTAGGGAAGGTGGG + Intergenic
1038382231 8:27106769-27106791 GCCAGGGCTGGTGGAAAGGGAGG - Intergenic
1038419746 8:27425781-27425803 GCCAGGGTTAGAGGGAAGGAGGG - Intronic
1038835497 8:31116823-31116845 GCCAGGCCAGTAGGTGATGAGGG + Intronic
1039910931 8:41826315-41826337 GCTGGGGCTGTAGGAAAGGTGGG + Intronic
1041354442 8:56985431-56985453 GCCAGGGCTGTTAGTAGGTATGG - Intronic
1041618687 8:59938598-59938620 GCCAGAGATGTAGGAAAGAATGG + Intergenic
1041902912 8:63001611-63001633 GCCAGAGCTTCAGGTAGGGAAGG + Intergenic
1044098816 8:88103142-88103164 GCCAGGACTGGAGGTACGAAGGG - Intronic
1045246227 8:100443854-100443876 ACCAGGGCTATAGTTAAGGTAGG - Intergenic
1048257987 8:132920153-132920175 GCCAGGACTGTATGTATGGGTGG + Intronic
1049414762 8:142490099-142490121 GCCAGGGCTGTAGGAAGCCACGG + Intronic
1049691890 8:143965136-143965158 GCCAGTGCTGCAGGAAAGGAAGG - Intronic
1049848715 8:144819428-144819450 GGAAGGGCTGCAGGAAAGGAGGG - Intergenic
1051252974 9:15180907-15180929 GCCAAAACTGTAGGTAAGTATGG + Intronic
1053694800 9:40627256-40627278 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1053941785 9:43257633-43257655 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1054270041 9:63012866-63012888 TCCAAGGCTGCAGGAAAGGATGG - Intergenic
1054306044 9:63426480-63426502 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1054404786 9:64750456-64750478 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1054438410 9:65235948-65235970 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1054491994 9:65786000-65786022 TCCAAGGCTGCAGGAAAGGATGG - Intergenic
1054849804 9:69835988-69836010 TCCAGAGCTGCAGGTCAGGAAGG - Intronic
1057592013 9:96381027-96381049 TGCAGGGCTGCAGGTAAAGACGG - Intronic
1057890616 9:98867313-98867335 GCCAGGTCTGTAGGAGTGGAAGG + Intergenic
1057987021 9:99727338-99727360 AGCAGGGCTGGGGGTAAGGATGG + Intergenic
1058986343 9:110211603-110211625 GCCAGGGATGTAGGGAAGTGGGG - Intergenic
1059640574 9:116212752-116212774 GGGAGGGCTGGAGGGAAGGAAGG + Intronic
1059870468 9:118568332-118568354 ACAAGGACTGTAGGTAAGTAAGG - Intergenic
1060971727 9:127742167-127742189 GCCAGAGCTGTGGGTCAGCAGGG + Intronic
1061221310 9:129253762-129253784 GCCAGGGCGGAAGGCGAGGAAGG - Intergenic
1061415717 9:130445758-130445780 GCCAGGGCTGTTCCTGAGGAGGG + Intronic
1062302741 9:135884572-135884594 GCCAGGGCTCCAGCTATGGAAGG + Intronic
1062388832 9:136326125-136326147 CCCAGGGCTGTGGCAAAGGAGGG + Intergenic
1202777245 9_KI270717v1_random:859-881 TCCAAGGCTGCAGGAAAGGATGG + Intergenic
1186521761 X:10212613-10212635 GCCAGGGCTGTACGCAATGGTGG + Exonic
1187263537 X:17709650-17709672 CCCAGGGCTGGAGGAATGGAAGG + Intronic
1188020115 X:25148024-25148046 GCCTGGGGGGTAGGTGAGGATGG - Intergenic
1189398354 X:40643424-40643446 GCCAGGGCTTTGGGGAATGAGGG - Intronic
1189682465 X:43530672-43530694 GCAAGGACTGGAGGTAAGGATGG - Intergenic
1190007760 X:46757208-46757230 GCCAGGCCTGCAGGTAAGCTGGG - Intronic
1190138650 X:47820383-47820405 TCCAGGGCTGTAGGAAAGACAGG - Intergenic
1195967874 X:110445477-110445499 GTCAGGGCTGTGGGGGAGGAAGG + Intronic
1196807979 X:119605721-119605743 TCCTGGGCTGCAGGTGAGGAAGG - Exonic
1198045949 X:132902548-132902570 GCCTGGTCTGTAGGGAATGAAGG + Intronic
1198111172 X:133503763-133503785 GCTACAGCTGTAGGAAAGGAAGG - Intergenic
1198628127 X:138602391-138602413 GTAAGGGCTGCAGGCAAGGAGGG - Intergenic
1200038910 X:153351849-153351871 CCCAGGGCTGCAGGTAGGGCAGG - Exonic
1200066595 X:153506999-153507021 TCAAAGGCTGGAGGTAAGGATGG - Intronic