ID: 979565805

View in Genome Browser
Species Human (GRCh38)
Location 4:122152741-122152763
Sequence CCCTGGCACCTATAAACCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565798_979565805 -1 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565796_979565805 24 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565797_979565805 9 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
979565800_979565805 -7 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565805 Original CRISPR CCCTGGCACCTATAAACCGA GGG Intronic
907936058 1:59043368-59043390 CCCTGGTACCTATATACAAAAGG + Intergenic
922964413 1:229676118-229676140 CCCTGGCACCTATAACAGTATGG - Intergenic
1079615110 11:22482427-22482449 CCCAGGCACCTATAAATTAAGGG - Intergenic
1084172040 11:67405491-67405513 CCCTGGCACCTATCAGGTGAGGG + Exonic
1086346678 11:85904103-85904125 CCCTGGCACCTCTGAACTGACGG - Intronic
1086909902 11:92460010-92460032 CCCTGGCAGCAATAAACCCTGGG - Intronic
1095090401 12:38099301-38099323 CCATGGCACATGTAAACCTATGG + Intergenic
1095460111 12:42434466-42434488 ACCAGGCAACTATAAACTGAGGG - Intronic
1102002699 12:109567414-109567436 CCCATGCACCTATAACCCCAGGG + Intronic
1103987500 12:124777778-124777800 CCTGGGCACCTATAATCTGAGGG + Exonic
1129890041 15:79065782-79065804 CCCTGCCACCTGGACACCGAGGG - Intronic
1132634005 16:934020-934042 CCCGGGCACCTAGAGACGGATGG - Intronic
1143530050 17:7497539-7497561 CCCTGGCTCCAATACACAGAGGG - Intronic
932191364 2:69743524-69743546 CCCTGGCAACTAAAAACCTAGGG - Intronic
936376269 2:111943872-111943894 CCTTGGCCCCTAAAAACCCATGG + Intronic
945146116 2:206739935-206739957 CCCTGGCCCCCATAAACCACTGG + Intronic
947191198 2:227506889-227506911 CCCAGTTACCTATAAACCGGTGG + Intronic
947949509 2:234135245-234135267 CCCAGGAACCTTTAAACTGATGG - Intergenic
1173875102 20:46365304-46365326 CCCTGGCCCCTCTGAACAGAAGG + Intergenic
1175428837 20:58889081-58889103 CAGCGGCCCCTATAAACCGAAGG - Intronic
950891730 3:16410287-16410309 CCCTGGCGGATATAAACCAATGG - Intronic
970555402 4:17226513-17226535 CCATGGCACGTATATACCTATGG - Intergenic
971178058 4:24300590-24300612 CTCTGTCACATATAAACTGATGG - Intergenic
974997125 4:69175256-69175278 CCATGGCACCTATAAAACCTGGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
1017202319 6:151768828-151768850 CCCTGGCTCTTATAAAACTAAGG + Intronic
1020286537 7:6685953-6685975 CCCTGGAACATATAAACTGATGG - Intergenic
1024045089 7:45580429-45580451 GCCTGGCACCTAAACACCGTGGG - Intronic
1029114119 7:98228707-98228729 CCCTGGCTCCTAGAAATCGGGGG + Intronic
1038087952 8:24220989-24221011 CCATGGCACGTATATACCTATGG - Intergenic
1041735804 8:61109297-61109319 CCCTGGCACCTGTGAACTGTTGG + Intronic
1052487817 9:29125356-29125378 CCATGGCACATATATACCTATGG + Intergenic
1186425878 X:9464606-9464628 CCCTGCCCCCTAGAAACTGAGGG + Intronic
1200837816 Y:7750098-7750120 GCCTGGCAGATATAAACCAATGG - Intergenic
1201770877 Y:17615622-17615644 CCATGGCACATGTAAACCTATGG - Intergenic
1201830678 Y:18290364-18290386 CCATGGCACATGTAAACCTATGG + Intergenic