ID: 979565807

View in Genome Browser
Species Human (GRCh38)
Location 4:122152745-122152767
Sequence GGCACCTATAAACCGAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979565797_979565807 13 Left 979565797 4:122152709-122152731 CCTTCATATTCCTTTGCCATCCT 0: 1
1: 0
2: 3
3: 37
4: 318
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565796_979565807 28 Left 979565796 4:122152694-122152716 CCTGCGGCGGCGACTCCTTCATA 0: 1
1: 0
2: 3
3: 12
4: 46
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565801_979565807 -7 Left 979565801 4:122152729-122152751 CCTTACCTACAGCCCTGGCACCT 0: 1
1: 0
2: 1
3: 17
4: 264
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565800_979565807 -3 Left 979565800 4:122152725-122152747 CCATCCTTACCTACAGCCCTGGC 0: 1
1: 0
2: 2
3: 25
4: 286
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29
979565798_979565807 3 Left 979565798 4:122152719-122152741 CCTTTGCCATCCTTACCTACAGC 0: 1
1: 0
2: 1
3: 17
4: 191
Right 979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979565807 Original CRISPR GGCACCTATAAACCGAGGGT TGG Intronic
901707668 1:11088093-11088115 GGCACCTTTAAACTAAGGCTGGG + Intronic
904546246 1:31275204-31275226 GTCACCTATAAAGTGAGGGATGG + Intronic
905675261 1:39820299-39820321 GGCACATGGAACCCGAGGGTAGG + Intergenic
906947422 1:50306750-50306772 GGCACTAAGAAACTGAGGGTTGG + Intergenic
911348294 1:96722231-96722253 GGCACCGCTAACCCAAGGGTCGG - Intronic
917245330 1:172994952-172994974 GGCACCTATAACCCTAGGTGAGG + Intergenic
919714706 1:200763944-200763966 GGCACCTGTAACCCGAGGTCGGG + Intronic
923488821 1:234463930-234463952 GGGACCTACAAACAGAGAGTGGG + Exonic
1073912737 10:108365830-108365852 AGCACCAATAAAATGAGGGTGGG - Intergenic
1088860621 11:113795800-113795822 GGAACTCATAAACCGATGGTGGG + Intergenic
1101199201 12:102417011-102417033 GCCACCTACAAGCCGAGGGGAGG + Intronic
1119062355 14:71487976-71487998 GGCACCTACACACTGAGGATGGG - Intronic
1120477279 14:85004528-85004550 TGCATCTACAAACCAAGGGTTGG + Intergenic
1138918073 16:61492210-61492232 GGCACCTATAATCCCAGCCTGGG + Intergenic
1139433239 16:66922375-66922397 GGCACCAGTAAACAAAGGGTGGG + Intronic
1143956255 17:10671862-10671884 AGCACCTGTAATCCCAGGGTGGG + Intergenic
1144121270 17:12155688-12155710 GGCACCTGTAATCCCATGGTGGG + Intergenic
1156925209 18:42569144-42569166 GGCAACTAGAAGGCGAGGGTTGG - Intergenic
928856534 2:35809196-35809218 AGCACCTACAAACTGAGGGTTGG - Intergenic
935712976 2:105915639-105915661 AGCACCTATAAACTAAGGTTGGG + Intergenic
938219501 2:129553430-129553452 GTCACCTGTATACCCAGGGTGGG - Intergenic
947191200 2:227506893-227506915 GTTACCTATAAACCGGTGGTTGG + Intronic
1173134246 20:40425222-40425244 GGCACTCATATACAGAGGGTTGG - Intergenic
1173442031 20:43086208-43086230 GGCACCTATTCACAGCGGGTTGG - Intronic
1185057674 22:48589425-48589447 GCCACCTGGAAACCCAGGGTCGG + Intronic
1185057687 22:48589465-48589487 GCCACCTGGAAACCCAGGGTTGG + Intronic
1185057700 22:48589509-48589531 GCCACCTGGAAACCCAGGGTCGG + Intronic
956616018 3:71173598-71173620 GGCAACTTTAAAGTGAGGGTGGG + Intronic
979565807 4:122152745-122152767 GGCACCTATAAACCGAGGGTTGG + Intronic
994965362 5:106663397-106663419 TGCAGCTATAAACCAAGGGTTGG - Intergenic
1007254842 6:40521347-40521369 GGCACCTGTAAGCTGAGGCTGGG + Intronic
1052339579 9:27351976-27351998 GGCACCTACACACTGGGGGTGGG + Intronic