ID: 979567628

View in Genome Browser
Species Human (GRCh38)
Location 4:122173347-122173369
Sequence GACTCTGCAGAGTCTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 26, 2: 34, 3: 115, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979567625_979567628 -7 Left 979567625 4:122173331-122173353 CCTTTTTACCAGTGGGGACTCTG 0: 1
1: 0
2: 2
3: 72
4: 526
Right 979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG 0: 1
1: 26
2: 34
3: 115
4: 240
979567619_979567628 22 Left 979567619 4:122173302-122173324 CCAAGTTGAGGGGGTGCATCTGG 0: 1
1: 0
2: 4
3: 22
4: 129
Right 979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG 0: 1
1: 26
2: 34
3: 115
4: 240
979567618_979567628 23 Left 979567618 4:122173301-122173323 CCCAAGTTGAGGGGGTGCATCTG 0: 1
1: 2
2: 48
3: 111
4: 324
Right 979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG 0: 1
1: 26
2: 34
3: 115
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979567628 Original CRISPR GACTCTGCAGAGTCTTGAGG TGG Intronic
902230097 1:15022295-15022317 GACTGGGCAGACTCTTGAGAAGG - Intronic
902279385 1:15363163-15363185 GGCTCTGCAGAGTCTGGGAGTGG + Intronic
902839499 1:19066157-19066179 GACTGTGCTGAGTCCTGGGGAGG - Intergenic
903858288 1:26350191-26350213 TTCTCTGCAGAGTCCCGAGGGGG - Intronic
904268444 1:29331919-29331941 GAATCTGCAGAGGGTGGAGGTGG + Intergenic
904292299 1:29495858-29495880 TCCTCTGCAGAGTCTTGAAGTGG + Intergenic
906617730 1:47246047-47246069 GACTCTGCAGAATCCTGAGGTGG + Intergenic
907320534 1:53599412-53599434 ACCTCTGCAGAGTCCCGAGGTGG - Intronic
908303927 1:62791554-62791576 GATTCTGCAGAGTCCTGAGGTGG + Intronic
908700645 1:66896713-66896735 GACTCTGCAGAGAGCTGAGGTGG - Intronic
909895859 1:81068016-81068038 ATCTCTGCAGAGTCTTGAAGAGG + Intergenic
910877668 1:91892331-91892353 TTCTCTGCAGAGTGTTGTGGAGG - Intronic
911238396 1:95437249-95437271 GACTAAGCTGATTCTTGAGGAGG - Intergenic
911389424 1:97220308-97220330 CTCTCTGGAGAGTCCTGAGGTGG - Intronic
911556415 1:99350612-99350634 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
912430316 1:109625293-109625315 GTCTCTGCAGAGGCTCGGGGTGG + Exonic
913105729 1:115612554-115612576 GACTCTTTAGAGTCTAGAGGTGG - Intergenic
913202448 1:116506185-116506207 AACTCTGTAGAGTCCTGAGGTGG + Intergenic
916782824 1:168054291-168054313 GACTCTGCAGAGTCCCGAGCTGG + Intronic
916793414 1:168144169-168144191 CTCTCTGCAGAGTACTGAGGTGG - Intergenic
917152716 1:171962006-171962028 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
918215883 1:182391776-182391798 GGCTCTGCAGAGTCGAGAGTGGG - Exonic
918545906 1:185683660-185683682 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
918781482 1:188705253-188705275 CTTTCTGCAGAGTCCTGAGGTGG + Intergenic
919510483 1:198457294-198457316 GATTCTGGAGAGTCCTGAGGTGG + Intergenic
920554222 1:206892291-206892313 GACTCTGCAGAGTCCCGAGGTGG + Intergenic
921183959 1:212654430-212654452 GACACTGAAGGTTCTTGAGGAGG + Intergenic
921675325 1:217969395-217969417 GAAACTGCAGAGTCTCGAAGAGG - Intergenic
921683640 1:218064468-218064490 GACGCTGCAGAATCCTGACGTGG + Intergenic
922555468 1:226528897-226528919 GACTCTGCATCGTCTTTGGGGGG + Intergenic
922790068 1:228306394-228306416 GCCGCTGCAGAGTCTGCAGGCGG + Exonic
1062902732 10:1158029-1158051 GGTTCTGCAGAATCCTGAGGTGG - Intergenic
1063085273 10:2812054-2812076 GCCTCAGCAGAGTGTTGAGGAGG + Intergenic
1063318016 10:5025468-5025490 GAAAATGCAGAGTGTTGAGGAGG - Intronic
1064472471 10:15650520-15650542 CCCTCTGCAAAGTCCTGAGGTGG - Intronic
1066010991 10:31193220-31193242 GTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1066470701 10:35694984-35695006 GCCTCTGGAGAGTAGTGAGGTGG + Intergenic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1067159124 10:43807892-43807914 AACTCTGCATAGTCATGAGTGGG - Intergenic
1067696015 10:48536159-48536181 CACTCTGCTCAGTCTTGAGGGGG + Intronic
1068632423 10:59311602-59311624 AACTTGGCAGAGGCTTGAGGTGG - Intronic
1070202718 10:74223181-74223203 GACTCTACAGATTCCTGAGGTGG + Intronic
1070961364 10:80502339-80502361 GTCACTGCAGAGTTTCGAGGAGG + Intronic
1071957815 10:90778431-90778453 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1072025583 10:91452663-91452685 GACTCTGCAAAGTCCTGAGGGGG - Intronic
1072483289 10:95829993-95830015 CTCTCTGCAGAGTCCCGAGGTGG - Intronic
1072617074 10:97057027-97057049 GGCTCTGCAGAGGCTAGAGAAGG - Intronic
1073668861 10:105564735-105564757 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1073784612 10:106875121-106875143 GACTCTGGAGACTCAGGAGGAGG - Intronic
1075224097 10:120610053-120610075 GAGACTGCAGAGACTTGTGGAGG + Intergenic
1075377503 10:121990580-121990602 GACTCTGCAGACCCTGGAGAGGG - Intronic
1075379559 10:122007969-122007991 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1075398773 10:122146593-122146615 GACTCTGCAGAGTACAGAGGTGG - Intronic
1075964035 10:126594933-126594955 GGCCCTGGAGAGTCTTAAGGTGG + Intronic
1076451032 10:130557114-130557136 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1076803267 10:132842772-132842794 GCCTCTGCAGAGTCCTGAGGTGG + Intronic
1077114647 11:878034-878056 GACTCCGAAGAGTCCGGAGGTGG - Intronic
1078073161 11:8132369-8132391 GACTCTGAAGGCTTTTGAGGAGG - Intronic
1078075819 11:8159432-8159454 GCCACTGTAGAGTTTTGAGGAGG + Intronic
1079685768 11:23357699-23357721 AACTCTGCAAAGTCCTGAGGTGG + Intergenic
1079875827 11:25856098-25856120 GACTCTGCAGAGTCCAGAGATGG - Intergenic
1080532626 11:33191892-33191914 GACTCCGCAGAGGCTGGAGGTGG + Intergenic
1083222006 11:61258750-61258772 GGCTGTGGAGAGTCTAGAGGTGG + Exonic
1084851068 11:71941075-71941097 GCCACTGAAGAGTCTTGAGCAGG + Intronic
1085233597 11:74993760-74993782 GACTCTGCAGAGTCTGGAGGTGG + Intronic
1085800035 11:79580813-79580835 CTCTCTGCAGGGTCCTGAGGTGG - Intergenic
1086576403 11:88343033-88343055 GACTCTCCAGAGTCTAGAGGTGG + Intergenic
1086935749 11:92743902-92743924 GACTCTGGAGAGTTGTGAGGTGG - Intronic
1087328721 11:96753737-96753759 AACTGTGCAGAGTCTTGGTGGGG - Intergenic
1087662961 11:101009187-101009209 GGCTATGCAGACTCTTGAAGGGG - Intergenic
1088316336 11:108510549-108510571 GACTCTGCAGATTTTGGAGTAGG + Exonic
1088976707 11:114822400-114822422 GACTCAGCAGAGCCTGGAGCTGG + Intergenic
1089147617 11:116341403-116341425 GCCACTGCAGAGTTTTGAGCAGG + Intergenic
1089904822 11:122027820-122027842 GACCCTGCAGAGTCCTGAGGTGG + Intergenic
1090565614 11:127988806-127988828 GCCTCTGCAGAGTCCCAAGGTGG - Intergenic
1091034439 11:132220697-132220719 GACTCTGGAGAGTGTGGGGGAGG - Intronic
1091191631 11:133700314-133700336 ACCTCTGCAGAGTCCTGAGGTGG - Intergenic
1091747275 12:3000396-3000418 AACTCTGCAGAGTCCCGAGGTGG + Intronic
1092041368 12:5387851-5387873 GGCTTTGTAGAGTCTTGAGATGG - Intergenic
1094649269 12:32359400-32359422 GACTCTGCAGAGTCCCAAAGTGG + Intronic
1094744174 12:33324637-33324659 GACTCTGCAGAGTCTGGAGGCGG + Intergenic
1094751743 12:33417397-33417419 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1094771415 12:33664993-33665015 GACTCTGCAGAGTCCCAAAGTGG - Intergenic
1096180630 12:49548723-49548745 GACTCTTCTGAGGGTTGAGGGGG + Intronic
1096949434 12:55450922-55450944 GTCTTTGCAGATTCTTCAGGGGG + Intergenic
1096957942 12:55546087-55546109 GACCCTGCAGAGTCGCAAGGTGG + Intergenic
1097695073 12:62767771-62767793 GATTCTGCAGAGCCTTCAGAAGG - Intronic
1100024712 12:90113925-90113947 CTCTCTGCAGAGTCCTGAAGTGG + Intergenic
1100965081 12:100004330-100004352 GACTCAGCAGAGTCGTGAGATGG - Intergenic
1101201126 12:102437247-102437269 TCCTCTGCAGAGTCCCGAGGTGG - Intronic
1101232795 12:102758244-102758266 TACTCTGCAGTGTCTTCAAGGGG + Intergenic
1105342333 13:19538996-19539018 GACTCTACAGAGTTCTGAAGTGG + Intergenic
1105793966 13:23832265-23832287 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1106464620 13:30001953-30001975 CTCTCTGCAGAGTCTTGAGGTGG + Intergenic
1106950018 13:34872946-34872968 CCCTCTGCAGAGTCCTGAAGTGG + Intergenic
1108230262 13:48331541-48331563 GAGTCCTCAGAGTCCTGAGGTGG - Intronic
1108516461 13:51207735-51207757 CTCTCTGCAGAGTGTTGAGGTGG - Intergenic
1109444400 13:62414194-62414216 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1112266801 13:97931890-97931912 GACTCTGCAGAGTCCCAAGGCGG + Intergenic
1113154418 13:107302187-107302209 GGCTCTGCAGAGTCCCCAGGTGG - Intronic
1113285225 13:108839110-108839132 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1114139705 14:19895631-19895653 GACTCTGCATAGACTCCAGGTGG + Intergenic
1115324492 14:32124152-32124174 GTGTCTGGAGAGTTTTGAGGTGG - Intronic
1116855245 14:49946199-49946221 GACTCTGCAGTCACTTCAGGGGG - Intergenic
1118595794 14:67434874-67434896 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
1119495827 14:75078043-75078065 GACACTGAAGAGTCATGAGCAGG + Exonic
1121008738 14:90507489-90507511 GACTGTGGAGAGTTTTGAGCAGG - Intergenic
1121033182 14:90676591-90676613 CACTCTGCAGACTGATGAGGCGG + Exonic
1121065411 14:90959309-90959331 GACTCTGCAGAGTTCTGAGTAGG + Intronic
1121406834 14:93724242-93724264 GACTCTGCAGAATCTCTAAGAGG - Intronic
1121753118 14:96375815-96375837 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1122374963 14:101251431-101251453 GACTCTGGAGTGTGGTGAGGAGG + Intergenic
1122816017 14:104314483-104314505 GTCTCAGCACAGACTTGAGGGGG + Intergenic
1124202924 15:27693851-27693873 GACTCTCCGCAGTCTTGAGGGGG - Intergenic
1124438335 15:29669413-29669435 GACTCTGTAGAGTCCCAAGGTGG - Intergenic
1124686358 15:31786112-31786134 GACTCTGCAGAGTCCCCAGGTGG - Intronic
1126518324 15:49559207-49559229 GACTCTGCAGGGAGTTGAGATGG - Intronic
1126989394 15:54355069-54355091 CTCTCTGTAGAGTCTGGAGGGGG - Intronic
1129046058 15:72735220-72735242 GACTCTCCAAAGCCATGAGGTGG + Intronic
1130098991 15:80877665-80877687 GACCCAGCAGTGTCCTGAGGTGG - Intronic
1130649159 15:85752205-85752227 GGGTCTGCAGAGTCTGCAGGTGG + Intergenic
1130747757 15:86674389-86674411 AACTCTGCTGAGTGCTGAGGAGG + Exonic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1131647589 15:94361951-94361973 GACTCAGGAGAGCCTGGAGGAGG - Intronic
1133809408 16:9149519-9149541 CTCTCTGCAGAGGCCTGAGGTGG + Intergenic
1134929939 16:18198659-18198681 GACTCAGCACACTTTTGAGGGGG + Intergenic
1135204808 16:20474434-20474456 GACTCCGCAGAGTCCCAAGGAGG - Intronic
1135214089 16:20549379-20549401 GACTCTGCAGAGTCCCAAGGAGG + Intronic
1138058464 16:53861950-53861972 GCCTCTACAGAGTTTTAAGGGGG - Intronic
1138301335 16:55932218-55932240 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1138493310 16:57390866-57390888 GCCTCTGCAGAGTCCCAAGGTGG - Intergenic
1138533870 16:57649460-57649482 GACTCTGGAGGGAGTTGAGGAGG + Intronic
1139381405 16:66534179-66534201 GACTCTTCAGAGTCCCCAGGTGG - Intronic
1140970576 16:80008611-80008633 CTCTCTGCAGAGTCCTGAGATGG - Intergenic
1140970687 16:80009674-80009696 GAATCTGCACAGTCCTCAGGTGG - Intergenic
1141439682 16:84021867-84021889 GACTTTGCAGAGCCCTGAAGTGG + Intronic
1141472565 16:84249291-84249313 TACTCTGAAGCGCCTTGAGGAGG - Intergenic
1143989543 17:10944912-10944934 GAAGCTGCAGAGTTTTGGGGTGG - Intergenic
1144347817 17:14365879-14365901 GACTCTGCAGAGTTCCAAGGAGG + Intergenic
1144353308 17:14420230-14420252 GGCCCTGCAGGCTCTTGAGGTGG - Intergenic
1149206643 17:54255113-54255135 CTCTCTGAAGAGTCCTGAGGAGG - Intergenic
1149632650 17:58139654-58139676 GACTCTGAGGAGTCCTGAGGTGG + Intergenic
1150837120 17:68574305-68574327 TCCTCTGCAGAGTTCTGAGGTGG + Intronic
1151286366 17:73114439-73114461 GACTCTGCAGAGTCTTGAAGTGG - Intergenic
1151638656 17:75372274-75372296 GCCTCTGCACAGGCTGGAGGTGG + Intronic
1153620709 18:6975090-6975112 GACTCTGTAAAGTGTTGTGGTGG - Intronic
1153916850 18:9753423-9753445 GACTCTGTAGAGTCCCAAGGTGG - Intronic
1157023722 18:43817432-43817454 GACTCTGAAGAGTCCTGAGGTGG - Intergenic
1159932833 18:74332208-74332230 CTCTCTGCTGAGTCCTGAGGTGG + Intronic
1160409389 18:78665094-78665116 GACTCTGCAGAGCGGAGAGGAGG + Intergenic
1160578819 18:79872070-79872092 GACCCTGCAGAGGCTCGTGGAGG + Intronic
1160630800 18:80246001-80246023 GTGTCTGCAGAGGATTGAGGCGG - Intronic
1161914882 19:7221044-7221066 GACTCTGCAGAGTCCTGACAGGG - Intronic
1162608027 19:11726630-11726652 GACTCTGCAGAGTCCCTAGGTGG - Intronic
1162678902 19:12323536-12323558 GACTCTGCAGAGTTCTTAGATGG - Intronic
1162686881 19:12394242-12394264 GACTCTGCAGAGTCCCTAGGCGG - Intronic
1162691228 19:12434024-12434046 GACTCTGCAGAGTCTCTAGGTGG - Intronic
1162789228 19:13054487-13054509 GAGTCTCCAGAGTCTTGGGTGGG + Intronic
1163970918 19:20793841-20793863 GACTATGCAGAGACATGAGATGG + Exonic
1164478691 19:28594781-28594803 GAGTCTGCAGAGTTATGAGTGGG - Intergenic
1164514573 19:28922851-28922873 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
1164683817 19:30153454-30153476 GACTCTGCAGAGCCTTCATGTGG + Intergenic
1164777901 19:30868513-30868535 GGCTCTGCTGAGTCCTCAGGAGG - Intergenic
1164876780 19:31696439-31696461 CTCTCTGCAGAGTCTTGAGGTGG + Intergenic
1164934594 19:32201117-32201139 CTCTCAGCAGAGTCTTCAGGTGG - Intergenic
1165912126 19:39236086-39236108 GACTCTGCAGGGCCCTAAGGTGG - Intergenic
1167891665 19:52544786-52544808 GACTCTGCACATTTTTGAGATGG + Intronic
926942127 2:18149642-18149664 CTCTCTGTAGAGTCCTGAGGTGG + Intronic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
928790145 2:34940355-34940377 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
928950395 2:36808525-36808547 GAGGCTGCAGGGTCTTGTGGAGG - Exonic
929181358 2:39043663-39043685 GACTCTGCAGAGTCCTGACGCGG + Intronic
930256727 2:49101851-49101873 GACTCTGTAGAGTCCGAAGGTGG + Intronic
931325304 2:61215956-61215978 GACATTAGAGAGTCTTGAGGAGG - Intronic
932189169 2:69724560-69724582 GACACTGAAGAGAATTGAGGGGG - Intronic
932637733 2:73407132-73407154 GACTCTGCAGAATCCTGAGGTGG + Intronic
933968629 2:87451855-87451877 CTCTCTGCAGAGTCCTGAGATGG + Intergenic
934504813 2:94881369-94881391 CCCTCTGCAGACTCTTGGGGAGG - Intergenic
934673057 2:96228903-96228925 GACTCTACCGAGTCCTGAGGTGG + Intergenic
936325165 2:111498650-111498672 CTCTCTGCAGAGTCCTGAGATGG - Intergenic
938571713 2:132567508-132567530 GACCCTGCAGAGTGCTGAGGAGG - Intronic
938679166 2:133671587-133671609 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
938918426 2:135968475-135968497 GACTCTGCAGAGCCCTAAGGTGG + Intronic
938985867 2:136575769-136575791 GACCCTGCAGAGTACTGAGGTGG + Intergenic
939354496 2:141083778-141083800 CTCGCTGCAGAGTCCTGAGGTGG - Intronic
939656847 2:144836731-144836753 GACTCGGAAGAGTCTTGAGAAGG - Intergenic
940866320 2:158820883-158820905 TTCTCTGCAGAGTCCCGAGGTGG - Intronic
942659966 2:178254003-178254025 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
942908718 2:181215276-181215298 GACTCTGCAAAGTCCTGAAATGG - Intergenic
943464047 2:188206723-188206745 GACTCTGCAGTAACTTGAGTAGG - Intergenic
943635687 2:190304353-190304375 GACTCTGCAGAGACCCAAGGAGG + Intronic
944250652 2:197577758-197577780 GACTCTGAAAAGTCGGGAGGTGG - Intronic
944422387 2:199545191-199545213 GACTCTGCAGAGTACCAAGGAGG + Intergenic
944428871 2:199611979-199612001 TTCTCTGCAGAGTCCTGAGGTGG - Intergenic
944660216 2:201915610-201915632 GACTCTGCAGAGCATAGAGGTGG + Intergenic
944918707 2:204388265-204388287 CTCTCTGCAGAGTCTTGAGATGG - Intergenic
946146879 2:217737791-217737813 GACTCTGCAGATACCTGAGCTGG - Intronic
947527505 2:230887817-230887839 GACTCAGCAGATCCTTCAGGAGG + Intergenic
948575142 2:238945081-238945103 CTCTTTGCAGAGTCCTGAGGTGG + Intergenic
1168765098 20:376779-376801 GTCTCTGAAGTGTCTGGAGGTGG + Intronic
1169249798 20:4051651-4051673 GACTCTGCAGAGTCTCCAGGTGG - Intergenic
1169395070 20:5221825-5221847 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1170060946 20:12258576-12258598 TTCTCTGCAGAGTCCTGAAGTGG + Intergenic
1170278064 20:14615124-14615146 GACTCTTCAGAGTCTTAAGTTGG + Intronic
1170747479 20:19113538-19113560 GACTCTGCAGATTCTTAGGCTGG + Intergenic
1173912657 20:46681773-46681795 GACTCTACAGAGACCTGAGGCGG + Intronic
1175296940 20:57915041-57915063 GGCTCTGCAGATTCCCGAGGTGG + Intergenic
1175531442 20:59676092-59676114 GGCCATGCAGAGTCCTGAGGCGG - Intronic
1175850786 20:62091267-62091289 GAACCTGCAAAGTCCTGAGGTGG + Intergenic
1177264841 21:18769164-18769186 GACTCTGCAGAGTCCCTTGGTGG - Intergenic
1178387172 21:32162220-32162242 GGCTTTGGAGAGTTTTGAGGCGG - Intergenic
1178534305 21:33399678-33399700 TTCTCTGCAGAGTCATGAGGTGG - Intergenic
1179370235 21:40800123-40800145 GACTCTGTAAAGTCCTGAGGTGG - Intronic
1180112839 21:45672202-45672224 GACTCTGCAGAGTCCTGAGGTGG - Intronic
1183603269 22:38852379-38852401 GACTCTACAGAGTCCCGAGGTGG - Intergenic
1184283334 22:43451714-43451736 ACCTCTGCAGAGTTTTAAGGGGG - Intronic
1184393658 22:44219885-44219907 TCCTCTGCAGAGTCCCGAGGTGG + Intergenic
1184394110 22:44222545-44222567 CTCTCTGCAGAGTCCCGAGGTGG + Intergenic
949374953 3:3378982-3379004 GACTCTGCAGAGTGCTGAGGTGG + Intergenic
949866231 3:8549788-8549810 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
950907752 3:16554421-16554443 TACCCTGCCGAGTCTTGAGGAGG + Intergenic
951078945 3:18428203-18428225 TTCTCTGCAGAGTCCTGTGGTGG + Intronic
952327848 3:32336979-32337001 GACTCTGCAGAGTTTTGAGGCGG + Intronic
952413064 3:33066436-33066458 GACTCTGCAGAGTCCTGAGGGGG - Intronic
952933824 3:38379971-38379993 CTCTCTGCAGAGTCCTGAGGAGG + Intronic
953833675 3:46324968-46324990 TACTCTGAAGAGTCTTGAGGTGG + Intergenic
954377989 3:50205056-50205078 GACTCCGTTGAGTCTTGTGGGGG - Intergenic
955792850 3:62606464-62606486 CTCTCTGCAGAGTCCTAAGGTGG - Intronic
956741990 3:72282353-72282375 GACTCTGTAGAGTCCTGGGATGG - Intergenic
956743644 3:72294278-72294300 GATTCTACAGAGTCCTGAGGTGG - Intergenic
957997656 3:87710732-87710754 GACTCTGTAGAGTCCTGAAGGGG - Intergenic
958270317 3:91491429-91491451 CTCTCTGAAGAGTCTTGAGGTGG - Intergenic
960237267 3:115298230-115298252 AACTCTGCGGAGTCTTGAAGTGG + Intergenic
960684642 3:120284708-120284730 GACTCTGGAAAGTCTACAGGCGG + Intronic
961313570 3:126019133-126019155 GACTCTGCAGAGTCCGGAGGTGG + Intronic
962390503 3:134967602-134967624 GACTCTGCAGAGCCCTGAAGTGG - Intronic
962605011 3:137025720-137025742 GACTCTCCAGAATGTTGAGCTGG - Intergenic
963344283 3:144075287-144075309 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
964124156 3:153218397-153218419 AAATGTGCAGAGGCTTGAGGGGG + Intergenic
965652618 3:170948985-170949007 GACTCTACAGAGTCCCAAGGTGG + Intergenic
965907383 3:173725757-173725779 GACTCATCAGAGGCTTGACGGGG + Intronic
966897575 3:184457301-184457323 CTCTTTGCAGAGTCCTGAGGTGG + Intronic
967581102 3:191155873-191155895 AACTCTGCAGAATTGTGAGGAGG - Intergenic
967689951 3:192462461-192462483 CTCTCTACAGAGTCTTGAGGTGG - Intronic
967762877 3:193244713-193244735 GACTCTGCAGAGTCCCAAGGTGG + Intronic
968468247 4:764022-764044 GAGGCTGCAGGGGCTTGAGGAGG + Intronic
969046785 4:4342145-4342167 GACTCTGCAGAGCCTCAAGGTGG - Intergenic
969391187 4:6892362-6892384 GCATCTGCAGAGTCATGGGGTGG - Intergenic
970383337 4:15530816-15530838 GGCTCAGCAGATGCTTGAGGTGG - Intronic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
970800212 4:19964631-19964653 GAGTCTGAAAAGTCTTGAGGTGG + Intergenic
970811587 4:20100442-20100464 GACTCTGCAAAGTCCTAAAGTGG - Intergenic
971331934 4:25688831-25688853 GACTCTGTAGAGTCCCAAGGTGG - Intergenic
973884401 4:55306109-55306131 GCCTGTGCAGAGTATTGTGGGGG - Intergenic
974362512 4:60900656-60900678 GACTCTGCAACATCTTTAGGGGG - Intergenic
975641224 4:76502143-76502165 GACTCTGGAGAGTCCCGAGACGG - Intronic
976425773 4:84901425-84901447 CTCTCTACAGAGTCCTGAGGTGG - Intronic
977032641 4:91905972-91905994 GACTCTGCAGAATCTCCATGTGG - Intergenic
979018902 4:115469089-115469111 GACTCCGCAGAGTCCAGAGGTGG - Intergenic
979567628 4:122173347-122173369 GACTCTGCAGAGTCTTGAGGTGG + Intronic
981361021 4:143845743-143845765 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981371759 4:143966745-143966767 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
981380849 4:144069943-144069965 GATTCTGTAGAGTCCTGAGGTGG + Intergenic
981699829 4:147596240-147596262 CTCTCTGCAGAGTCTCAAGGTGG - Intergenic
981933763 4:150217482-150217504 GACTCTGAAGAGCCGTGAGAGGG - Intronic
982152065 4:152470988-152471010 TACTCTGCAGATTCTTTAAGAGG - Intronic
983634528 4:169883595-169883617 CCCTCTGCAGAGTCCTGAGGGGG - Intergenic
983895118 4:173072964-173072986 GACTCTGAAGAGTCCCGAAGTGG - Intergenic
984321530 4:178203337-178203359 CCCTCAGCAGAGTCTTGAGGTGG + Intergenic
985839972 5:2298777-2298799 GACTCTGCAGGCTCTAGAAGAGG - Intergenic
985869567 5:2543311-2543333 GACTGTGGAGTGACTTGAGGCGG - Intergenic
986340118 5:6781670-6781692 CTCTCTGCAGAGTCCTGAGTTGG - Intergenic
986923832 5:12721181-12721203 CTCTCTGCAGAGTCCTAAGGTGG - Intergenic
987798988 5:22668537-22668559 CTCTCTGCAGAGTTCTGAGGTGG + Intronic
987886759 5:23823281-23823303 TCCTCTGCAGAGTCTTGAGTTGG - Intergenic
988920599 5:35937959-35937981 GATTCATCAGAGACTTGAGGGGG - Intronic
990463613 5:56052031-56052053 CTCTCTGCAGAGTCCTGAGGTGG + Intergenic
990477963 5:56180083-56180105 CTCTCTGCAGAGTCCTGAGGTGG + Intronic
991952163 5:71956758-71956780 GAGTATGCAGAGGCTTGGGGTGG + Intergenic
991988231 5:72311637-72311659 GACTATTCAGAGTCCTGAGGTGG - Intronic
992158483 5:73977975-73977997 CTCTCTGCAGAGTCCCGAGGAGG - Intergenic
992214178 5:74509028-74509050 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
992478071 5:77123200-77123222 ATCTCTGCAGAGTCCCGAGGTGG + Intergenic
992606679 5:78464598-78464620 CACTCTGCAGATTTTTGACGTGG + Intronic
993123452 5:83803251-83803273 AACTTTGCAGAGTATTGAGGTGG + Intergenic
995345641 5:111113748-111113770 GACTCTGAAGAGTCCCAAGGTGG + Intronic
996102580 5:119459655-119459677 GACTCTGTAGAGTCCCGAGATGG + Intronic
997189122 5:131914131-131914153 CTCTCTGCAGAGTCCCGAGGTGG - Intronic
998403486 5:141860555-141860577 GACTCTGCAGAGCCTTTAATAGG + Intronic
999617777 5:153443326-153443348 GACTCTGCAGAGTCCTGAGGAGG + Intergenic
1000169203 5:158685132-158685154 GACTATGCAGAGCCTTGTGTAGG - Intergenic
1000268748 5:159662903-159662925 GACTCTGCAGAGTTCTGAGATGG + Intergenic
1001163023 5:169338182-169338204 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
1002162603 5:177324578-177324600 GACTCTGCAGAGTCTGGAGCTGG + Intergenic
1003232715 6:4269209-4269231 GACTCTGCAGAGCCCTGAGGTGG - Intergenic
1003612650 6:7627468-7627490 GTCTCTGGAGACTCTAGAGGAGG + Intergenic
1003613795 6:7636913-7636935 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1003616419 6:7659038-7659060 TTCTCTGCAGTGTCCTGAGGTGG + Intergenic
1003863546 6:10343495-10343517 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1004173525 6:13318114-13318136 CTCTCTGCAGGGTCCTGAGGTGG - Intronic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1004673827 6:17822601-17822623 AACTCTGCAGAGTTTACAGGTGG - Intronic
1005006469 6:21292275-21292297 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1005442092 6:25881185-25881207 GACTCTGCAGAGTCCAGATCTGG - Intronic
1005912081 6:30319310-30319332 AACTCTGCAGAATCCTGAGGTGG - Intergenic
1006122401 6:31815347-31815369 GACTCTGGAGAGTTCTGAGCAGG + Intergenic
1006804941 6:36781964-36781986 GGCTCTGCATAGCCTTGAGCAGG + Intronic
1006843921 6:37049920-37049942 CACTCAGCAGGGTCCTGAGGAGG + Intergenic
1007526874 6:42503724-42503746 GACTCTGCAGAGCCCCAAGGTGG + Intergenic
1008984832 6:57529926-57529948 CTCTCTGAAGAGTCTTGAGGTGG + Intronic
1009172879 6:60422870-60422892 CTCTCTGAAGAGTCTTGAGGTGG + Intergenic
1014227415 6:118863753-118863775 CTCTCTGCAGAGTTCTGAGGTGG - Intronic
1015140181 6:129921931-129921953 TTCTCTGCAAAGTTTTGAGGAGG + Intergenic
1015770549 6:136763918-136763940 CTCTCTGCAGAGTCTCAAGGTGG - Intronic
1016032074 6:139348131-139348153 GACTCTGGAGAGTCAGAAGGGGG + Intergenic
1016440312 6:144076531-144076553 CTCTCTGCAGAGTCCTGAGGTGG - Intergenic
1017144928 6:151225997-151226019 GCCTCTGCCGAGTCGTGCGGAGG - Intergenic
1017484226 6:154888344-154888366 GACTCTGCAGAGTCCTGAGGTGG + Intronic
1017767674 6:157620222-157620244 GACACTGCAGAGTCTCAAGGTGG + Intronic
1019068714 6:169324213-169324235 GAGGCTGCAGAGTTTTGATGTGG - Intergenic
1020199924 7:6071766-6071788 GACTCTGCAAAGTCCCGAGGTGG + Intergenic
1020351793 7:7227803-7227825 TCCTCTGAAGAGTCTTGAGGTGG - Intronic
1020457878 7:8394822-8394844 GAATCTGCAGGTCCTTGAGGAGG - Intergenic
1023729419 7:43176522-43176544 GACTCTGCAGAGGCCTGAGGTGG + Intronic
1024116702 7:46201090-46201112 GACTCTGCAGAGTCCCAAGGTGG + Intergenic
1024124008 7:46273177-46273199 GACTCTACAGAGTCTGCAGGAGG + Intergenic
1024220233 7:47281359-47281381 GACACAGCAGAGTGTTGAGTTGG - Intronic
1026367805 7:69667085-69667107 GACTCTACAAAGTCCTGAGGTGG + Intronic
1027331617 7:77101578-77101600 GGCTCTGCAGAGTCATGAAGTGG - Intergenic
1027496638 7:78895232-78895254 CTATCTGCAGAGTCCTGAGGTGG - Intronic
1027878271 7:83799809-83799831 GTCTTTGCAGGGTTTTGAGGGGG + Intergenic
1028445939 7:90924178-90924200 CTCTCTGCAGAGTCCTGAGGCGG + Intronic
1028534094 7:91872028-91872050 GACTCTGAAGAGTCCTGAGGCGG - Intronic
1029065821 7:97847302-97847324 GGCTCTGCACATTGTTGAGGGGG - Intergenic
1029784155 7:102769762-102769784 GGCTCTGCAGAGTCATGAAGTGG + Intronic
1029805159 7:102988365-102988387 TACTCAGCAGTGTCTGGAGGTGG - Intronic
1030028921 7:105351226-105351248 GACTCTGCAGAGTCCCAAGGTGG - Intronic
1031004179 7:116453406-116453428 GTGTCAGCAGAGTCGTGAGGAGG - Intronic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1031772220 7:125858352-125858374 GACTGTGCAGATTCTTGAAGGGG - Intergenic
1032633992 7:133686158-133686180 CTTTCTGCAGAGTCATGAGGTGG - Intronic
1032850984 7:135795193-135795215 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1032892638 7:136215784-136215806 TACTCTGCAGAGTCCTGAGGTGG + Intergenic
1032968012 7:137124123-137124145 GAGACTGCAGACTCTTGAGGTGG + Intergenic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033561543 7:142536714-142536736 GACTCTGCAGAGTCCCCAGGTGG + Intergenic
1035106699 7:156446984-156447006 GTCTCTGCAGAATCCAGAGGTGG + Intergenic
1035197218 7:157231690-157231712 GACTCTGCAGAGTCCGGAGGCGG - Intronic
1035360266 7:158307963-158307985 CTCTCTGCAGAGTCCTGAGGTGG - Intronic
1036470847 8:9051274-9051296 GACTCTGTGGAGTCCTGAGGTGG + Intronic
1037180827 8:16003732-16003754 CTCTCTGCAGAGTCTCAAGGTGG - Intergenic
1037502815 8:19501543-19501565 AACCCTGCAGAGGCTGGAGGAGG + Intronic
1038158829 8:25017226-25017248 GACTCTGAAGAGTCCTGAGGTGG + Intergenic
1038323600 8:26552626-26552648 TTCTCTGCAGAGTTCTGAGGAGG + Intronic
1038496689 8:28008352-28008374 GAGTCAGAAGAGTCTTGAAGAGG + Intergenic
1039449804 8:37663315-37663337 TTCTCTGCAGGGTCCTGAGGAGG + Intergenic
1040454756 8:47585706-47585728 GACTCTGCAGAGTCTTGAGATGG + Intronic
1040895247 8:52361344-52361366 GAATCACTAGAGTCTTGAGGGGG + Intronic
1041153969 8:54964487-54964509 GACTCTGCAGAGTCCTCAGGTGG - Intergenic
1041356682 8:57007886-57007908 CACTCTGCAGAGTCTTGAGGGGG - Intergenic
1041386517 8:57309996-57310018 GAGTTTGCAGAGTCTTCAGCTGG + Intergenic
1042036105 8:64535919-64535941 GACTCTGGAGAGTTTTGAGCAGG + Intergenic
1042195584 8:66228862-66228884 GCCACTGCTGAGGCTTGAGGAGG + Intergenic
1042867474 8:73368471-73368493 GACTCTGCAGTGTCCCCAGGTGG + Intergenic
1043811726 8:84750772-84750794 CCCTATGCACAGTCTTGAGGTGG - Intronic
1044163876 8:88955795-88955817 GACTCTGCAGAGTCCCAAGGTGG - Intergenic
1045518132 8:102879144-102879166 GACTCTGCAGTGTCCTGAGGTGG - Intronic
1046880598 8:119302977-119302999 GACTCTGAAGAGTCCTGAAGTGG + Intergenic
1047862447 8:128983294-128983316 GACCCTGCCGAGTCCTGGGGAGG - Intergenic
1049010348 8:139883224-139883246 GACTCTGCAGAGTGCTCAGGTGG - Intronic
1049229853 8:141476291-141476313 GCCTCTGCAGGGCCTTGAGCTGG + Intergenic
1049631335 8:143659773-143659795 GACTCTGCAAAGTCCAGAGATGG + Intergenic
1049917995 9:336978-337000 CTCTCTGTAGAGTCCTGAGGTGG + Intronic
1052219936 9:26007877-26007899 GACTCTGCAGAGTCCCAAGGTGG - Intergenic
1052943829 9:34151323-34151345 GATTCTTCAGAGAGTTGAGGAGG - Intergenic
1053240458 9:36490316-36490338 GACTCTGCACAGTCCTGAGGTGG - Intergenic
1054765576 9:69039881-69039903 GACTTTGCAGAGTATTGAGGCGG + Intronic
1054952084 9:70863479-70863501 GTCTCTGAAGAGCTTTGAGGAGG + Intronic
1055020627 9:71665593-71665615 GACTCTGAAGAGTCGTGTGGCGG - Intergenic
1055140444 9:72871220-72871242 GACTCTGCAGAGTCCCATGGTGG + Intergenic
1055843898 9:80537699-80537721 GACTCTGCAGGGTTCTGAGGTGG - Intergenic
1056103489 9:83323572-83323594 CTCTCTGCAGAGTCCTGAAGTGG - Intronic
1056454726 9:86748781-86748803 CTCCCTGCAGAGTCCTGAGGTGG - Intergenic
1056566901 9:87781201-87781223 ATCTCAGCAGAGTCCTGAGGTGG + Intergenic
1056783803 9:89573482-89573504 GACTCTGCAGAGTCCTGAGGTGG + Intergenic
1057310168 9:93937943-93937965 GACTATGCCCAGTGTTGAGGAGG + Intergenic
1058395406 9:104547567-104547589 GACACTGCAGAGTCCCAAGGTGG + Intergenic
1058562973 9:106249359-106249381 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1061396117 9:130343992-130344014 GACTCTGCACAGTGGGGAGGGGG + Intronic
1062361622 9:136190938-136190960 GACTCTTCAGAGGGGTGAGGTGG + Intergenic
1062562301 9:137146929-137146951 GGGTCTGCTGAGTCTTGGGGGGG + Intronic
1062618630 9:137409249-137409271 GACTCCGAAGGGTCCTGAGGCGG - Intronic
1203744458 Un_GL000218v1:34312-34334 CCCTCTGCAGACTCTTGGGGAGG + Intergenic
1203565648 Un_KI270744v1:85172-85194 CCCTCTGCAGACTCTTGGGGAGG - Intergenic
1185963785 X:4576902-4576924 GACTTTGCAGAATCCCGAGGTGG - Intergenic
1186387824 X:9127756-9127778 GACTCTGCAGAGTCCTGAATTGG - Intronic
1186676176 X:11819753-11819775 CTCTTTGCAGAGTCTGGAGGTGG + Intergenic
1186790218 X:12990220-12990242 CTCTCTGCAGAGTCCTGAGGCGG - Intergenic
1186792918 X:13016332-13016354 GACACTGCAGGGACTTGTGGTGG + Intergenic
1186809564 X:13174909-13174931 GACTCTGCAGAGTTCTGAGGTGG + Intergenic
1186910198 X:14155649-14155671 CTCTCTGCAGAGTCTGCAGGTGG - Intergenic
1186987915 X:15036629-15036651 GACTCTGCAAAGTTCTGAGGTGG + Intergenic
1187592003 X:20727027-20727049 GACTCTTCAGAGGCTGGAAGCGG + Intergenic
1187813857 X:23209733-23209755 GATTCTGGAGAGTCCTGTGGAGG - Intergenic
1188801452 X:34536163-34536185 GACTCTGCAGAGTCTCAAGATGG - Intergenic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1190583699 X:51915546-51915568 GACACTGCAGAGTCCCGAGGCGG - Intergenic
1192229580 X:69255904-69255926 GGCTCTGAAGAGCCCTGAGGGGG - Intergenic
1192473201 X:71417259-71417281 AACTCTGCAGAGTCCCGAGGTGG - Intronic
1192620300 X:72672431-72672453 AACTCTGCAGAGTCCCAAGGTGG + Intronic
1196317891 X:114250745-114250767 GACTCTGCAGAGTCCTGAGGTGG - Intergenic
1199762679 X:150917195-150917217 GATTCTGCAGAGTACTGAGGTGG - Intergenic
1202274066 Y:23097666-23097688 TATCCTGCCGAGTCTTGAGGAGG + Intergenic
1202291960 Y:23323011-23323033 TATCCTGCCGAGTCTTGAGGAGG - Intergenic
1202427062 Y:24731411-24731433 TATCCTGCCGAGTCTTGAGGAGG + Intergenic
1202443729 Y:24938683-24938705 TATCCTGCCGAGTCTTGAGGAGG - Intergenic