ID: 979567890

View in Genome Browser
Species Human (GRCh38)
Location 4:122177296-122177318
Sequence GGGGAGAAGTAGTTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 705
Summary {0: 1, 1: 3, 2: 30, 3: 145, 4: 526}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979567890 Original CRISPR GGGGAGAAGTAGTTGGATTC TGG (reversed) Intronic
900523715 1:3118467-3118489 AGCTAGAAGTGGTTGGATTCCGG + Intronic
900666452 1:3818478-3818500 GGCGAGAAGTGGTCAGATTCTGG - Intronic
901203580 1:7481072-7481094 GGAGAGAAGGAGGTGGGTTCAGG - Intronic
901386101 1:8910331-8910353 GGGAAGCAATGGTTGGATTCAGG + Intergenic
901416125 1:9118188-9118210 GTGGAGAAGTGGTTAGATGCCGG + Intronic
901690002 1:10966686-10966708 GGGGAGATGGGGTTGGATTCTGG - Intronic
902124478 1:14197054-14197076 AGGGAAAATTAGGTGGATTCTGG + Intergenic
902945178 1:19830887-19830909 GGTGAGAAGTAATTAGATTCAGG - Intergenic
903286652 1:22281650-22281672 GGTGAGAGGTGGGTGGATTCTGG + Intergenic
903556894 1:24200549-24200571 GGTGAGACGTGGCTGGATTCTGG + Intergenic
903629989 1:24761004-24761026 GGTGGGAAGTTGCTGGATTCTGG + Intronic
903801974 1:25975663-25975685 GGAGAGAAGTGATTGGAGTCAGG - Intronic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
904257876 1:29267915-29267937 GGGGAGAAGTGGTCAGATTCTGG + Intronic
905032629 1:34897798-34897820 GGTGAGGAGTGGTTGGATCCTGG + Intronic
905380492 1:37558267-37558289 GGTGAAAAGTGGTTGGATTTGGG - Intronic
905494488 1:38374037-38374059 GGTGAGAAGTAACTGCATTCAGG + Intergenic
905585673 1:39115690-39115712 GGGGAGAAGGAGCTGGCTTTAGG + Intronic
906349562 1:45046348-45046370 GATGAGCAGTAGTTGGATTCTGG + Intronic
907905860 1:58783475-58783497 GGGGACAAGTCGTCGGAGTCCGG - Exonic
908774362 1:67625943-67625965 GGTGAGAAGCAGTTGAATTCCGG - Intergenic
910247414 1:85154705-85154727 GGTGAGATATGGTTGGATTCTGG - Intergenic
910256950 1:85258523-85258545 GGGGAGGAGACGTTGGAATCAGG - Exonic
910782179 1:90951106-90951128 GATGAGAAGTGATTGGATTCTGG - Intronic
911609367 1:99943971-99943993 GGGGAGGAATAGTTGGTTCCAGG - Intergenic
911831500 1:102555378-102555400 GGAAAGAACTAGTTGAATTCTGG + Intergenic
912130673 1:106596138-106596160 GGGGAAAAGGAGCTGGATTCAGG - Intergenic
912565728 1:110585874-110585896 GGGGAGAAGCAGTTGGACTTTGG - Intergenic
913392565 1:118330811-118330833 GGTGACAAGTAGATGGATTCAGG - Intergenic
913672608 1:121111727-121111749 GGTGAGATGTGGTTGGATGCTGG + Intergenic
914024377 1:143899092-143899114 GGTGAGATGTGGTTGGATGCTGG + Intergenic
914662858 1:149807113-149807135 GGTGAGATGTGGTTGGATGCTGG + Intronic
914908338 1:151764881-151764903 GGTGACAAGTGGCTGGATTCTGG - Intronic
915896023 1:159811610-159811632 GGGGAGAGGAAGTTGAAGTCTGG - Intronic
915955003 1:160213885-160213907 TGGGAGAGGTAGGTGGATCCAGG + Exonic
915988088 1:160486361-160486383 GGAGAGAAGTGGTTGTCTTCTGG + Exonic
916149663 1:161774378-161774400 AATGAGAAGTAGTTGGATTATGG + Intronic
916560600 1:165931361-165931383 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
916877592 1:168986438-168986460 GGTGGGAGGTAGTTGGATTATGG - Intergenic
917184002 1:172331942-172331964 AGTGAGAAGCAGTTGGATTCAGG + Intronic
917359698 1:174161565-174161587 GGGGAGAAGTAGATGAAATAGGG + Intronic
918065140 1:181095511-181095533 GGAGAGAAGTAATTGGATTATGG - Intergenic
918111080 1:181456022-181456044 GAGGAGAAGAATTTGGTTTCAGG + Intronic
918371253 1:183863648-183863670 GATGAGAAGTGTTTGGATTCAGG + Intronic
918973633 1:191451079-191451101 GAAGAGAAGTAGTTTGTTTCTGG + Intergenic
919475962 1:198034301-198034323 GGTGAGAAAGGGTTGGATTCTGG + Intergenic
919545356 1:198911198-198911220 GGTGAGAAGTGGCTGGATTCTGG - Intergenic
919619389 1:199847814-199847836 GGAGACAAGTGGATGGATTCAGG - Intergenic
919643268 1:200066208-200066230 GGGGAGAAGTTGATGGACCCAGG + Intronic
920377623 1:205517723-205517745 GGTGAGAAGTGGCTGGATTTGGG - Intronic
920974613 1:210774075-210774097 GGGGATAAGTGGTTGAGTTCGGG + Intronic
921276426 1:213525212-213525234 GGAGAGAAGCACTTGGATTCTGG + Intergenic
921442983 1:215210919-215210941 AGTGAGAAGTGATTGGATTCTGG - Intronic
922019290 1:221687773-221687795 GGGGAGCAGTCTATGGATTCTGG - Intergenic
922326443 1:224532542-224532564 GGGCAGAAGTGGTTGTATTCTGG + Intronic
923027577 1:230218160-230218182 GGTGAGAGGTGGTTGGATTCTGG + Intronic
923544991 1:234917626-234917648 GGGGAGAAGCAATTGGCTGCAGG - Intergenic
923793253 1:237128828-237128850 GGAGAAAAGAGGTTGGATTCCGG + Intronic
923944291 1:238865126-238865148 GGGGAGAAGCAGCTGGATTCAGG - Intergenic
923974980 1:239252348-239252370 AGTGAGAAATAGTTGGATTATGG + Intergenic
924310971 1:242742834-242742856 GGTGAGAAGTTGTTGGATTTAGG + Intergenic
924754681 1:246931093-246931115 GCGGGGAAGAAGTTGGACTCGGG - Intronic
1063333767 10:5188793-5188815 GAGGAGAAGTGGTCAGATTCTGG + Intergenic
1063478621 10:6350608-6350630 GGGGATCAGTACTTGGAGTCGGG - Intergenic
1063555026 10:7070151-7070173 GGTGAGAAGGGGTTAGATTCTGG + Intergenic
1063614170 10:7587989-7588011 TGGGATGAGCAGTTGGATTCAGG - Intronic
1063747875 10:8906274-8906296 GGGGAGAAGCAATTGCCTTCTGG - Intergenic
1063802977 10:9602712-9602734 GGTGAGAAGTAGTAAGATTCAGG + Intergenic
1064477219 10:15704150-15704172 GGAAAGAAGTAGATGGATTTGGG - Intronic
1064483819 10:15765368-15765390 GGTGAGAAGCAGATGGATTGTGG + Intergenic
1064774814 10:18764692-18764714 GGTGGGAAGTGGTTGGATTATGG + Intergenic
1066380039 10:34893334-34893356 GGTGAGAAATGGTCGGATTCTGG + Intergenic
1067018938 10:42778591-42778613 AGTGACAAGTGGTTGGATTCTGG + Intergenic
1067224238 10:44364934-44364956 AGTGAGAAGTGATTGGATTCTGG + Intergenic
1067280716 10:44870086-44870108 GGTGAGAAGTGGTTGGATTTTGG - Intergenic
1067553700 10:47253373-47253395 GGTGATGAGAAGTTGGATTCAGG - Intergenic
1068696503 10:59973096-59973118 GATGAGAAGTGGTTAGATTCAGG + Intergenic
1068894273 10:62182135-62182157 GGTGATAAGTGGTTGGATTCTGG + Intergenic
1070837878 10:79462201-79462223 GGTGAGAAATGGTTGGATTCGGG + Intergenic
1071252143 10:83829881-83829903 AGGCAGAAGTAATTGCATTCAGG - Intergenic
1071530599 10:86388237-86388259 GGTGAGAAGGGGCTGGATTCTGG - Intergenic
1071534895 10:86420356-86420378 GGTGAGAGGTAGTCAGATTCTGG + Intergenic
1071990022 10:91092611-91092633 GGTGGGAAGTAGTTGGATCATGG - Intergenic
1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG + Intronic
1073081000 10:100860696-100860718 TGGGAGAAGGAGATGGAGTCAGG + Intergenic
1075016658 10:118914646-118914668 GGGGGGAAGTGTTTGGATTATGG - Intergenic
1075382546 10:122031006-122031028 GGGTGGAAGTAGGTGGAGTCAGG - Intronic
1075661958 10:124203706-124203728 GGGGAGAAGTAGATGGTTGAGGG - Intergenic
1077901793 11:6496107-6496129 GGTGGGAAATAGTTGGATTCTGG + Intronic
1078087858 11:8244922-8244944 GGGGAGAAGTGGCTGGCTTCTGG - Intronic
1078181862 11:9018356-9018378 TGAGAGAAGTAGAAGGATTCTGG - Intergenic
1078899385 11:15627484-15627506 GGGGAGAAGTGAATGGATCCTGG - Intergenic
1080048014 11:27829642-27829664 GATGAGAAGTGGTTGGATTCTGG + Intergenic
1081325229 11:41736741-41736763 GGTGAGAAATGATTGGATTCTGG - Intergenic
1081540163 11:44028985-44029007 AGTGAGAAGTGGTTGGATTCTGG - Intergenic
1081840023 11:46193371-46193393 GGGGAGAAGTGATTGGATTCAGG + Intergenic
1082087013 11:48058594-48058616 GGTGAGAAGTAGTAAGGTTCTGG - Intronic
1082270041 11:50160496-50160518 GGTGAGAAGCAGTCAGATTCTGG + Intergenic
1082726868 11:56746824-56746846 GGGGAGAAGTGGTCAGATTCAGG - Intergenic
1082758931 11:57107024-57107046 TGTGAGAAGTAGCTGGACTCTGG + Intergenic
1083835778 11:65266270-65266292 GGCGAGAAGTGGCTGGACTCTGG - Intronic
1084126169 11:67100421-67100443 AGAGAGAAGTGGGTGGATTCGGG - Intergenic
1085391791 11:76185882-76185904 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1085422040 11:76371056-76371078 GGAGAGAAGCAGATGGATTTGGG - Intronic
1086165793 11:83776272-83776294 AGAGAGAAGTAGATAGATTCAGG - Intronic
1086463029 11:87024515-87024537 AGGGAGAAGAGGTTCGATTCTGG - Intergenic
1086499715 11:87439789-87439811 TGGGAGAGGTAGTTGGCTTCAGG + Intergenic
1086866893 11:91990767-91990789 GGTGAGAAGTAGCTGGATTGTGG - Intergenic
1087216729 11:95502947-95502969 GGTGGGAAGTAGTTGGATTGTGG - Intergenic
1087696954 11:101390209-101390231 GTGGAGAAGAAAATGGATTCTGG + Intergenic
1088126171 11:106426379-106426401 GGGTATAAGAAGTTGAATTCTGG + Intergenic
1088644638 11:111907994-111908016 GGGGAGCAGGAGATGGTTTCAGG - Intergenic
1089002935 11:115067417-115067439 GGGGAGACATGGTTGGAGTCAGG - Intergenic
1089411351 11:118245552-118245574 GGGGAACAGGAGTTTGATTCTGG + Intronic
1089710372 11:120310216-120310238 GAGGAGGAGTGGTTGCATTCTGG + Intronic
1090091678 11:123703535-123703557 GGACAGAAGTAGCAGGATTCGGG + Intergenic
1090833417 11:130436255-130436277 GTGGAGGATTATTTGGATTCTGG + Intergenic
1090846861 11:130536667-130536689 TGAAAGAAGTGGTTGGATTCTGG + Intergenic
1091577956 12:1756787-1756809 GGAGGGAAATGGTTGGATTCTGG + Intronic
1091860406 12:3776448-3776470 GAGGAGAAGTGGATGGAGTCAGG + Intergenic
1092336113 12:7635469-7635491 GGTGAGAAGTAGTAAGATTTGGG - Intergenic
1092518235 12:9238367-9238389 GGAGAGAAGTGGGTAGATTCTGG + Intergenic
1093073743 12:14735542-14735564 GGTGAGAAGCAGTTGGATTCTGG - Intergenic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1094068707 12:26389036-26389058 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1094080455 12:26529006-26529028 GGCAAGAAGTTGTAGGATTCTGG - Intronic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095324471 12:40871470-40871492 GGGGCAAAGTGGTTGGATTTGGG + Intronic
1095646487 12:44554449-44554471 GGGGAGAGGGAGTTGGAATGAGG + Intronic
1095675017 12:44906530-44906552 GGTGAGAAGTGGTGAGATTCTGG + Intronic
1095693326 12:45116129-45116151 GTGGAGTAGGAGTTGGATCCAGG - Intergenic
1096553213 12:52387939-52387961 GGTGAGAAGGAGTAGGAGTCTGG - Intergenic
1097258339 12:57697403-57697425 GATGGGAAGTAGTTGGATTCTGG + Intronic
1097376112 12:58844858-58844880 GGTGAGAGGTTGCTGGATTCTGG + Intergenic
1097564836 12:61254061-61254083 GGTGAGAAGTAAGTGGATTGTGG - Intergenic
1097579984 12:61443340-61443362 AGTGAGAAGTAGATGGATTTTGG + Intergenic
1098024351 12:66186990-66187012 GAGGAGAAGGAATTGGAGTCGGG + Intergenic
1098034286 12:66286594-66286616 GGTGAGAAGTGATTGGATTCTGG + Intergenic
1098158968 12:67629564-67629586 AGTGAGAAGTAGGTGGATCCTGG + Intergenic
1098598233 12:72297782-72297804 GGGCAGAAGTAGTGGGAGTCAGG + Intronic
1098604557 12:72374103-72374125 TGTGAGAAGTGGTTGGATTCTGG + Intronic
1099097863 12:78398078-78398100 GAAGAGAAGTGGATGGATTCAGG - Intergenic
1099652675 12:85448211-85448233 GAGAAGAAGTGGTTAGATTCTGG + Intergenic
1099720247 12:86353083-86353105 AGTGAGAAGTGGTTAGATTCTGG - Intronic
1100087075 12:90924400-90924422 GGTGAGAAGTAGTTAGATTCTGG + Intronic
1100662383 12:96714203-96714225 GGTGAGAAGTAGCCAGATTCTGG + Intronic
1100702637 12:97164286-97164308 TGTGAGAAGTGGTTTGATTCTGG + Intergenic
1100799474 12:98216182-98216204 AGTGATAAATAGTTGGATTCTGG - Intergenic
1100885628 12:99066733-99066755 AGCAAGAAGTAGTTAGATTCTGG + Intronic
1101084745 12:101224682-101224704 GGAGAGAACTAGTTGTAATCAGG + Intergenic
1101139674 12:101782496-101782518 GATAAGAAGTGGTTGGATTCTGG - Intronic
1101565998 12:105906020-105906042 GGTAAGAAGTACTTGGGTTCTGG - Intergenic
1101668928 12:106848572-106848594 GGGGAGAAGTGGTTGGATTGTGG + Intronic
1101707341 12:107232835-107232857 GGTGAGAAGTGGTTGGATTCTGG - Intergenic
1103243497 12:119435030-119435052 GGGGAGAAGTGGATGGATTCAGG + Intronic
1103992407 12:124807999-124808021 GGGGAGAAGTGGCTGGATCTGGG - Intronic
1104000051 12:124854613-124854635 GGTGAGAAGTAGTTGGAATCTGG + Intronic
1106357874 13:29001363-29001385 TGGGAGAAGTAGTCAGATGCTGG + Intronic
1106588943 13:31081729-31081751 GGAGAGAAGTGGTTTGGTTCTGG + Intergenic
1106774080 13:32991573-32991595 GGTGATAAGTGCTTGGATTCTGG + Intergenic
1106777305 13:33020702-33020724 GGGGAGAAGTGGTTTGATTCTGG - Intronic
1106936592 13:34729381-34729403 GGGGAGAAGCAGTTACATTCTGG - Intergenic
1107175252 13:37392208-37392230 GGGAAGAAGCTGTTGGATTCTGG + Intergenic
1107588288 13:41876078-41876100 GATAAGAAGTAGTTGGATTTGGG - Intronic
1107696250 13:43002968-43002990 GGTGAGAAGTGGTGAGATTCTGG + Intergenic
1107714743 13:43189075-43189097 GATGAGAAGTTATTGGATTCTGG - Intergenic
1107766670 13:43742732-43742754 GGAGAGAAGTGGTTGAATTCTGG + Intronic
1107813087 13:44218963-44218985 GGGGTGTGGCAGTTGGATTCAGG - Intergenic
1108955638 13:56153984-56154006 GGTGGGAAGAGGTTGGATTCTGG - Intergenic
1110037527 13:70707277-70707299 GGTGAGAAGTGGTGGGGTTCTGG + Intergenic
1110675067 13:78232826-78232848 TCAGAGAAGTACTTGGATTCTGG - Intergenic
1110981572 13:81906634-81906656 AGGGAGAAGTAGTTGAAATCAGG - Intergenic
1112355869 13:98674687-98674709 GGTGAGAAGTGGTGGGATTCTGG - Intergenic
1115095217 14:29627246-29627268 AGGGAGAAGTGGTTGGAATCAGG - Intronic
1115430909 14:33317538-33317560 GGTGAGAGGTAGTTGAATTGTGG + Intronic
1115590276 14:34857611-34857633 GGAGAGAATTGGATGGATTCAGG - Intronic
1115602148 14:34965719-34965741 GGGTATAAGTAATTGCATTCTGG + Intergenic
1115982454 14:39069178-39069200 GGTGGGAAGTAGTTGGATTTTGG - Intronic
1116444853 14:44997106-44997128 GGTAAGAAGTGATTGGATTCTGG + Intronic
1116462764 14:45196829-45196851 GGGGAGGAGAAGTAGTATTCGGG + Intronic
1116467558 14:45251442-45251464 GAGGAGGAGTAGTTACATTCAGG - Intronic
1116575062 14:46563581-46563603 GGGGAGAAGTGATTGGATTATGG - Intergenic
1117323705 14:54648938-54648960 GGAGACAAGTGGTTGGATTCTGG + Intronic
1118112330 14:62735611-62735633 GGTGAGAAGTGGATGGATTGTGG - Intronic
1118233410 14:63976048-63976070 GAGGAGATGTACTTGGATTTGGG + Intronic
1118575042 14:67233711-67233733 GGGGAGAAGTGGTTAGATTCTGG + Intergenic
1118647778 14:67856476-67856498 GGAGACAAGTAGTTAGATGCTGG + Intronic
1119074350 14:71621108-71621130 TGGGAGAAGTAGTTGAGCTCTGG - Intronic
1120164557 14:81182524-81182546 GGTGAGAAGTAGTTGGATTTTGG - Intronic
1120534170 14:85672267-85672289 GGTGGGAAGTAATTGGATTATGG - Intergenic
1120787107 14:88548121-88548143 GGAGAGAGGTGGTTGGAATCTGG - Intronic
1120802793 14:88711572-88711594 GGTGAGAAGTGATTGGATTATGG - Intronic
1121482150 14:94287433-94287455 GGTGAGAAGTGGCTGGATTCTGG - Intronic
1121752178 14:96366065-96366087 AGTTAGAAGCAGTTGGATTCTGG + Intronic
1122250783 14:100437956-100437978 AGAAAGAAGTAGTTGGAGTCTGG + Intronic
1122482454 14:102055806-102055828 GGGGAGATGTGGCTGAATTCTGG - Intergenic
1122736517 14:103847034-103847056 GGGGAGAAGCAGATGCATTTGGG - Intronic
1124025499 15:25961768-25961790 GGTGGGAAGTATTTGGATTATGG + Intergenic
1124068737 15:26371305-26371327 GGCAGGAAGTGGTTGGATTCTGG - Intergenic
1125043079 15:35214529-35214551 GATGAGAAGTGGTTGGATTCTGG - Intergenic
1125064189 15:35462136-35462158 GATGAGAAGTGGTTGGAATCTGG - Intronic
1125772390 15:42178251-42178273 CTGGAGAAGTTGTTGGATTTGGG + Exonic
1126679279 15:51188031-51188053 CGGGAGAAGTAATGAGATTCTGG - Intergenic
1126804088 15:52328494-52328516 AGTGAGAAGTAGCTGGATTTTGG - Intronic
1126812553 15:52422576-52422598 GGTAAAAAGTAGATGGATTCTGG - Intronic
1126928053 15:53612948-53612970 GGTGAGAAGCAGTCAGATTCTGG + Intronic
1127864779 15:63023407-63023429 GGGGGGCAGAAGTTGGATGCTGG + Intergenic
1128321283 15:66696528-66696550 GGGGAGCAGAAGTTGGATCCTGG - Intergenic
1129636945 15:77330264-77330286 GATGAGAAGTAGTTTGATTCTGG - Intronic
1130792156 15:87167131-87167153 GGGGACAAGCTGTTTGATTCTGG - Intergenic
1131159925 15:90099044-90099066 GTGAAGAAGTGGTTGGATTCTGG - Intronic
1131305829 15:91242370-91242392 GGTAAGAAGTGGCTGGATTCTGG - Intronic
1131450837 15:92538469-92538491 GATGAGAAGTGATTGGATTCAGG + Intergenic
1132073314 15:98798599-98798621 GGAGAGAAGTAGTCAGAGTCTGG + Intronic
1133038839 16:3049235-3049257 GGCCAGAAGTAGTTGGATTCGGG + Intronic
1133711151 16:8402214-8402236 GGAGAGAAGTTGTTGAATTCTGG + Intergenic
1133714689 16:8435823-8435845 GGTGGGAAGTAGTTGGATCCTGG - Intergenic
1133835827 16:9366440-9366462 GGAGAGACATGGTTGGATTCTGG + Intergenic
1134051779 16:11142300-11142322 GGGGAGCTGTAGTTGGAAGCTGG + Intronic
1134382803 16:13743983-13744005 AGAGAGAAGTGGTTGGATTTAGG - Intergenic
1135126971 16:19819005-19819027 GGGGAGAAATATTGGGATTGCGG - Intronic
1135343680 16:21669686-21669708 GGTGAGAAGTGGTTGGATTTTGG - Intergenic
1135870855 16:26148979-26149001 GATGAGAGGTAGCTGGATTCTGG - Intergenic
1136452755 16:30363237-30363259 GGGGAGAAGTGGTTGGATTCTGG - Intronic
1136461873 16:30416536-30416558 GGTGAGAAGTGATTGGCTTCTGG - Intronic
1138029661 16:53550442-53550464 TGGGAGGAAAAGTTGGATTCAGG - Intergenic
1138282274 16:55780989-55781011 TGGGAGGAGTAGTTGGAGTCTGG + Intergenic
1138286673 16:55815651-55815673 TGGGAGGAGTAGTTGGAGTCTGG - Intronic
1138407256 16:56806313-56806335 AGTGAGAAGTGGTTGGATTCTGG - Intronic
1138470740 16:57233805-57233827 GGTGATGAGTAGTTGGATTTTGG - Intronic
1138495956 16:57409609-57409631 GAGGAGAAGGAGACGGATTCAGG + Intronic
1138669648 16:58603075-58603097 TGTGAGAAATGGTTGGATTCTGG - Intronic
1139040070 16:62989074-62989096 GGGGAAAAAAAGCTGGATTCAGG - Intergenic
1139046128 16:63061975-63061997 GGGGATAAGTAGCTGGATGTAGG - Intergenic
1139133583 16:64175529-64175551 TGGGAGAAGCAGTTGAGTTCAGG + Intergenic
1139327235 16:66161873-66161895 GGGGAAAAGAAGGTGGATTCTGG + Intergenic
1139573220 16:67826121-67826143 GGGGAGAGGGAGCTGGAGTCTGG - Intronic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1140151756 16:72374521-72374543 GGTAAGAAGTAGAGGGATTCAGG + Intergenic
1140376815 16:74451339-74451361 GGGGACAATCAGTTGGCTTCTGG + Intergenic
1140917106 16:79504300-79504322 GGGGACAGGTAGTTGGTGTCAGG - Intergenic
1141055482 16:80809958-80809980 GAAGAGATGTAGTTGGATTGAGG + Intergenic
1141581770 16:85004287-85004309 TGGGAGAAGTGGTCGGATTTGGG - Intronic
1141773631 16:86107098-86107120 TGGGAGAGGAAATTGGATTCTGG - Intergenic
1141936483 16:87242392-87242414 CGGGAGAGGGAGTTGGTTTCTGG - Intronic
1142669504 17:1481331-1481353 GGCGAGCAGTGATTGGATTCTGG - Intronic
1142765851 17:2063826-2063848 GGGGAGAAGAAGGTGGCCTCGGG + Intronic
1143094207 17:4468413-4468435 GTGGAGAAGTGGTCAGATTCTGG + Intronic
1143123103 17:4621863-4621885 GGTGAGAAGTGATTGGATTCTGG - Intergenic
1144090152 17:11849189-11849211 GGTGAGAAGTGATTGGATTTGGG - Intronic
1144144906 17:12388028-12388050 GATGAGAAGTAGATGGATTCAGG + Intergenic
1144334602 17:14257466-14257488 AGTGAGAAGTAGCTGGATACTGG - Intergenic
1144827625 17:18115183-18115205 GTGGAGAAGTGGTAGGATGCTGG - Intronic
1145790661 17:27624716-27624738 GTGGAGACGTGATTGGATTCAGG + Exonic
1146390761 17:32420453-32420475 GGAAAGAAGTAGTTGGAATTAGG - Intergenic
1146962934 17:37000208-37000230 AGAGAGAACTGGTTGGATTCTGG + Intronic
1147419188 17:40313652-40313674 GGGGAGAGGGTGTTGGATTAAGG - Intronic
1147597691 17:41727398-41727420 CGGGAGAAGTACATGGATTGTGG - Intronic
1149458231 17:56806886-56806908 GGCGAGAAGTAGTCAGGTTCTGG + Intronic
1150175756 17:63053879-63053901 AGTGAGAAGAGGTTGGATTCTGG - Intronic
1150193871 17:63273689-63273711 GGTGAAAAGTAGTTGGATTTGGG - Intronic
1150239254 17:63618910-63618932 GATGAGAAGTGGTTGGATTCAGG + Intergenic
1151444978 17:74157579-74157601 AGGCGGAAGAAGTTGGATTCTGG - Intergenic
1151718534 17:75843491-75843513 GGGGAGAAGTGGTGGGATGGAGG + Exonic
1152097475 17:78280256-78280278 GCTGAGAAGTGGTCGGATTCTGG + Intergenic
1153587161 18:6634425-6634447 GGTGAGAAGTAATTGAATTCTGG - Intergenic
1154374506 18:13797984-13798006 GGTGAGAAGTTGTTGGTTTCGGG - Intergenic
1155870884 18:31026569-31026591 GGTGAGAAGTGGTTAGATTCTGG + Intronic
1156954390 18:42943911-42943933 AGAAAAAAGTAGTTGGATTCTGG - Intronic
1157391812 18:47309402-47309424 GATGAGAAGCAGTTGGGTTCTGG + Intergenic
1157949290 18:52016676-52016698 AGTGAGAAGTAGTCGAATTCTGG - Intergenic
1157956333 18:52101582-52101604 GGTGAGAAGTGGTTGCATTGTGG - Intergenic
1158020999 18:52841578-52841600 AGTGAGAAGTAGTGAGATTCAGG + Intronic
1159016309 18:63104217-63104239 GGGGGGAAGTAGGTGGAATGCGG + Intergenic
1159573386 18:70145489-70145511 GGAGAGAAGTATGGGGATTCAGG - Intronic
1159575340 18:70169328-70169350 GGAGAGAAGAAGTTGGTTTGGGG - Intronic
1159987243 18:74857982-74858004 GGGGAGAGGTAGAAGGAGTCAGG - Intronic
1160151117 18:76395002-76395024 GAGCAGAAGGAGTTGGAATCGGG - Intronic
1161480071 19:4505993-4506015 GGTGAGAAGTAGCTGGGCTCTGG - Intronic
1161596720 19:5154401-5154423 AGTGAGAAGTGGGTGGATTCTGG + Intergenic
1161644425 19:5444441-5444463 GGGGAGAAGTGGGTGGATCTGGG - Intergenic
1161857112 19:6772419-6772441 GGTGAGAAGTGGGTGAATTCTGG + Intergenic
1162126122 19:8500307-8500329 AGTGAGAAGTGGTTGGATTCCGG - Intronic
1162400771 19:10445275-10445297 GGTGAGAAGTAGACAGATTCTGG + Intronic
1162429965 19:10622490-10622512 GGTGAGAAGAGGTTGGATTCTGG + Intronic
1162569032 19:11460238-11460260 GGGGTGAAGTGTGTGGATTCTGG - Intronic
1162917805 19:13883577-13883599 GGGGAGAAGCGGTTGGGTTCTGG - Intronic
1163200297 19:15762016-15762038 GGGGAGAAGTAGATGGCATTGGG - Intergenic
1164715190 19:30385709-30385731 GGGGAGAAGTAGGTGGAATATGG - Intronic
1165098184 19:33421824-33421846 GCGGAGAAGTGGTCAGATTCTGG - Intronic
1165223717 19:34338987-34339009 GGCGAGAAGTGCTTAGATTCTGG + Intronic
1165430704 19:35770356-35770378 GGGGAGAAGCAGTTGAATTCTGG - Intronic
1165733878 19:38163757-38163779 GGGGAGATGAAGTTGGAGACCGG + Intronic
1165761811 19:38326010-38326032 GGGGAGAAGTAAGTGGGTTTTGG + Intronic
1165925267 19:39322119-39322141 GGGGAGAAGTTGCTGGGTTTAGG - Intergenic
1166103164 19:40583280-40583302 GGGGAGCAGTGGGTGGGTTCTGG + Intronic
1166386262 19:42383270-42383292 GGAGAGAAGTGGTGAGATTCTGG + Intergenic
1166651889 19:44581185-44581207 GGTGAGAAGTGGTTGGATTCTGG - Intergenic
1166678951 19:44756101-44756123 GGGGAGAAGTGTTTGAATACTGG + Intronic
1166703379 19:44894945-44894967 GGGGAGAGGAGGTTGGATTCTGG + Intronic
1167639050 19:50670329-50670351 GGTGAGAAGGGATTGGATTCCGG - Intronic
1167780420 19:51595247-51595269 GGAGAGAAGTGGTTAGATTCTGG - Intergenic
1168596701 19:57683263-57683285 TGCGAGAAGCAGTTGGATTCTGG + Intronic
926842817 2:17101519-17101541 GGTGAGAAGTGGTTAAATTCTGG + Intergenic
927211181 2:20640149-20640171 GGGGAGAAGGGGTGGGAGTCCGG + Intronic
927981457 2:27377486-27377508 GGGGAGAAAAAGGTGGCTTCTGG + Exonic
928054786 2:28041963-28041985 GGTGAAAAGTGGTTGGACTCAGG + Intronic
928985166 2:37173747-37173769 GATGAGAAGAGGTTGGATTCTGG - Intronic
929065706 2:37972732-37972754 GGGGAGAAGTGGCTAGATTCTGG + Intronic
929241079 2:39654106-39654128 GGTGAGAAGTGGTTGGTTTCTGG - Intergenic
929448776 2:42022340-42022362 GGAGAGAAGTGAATGGATTCAGG - Intergenic
929461943 2:42108810-42108832 GGCAAGAAGTGGTTGGATTCTGG - Intergenic
929683212 2:44011963-44011985 TGGGAGAAGCAGTTTGAGTCAGG - Intergenic
929834789 2:45385573-45385595 GATGAGAAGTGGTGGGATTCTGG - Intergenic
930829852 2:55731445-55731467 GGGTAAGAGTAGTTGGATTTGGG + Intergenic
930860985 2:56072363-56072385 GAGGAGAAGGAGTTGGGTTGGGG + Intergenic
931623209 2:64231773-64231795 AGTGAGAAGTGGTTGGATGCAGG + Intergenic
932077845 2:68681732-68681754 TGGGAAAAGTGGATGGATTCAGG + Intronic
932160442 2:69454991-69455013 GGGGAGAAGTAGTTTGATGAAGG - Intergenic
932253644 2:70265955-70265977 GGAGAGAAGTAGTGGAATACTGG - Intronic
932270212 2:70402868-70402890 GGGGAGAAGGAGGAGGATTCAGG + Intergenic
932800707 2:74740248-74740270 GGAGAACAGTATTTGGATTCAGG - Intergenic
932879369 2:75486581-75486603 GGAGAGAAGTGGTTGGATTATGG + Intronic
933633567 2:84682740-84682762 GGTGAGGAGTGGTTAGATTCGGG - Intronic
933940419 2:87240356-87240378 GGGGACAAGGGGCTGGATTCTGG - Intergenic
934751636 2:96797693-96797715 GGGGAGAAGTCCTGGGTTTCCGG + Intronic
934883012 2:97999571-97999593 GGTGAGAAGCAGTTAGATTTGGG - Intergenic
936241345 2:110790970-110790992 GTGGGGAAGTAGAGGGATTCAGG - Intronic
936352718 2:111725420-111725442 GGGGACAAGGGGCTGGATTCTGG + Intergenic
936856395 2:116963145-116963167 GGGTATAAATAGTTGGATTACGG + Intergenic
936868615 2:117107348-117107370 GAGGAGAAGCAGTTGGATGTTGG + Intergenic
937392439 2:121501862-121501884 GAGGAGAATTACTGGGATTCGGG + Intronic
939000961 2:136733700-136733722 GGTGAGAAGTGTCTGGATTCTGG - Intergenic
939382720 2:141457122-141457144 GGACAGAAGTAGGTGAATTCTGG + Intronic
939892824 2:147757838-147757860 GGTGAGAAGTGGTTGGATACTGG - Intergenic
940165297 2:150764233-150764255 GGAGAGAAGTAGTTGAATTTGGG - Intergenic
940390754 2:153130124-153130146 TGGGAAAAGTTGTTAGATTCTGG - Intergenic
940855930 2:158728689-158728711 GGCGAGAAGTGGCTGGACTCAGG + Intergenic
941001751 2:160209373-160209395 AGTGAGAAGTGTTTGGATTCTGG + Intronic
941272385 2:163447112-163447134 GGGGAGAATTACTTGAGTTCCGG + Intergenic
942279082 2:174342770-174342792 GGGGAGAAGCAGTGCGTTTCCGG + Intergenic
943593672 2:189829822-189829844 GGTGAAAAGTCGTTAGATTCTGG - Intronic
943608440 2:190003991-190004013 TGTGAGAAGTGATTGGATTCTGG - Intronic
943656487 2:190514172-190514194 TGGCAGAAGTACTTGGACTCTGG - Intronic
943726760 2:191259756-191259778 GGGCAGAAAGAGTTGGAGTCTGG + Intronic
943978007 2:194508542-194508564 GGTGAGAAGTAGCTAGACTCTGG + Intergenic
944686857 2:202125362-202125384 GGGGAGAAATTGTGGGTTTCTGG - Intronic
946001323 2:216485044-216485066 GATGAGAAGTGGTTGGGTTCTGG + Intergenic
946146411 2:217734533-217734555 GGTGAGACGTACTTGGAATCAGG - Intronic
946446599 2:219745458-219745480 AGTGAGAAGTTGTTGGATTCTGG + Intergenic
946919222 2:224560630-224560652 GGTGAGAAAGAGTTGAATTCTGG - Intronic
947512281 2:230767339-230767361 GGGGAGAAGGGATTAGATTCTGG - Intronic
947969408 2:234309752-234309774 GGTGAGAAGTGATTGGAATCTGG + Intergenic
948115477 2:235492281-235492303 GGTGAGAAGTCGTGGGATTCTGG + Intergenic
948325191 2:237112716-237112738 TTGGAGAAATAGTTGGTTTCAGG + Intergenic
1168964059 20:1888255-1888277 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1169784414 20:9343891-9343913 GGTGAGGAGCAGCTGGATTCTGG - Intronic
1169827152 20:9781787-9781809 AGTGAGAAGCAGTTGGAATCTGG - Intronic
1170679785 20:18516107-18516129 AGGGGGAAGTGGGTGGATTCTGG - Intronic
1170743502 20:19078289-19078311 TGGGAGAAGTGGTAAGATTCAGG + Intergenic
1171131620 20:22658879-22658901 GGGGAGAAGTAGAATGATTCTGG + Intergenic
1171386196 20:24770768-24770790 GGGGAGAAGTGCTGGGATTGGGG + Intergenic
1172796806 20:37545649-37545671 GGTGAGATGTAGTTGGATTCTGG - Intergenic
1173178183 20:40781170-40781192 GGTGAAAAGTGATTGGATTCTGG + Intergenic
1173504991 20:43579771-43579793 GGGGAGAAGGGTTTGGATTCTGG + Intronic
1173583622 20:44165377-44165399 GGTGAGAAGCGGCTGGATTCTGG - Intronic
1173849594 20:46209644-46209666 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1174064108 20:47852284-47852306 GGGGAGAAGCGGTGGGAGTCAGG + Intergenic
1174478362 20:50813492-50813514 AGAGTGAAGTAGTTGGATTTGGG + Intronic
1174539457 20:51277515-51277537 GGGGAGGAGGGGCTGGATTCTGG + Intergenic
1174963853 20:55188335-55188357 GGGGAGAATGTGTTGTATTCTGG + Intergenic
1174974799 20:55319759-55319781 GGTGAGAAGTGGCTGGATTCAGG + Intergenic
1175135187 20:56818251-56818273 GGTGACAAGTGGTGGGATTCTGG - Intergenic
1175663328 20:60836555-60836577 GGAGAGAATTCGTTGGATCCTGG - Intergenic
1177299698 21:19226775-19226797 GGAGAGAAGTGATTGGATTATGG + Intergenic
1177550843 21:22620201-22620223 GGTGAGAAGCAGTAGGATTCTGG + Intergenic
1178183576 21:30193118-30193140 GGTGAGAAGTGATTTGATTCTGG - Intergenic
1178591062 21:33910565-33910587 GGAGAGAATTACTTGGATTGTGG - Intronic
1178755626 21:35346902-35346924 GGTGAGAGGTGGTTGGATTGTGG - Intronic
1181406217 22:22686773-22686795 GGGGAGAAGTAGAGGGATCCAGG - Intergenic
1181592870 22:23895559-23895581 GGGGAGGAGGAGTTGGAGTTGGG + Intronic
1181953535 22:26571861-26571883 GGAGAGAAACAGTTGGATCCTGG - Intronic
1182583045 22:31326742-31326764 GTGGAGAAGGAGTTGGAGTGGGG + Exonic
1182764741 22:32750700-32750722 GGTGAGAGATGGTTGGATTCTGG + Intronic
1183075416 22:35423569-35423591 GAGCAGAGGTGGTTGGATTCTGG + Intronic
1183154386 22:36063846-36063868 GGTGAGAAGTGGTTGGATTATGG - Intergenic
1183240718 22:36656443-36656465 GATGAGAAGTGGTTGGATTCGGG - Intronic
1183901043 22:41006321-41006343 GGTGACAAATGGTTGGATTCTGG - Intergenic
950008759 3:9707460-9707482 GGGGAGAAGTGGTCAGATTCAGG + Intronic
950114020 3:10438892-10438914 GAGGAGAAGTAATTGGAAACTGG + Intronic
951017000 3:17742514-17742536 GGGGAGGAGGAGGAGGATTCAGG - Intronic
951250636 3:20390388-20390410 AGTGAGAAGTGGTTGGATTTTGG + Intergenic
951345069 3:21537984-21538006 GGTGAGAAGCAGTCAGATTCTGG + Intronic
951727546 3:25776802-25776824 GGAGAGAAGTAGATGGATCCAGG - Intronic
951885728 3:27522212-27522234 GGGGAGAAATGGTTGGATTTGGG + Intergenic
952909910 3:38174686-38174708 GGTGAGAAGTGGTCAGATTCTGG + Intronic
953035965 3:39211277-39211299 GGGGAAAAATGGTCGGATTCTGG - Intergenic
953647300 3:44767335-44767357 GGCAAGAAGTTGTTGGATTGTGG + Intronic
954562750 3:51571924-51571946 GGGGAAAAGTATATGGAGTCTGG - Intronic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
954759012 3:52860713-52860735 GGGGAGAAGAGGTCAGATTCCGG + Intronic
955052103 3:55423033-55423055 AGTGAGAAGTAGTTGGATTTGGG - Intergenic
955070470 3:55568584-55568606 GGAGGGAAGCAGTTGGATTTTGG - Intronic
955580329 3:60412795-60412817 GGAGGGAAGTAATTGGATTATGG + Intronic
955662733 3:61318677-61318699 TGGGAGAAATAGATGGATTCAGG - Intergenic
956390024 3:68761829-68761851 AGGAAGAAGAGGTTGGATTCTGG + Intronic
956736094 3:72239473-72239495 GGGGAGCAGTAGATGGATGCTGG - Intergenic
956910997 3:73816846-73816868 GGTGAGAAGCAGTCAGATTCTGG + Intergenic
958095422 3:88938159-88938181 GGTAAGAATTAGTTGTATTCTGG + Intergenic
958269876 3:91486447-91486469 GGGGAGAAGTACTTCAATTTGGG + Intergenic
958467349 3:94473849-94473871 GAGGAGAAGCAGTTGGACTTTGG - Intergenic
958837095 3:99158477-99158499 GGTGAAAAGTAATTGGATTATGG - Intergenic
960676280 3:120198485-120198507 GGTGAGAAGGAGTTAGATTCTGG - Intronic
961739738 3:129025704-129025726 TGGGAGAAGCAGTTGAATACTGG + Intronic
962159628 3:132985381-132985403 AGTGAGAAGTGGTTGGATTTGGG - Intergenic
962732041 3:138292478-138292500 ATTGAGAAGTGGTTGGATTCAGG + Intronic
962949167 3:140202316-140202338 GGTGAGAAGTAGTGGGATTGTGG + Intronic
963044240 3:141090910-141090932 GGTGAGAAGTAGTTGGATGCTGG + Intronic
963373404 3:144431906-144431928 AGTGAGAAGTGGTTGGAGTCTGG - Intergenic
964386848 3:156156513-156156535 GGTGAGAAGTAGTTGGATTCTGG + Intronic
964432096 3:156617907-156617929 GGTGAGAAGTAGCTGGATTCTGG + Intergenic
964437166 3:156666057-156666079 GGAGAGAGGTGGTTAGATTCTGG - Intergenic
965697879 3:171428245-171428267 TGTGAGAAGTAGTTGGATTATGG + Intronic
965797781 3:172459260-172459282 GGTGAGAAATAGTTGAGTTCTGG + Intergenic
965887291 3:173462555-173462577 GGGGAGAAGGTGGTGGAGTCAGG - Intronic
966494828 3:180568153-180568175 GGTGAGAAATGGTTGGATTCTGG - Intergenic
967281745 3:187829883-187829905 GGGGAAAAGCGATTGGATTCTGG - Intergenic
967354714 3:188555495-188555517 GATAAGAAGTAGTGGGATTCTGG + Intronic
967661551 3:192116713-192116735 GATGGAAAGTAGTTGGATTCTGG - Intergenic
967856206 3:194119362-194119384 GGAAAGAGGTAGTTGGATTTTGG - Intergenic
967988829 3:195116060-195116082 AGGGAGAAGCAGCTGGATTGGGG + Intronic
968014522 3:195317441-195317463 TATGAGTAGTAGTTGGATTCTGG - Intronic
968220057 3:196930627-196930649 GGGGAGAGGGGGTTGGTTTCAGG - Intronic
968359935 3:198139710-198139732 GGGGAGAAGGAGGAGGAATCGGG + Intergenic
968424993 4:517300-517322 GTGAAGAAGTGGTTGCATTCTGG + Intronic
970332010 4:14996149-14996171 GGGGTGAAGTGCTTGGATTCTGG + Intergenic
970409822 4:15793761-15793783 GTTGAGAAGTGGGTGGATTCTGG + Intronic
970455873 4:16224130-16224152 GTGGAGGACTAGTTTGATTCAGG + Intronic
970546042 4:17131508-17131530 GGTGAGAAGCAGTCAGATTCTGG - Intergenic
970848136 4:20567594-20567616 AAGGAGAAGAAGATGGATTCTGG + Exonic
971076081 4:23151511-23151533 GGGGAGAAGCAGCTGGACACTGG + Intergenic
971184442 4:24360096-24360118 GGTGAGAAGTTGTGAGATTCTGG - Intergenic
971282300 4:25250829-25250851 GGCAAGAGGTGGTTGGATTCTGG + Intronic
971489392 4:27195119-27195141 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
972510405 4:39763633-39763655 GGGGAGAGGTGTTTGGATCCTGG - Intronic
973816374 4:54623158-54623180 GGTGAGAAGTGGTTGGATTTTGG - Intergenic
974092799 4:57329692-57329714 GGGGAGATGTCGTAGGGTTCAGG - Intergenic
974356175 4:60815640-60815662 GGTAAGAAGTGGTTAGATTCTGG - Intergenic
974456836 4:62139253-62139275 GGGGGGAAGTTATTGGATTATGG - Intergenic
974652597 4:64774714-64774736 GGTGAGAAATGGTTGGATTCAGG + Intergenic
974777531 4:66505814-66505836 GGAGGGAAGTAATTGGATTATGG - Intergenic
975241878 4:72068729-72068751 GGGGATTAGCAGATGGATTCAGG + Intronic
975990785 4:80257927-80257949 GGTGGAAAGTACTTGGATTCTGG + Intergenic
976121066 4:81782358-81782380 GGGGAGAAGGAGTGGAATTTGGG - Intronic
976381096 4:84399945-84399967 AGGAAGAAGTATTTGGATTTGGG + Intergenic
976519455 4:86009115-86009137 GGTGAGAAGGATTTGAATTCTGG - Intergenic
976744464 4:88389479-88389501 GGTGAGAAATGGTTGGATTCTGG + Intronic
977424612 4:96851898-96851920 GGGGAGAATCACTTGAATTCGGG + Intergenic
977529457 4:98183064-98183086 GAGGAGAAGTGGTCAGATTCTGG - Intergenic
978304888 4:107316452-107316474 GGGGAGAAGAAATTGGTTTTAGG - Intergenic
978532162 4:109726451-109726473 AATGAGAAGTAGTTGGATTTTGG - Intronic
978880410 4:113695634-113695656 GGTGAGAAGTAGTTGTATTCTGG - Intronic
979320361 4:119316084-119316106 GATGGGAAGTGGTTGGATTCTGG + Intergenic
979567890 4:122177296-122177318 GGGGAGAAGTAGTTGGATTCTGG - Intronic
980401455 4:132291580-132291602 GAAGAGAAGTGGTCGGATTCTGG - Intergenic
980690539 4:136290778-136290800 GGTGAGAAGTGGTTGGATTCTGG + Intergenic
980770993 4:137372876-137372898 GGGGTGAAGAAATGGGATTCAGG + Intergenic
981652245 4:147073258-147073280 AGTGAGAAGTAGTCAGATTCAGG + Intergenic
981954933 4:150459345-150459367 AGGGAAGAGTAGTTGGATTTTGG + Intronic
982353743 4:154444498-154444520 GGGGAGAAGAAATCAGATTCAGG - Intronic
982731909 4:158964920-158964942 GGTGGGAGGTAGTTGGATTGTGG - Intronic
983047840 4:163007946-163007968 GGGGAGAAGTGAGTGGATACTGG + Intergenic
983103338 4:163653560-163653582 GGTGAAAAGTGGTTGGATTTAGG + Intronic
983271751 4:165570210-165570232 AGTGAGAAGTGGTTGGATTCTGG + Intergenic
983299640 4:165908830-165908852 GGAGGGAAGTATATGGATTCTGG + Intronic
983826482 4:172268470-172268492 GTGGACCAGTAGTTGGATGCAGG + Intronic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
984504388 4:180598674-180598696 GATGAGAAGTGTTTGGATTCTGG - Intergenic
984592922 4:181636631-181636653 GGGGAGAAGTGGGTGGAGTGTGG - Intergenic
985208814 4:187570411-187570433 GGGGAAAAATAGTTATATTCAGG - Intergenic
985386253 4:189451156-189451178 GGGGGGAAGTGATTGGATTATGG + Intergenic
986652950 5:9982591-9982613 GGGGAGAAGAAGCTGGGTTGGGG - Intergenic
986728409 5:10617483-10617505 GGGGAGGCGAATTTGGATTCTGG - Intronic
986923928 5:12722356-12722378 GGAGACAAGTAGTAGGATTTTGG + Intergenic
987191675 5:15484972-15484994 GGGGAGAAGTAGTTGGGGTCTGG + Intergenic
987236806 5:15950770-15950792 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
987308194 5:16658162-16658184 GGTGAGAGGTATTTGGATCCTGG - Intergenic
987442226 5:17969674-17969696 GGTGGGAAGTGGTTGGATTATGG - Intergenic
987664113 5:20914088-20914110 GGTGAGAAGTGGTTGGATCATGG - Intergenic
988640296 5:33034300-33034322 AGGGAGAAGGAGTGGGATTCTGG - Intergenic
988758578 5:34288108-34288130 GGTGAGAAGTGGTTGGATCATGG + Intergenic
989295482 5:39820351-39820373 GGAGAGAAGTAATGGGATTATGG - Intergenic
990383855 5:55240312-55240334 GGTGAGAAGTGATTAGATTCTGG + Intergenic
990929903 5:61076846-61076868 GGAAAGAAGAAGTTGCATTCCGG + Intronic
991036819 5:62135711-62135733 GGGGAGAAGGAGATGGTTTTGGG + Intergenic
991188900 5:63845409-63845431 GAGAAGAAGTAGTGGGATTCTGG - Intergenic
991399743 5:66240226-66240248 GGAAAGATGTGGTTGGATTCTGG + Intergenic
991472544 5:66984682-66984704 GGAGAGAAGTAGATGGATTCAGG + Intronic
991960422 5:72038843-72038865 GGTGAGAAGTGGCAGGATTCTGG - Intergenic
992358270 5:76008590-76008612 GATGAGCAATAGTTGGATTCTGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993714273 5:91259500-91259522 GGAGAGAAGAATTTGGATTCTGG - Intergenic
993721217 5:91323638-91323660 GGTGAGAGGTAGTTGGAGTTGGG - Intergenic
993722905 5:91338949-91338971 GGTGAGAAATGGTTGGAGTCTGG + Intergenic
993843923 5:92915893-92915915 GGGGAGAAATAAATGCATTCTGG - Intergenic
995009144 5:107238618-107238640 GATGAGAAGCAGTTGGATTAGGG + Intergenic
995070770 5:107919298-107919320 GGGGAGAAGCTGTTGGATCCTGG - Intronic
995447051 5:112256034-112256056 GCGGAGAAGCTGTTGGATTATGG - Intronic
995519137 5:112984296-112984318 GGGCATAAGGAGTTGGATCCTGG + Intronic
995624247 5:114059103-114059125 GAGGAGAAGTGGATAGATTCAGG + Intergenic
996411275 5:123161973-123161995 GGTGAGAAGTAGTTGGATTCTGG + Intronic
996519757 5:124413703-124413725 GGTCAGCAGTAGATGGATTCTGG - Intergenic
996862220 5:128080582-128080604 GGGGAAAAGTAGTTGAATTCTGG - Intergenic
997197806 5:131991328-131991350 GGGGAGTATTGGCTGGATTCAGG + Intronic
997616856 5:135252408-135252430 GGGGAGAAGTGATTGGATTATGG + Intronic
998188647 5:140002865-140002887 GATGAGAACTAGTTGGATTCTGG + Intronic
998223795 5:140310136-140310158 AGGGAGAAGTAGATGGATTCAGG + Intergenic
998230552 5:140358955-140358977 GGGGAGATGTGGTTGGATTATGG + Intergenic
998545866 5:143026907-143026929 GGTGAAGAGTAGTTAGATTCTGG + Intronic
999045128 5:148459059-148459081 ATTGAGATGTAGTTGGATTCAGG + Intronic
999055185 5:148567267-148567289 GATGAGAAGTGGTTAGATTCAGG - Intronic
999711109 5:154319469-154319491 GGGGTAAATGAGTTGGATTCAGG - Intronic
1000100290 5:158009740-158009762 GGTGAGAAGTAGTCAGATTCTGG - Intergenic
1000641307 5:163705663-163705685 TGGGAAAAGTAGTAGGATGCTGG - Intergenic
1000844824 5:166266283-166266305 GGTGAGATGTGGTTGGATTATGG + Intergenic
1001539561 5:172527848-172527870 GAGGGGAAGTGGTTGGATCCAGG + Intergenic
1001542146 5:172547130-172547152 GGTGGCAAGTAGCTGGATTCTGG + Intergenic
1001599047 5:172917053-172917075 GGGGAGATGTGGTCGGATTAGGG + Intronic
1002525616 5:179814302-179814324 TAGGAGAAGTAGATAGATTCAGG + Intronic
1003623116 6:7719748-7719770 ACAGAAAAGTAGTTGGATTCTGG - Intergenic
1005390369 6:25326722-25326744 GGTAAGCAGTAGATGGATTCTGG + Intronic
1005525434 6:26642947-26642969 GGTGAGAAGTGGTTAGACTCTGG - Intronic
1006308041 6:33236720-33236742 GGTGAGAGGTGGTTGGATTATGG + Intergenic
1006432694 6:34007650-34007672 GGAGGGAAGCTGTTGGATTCTGG + Intergenic
1006505300 6:34485425-34485447 GGTGAGAGGTGGCTGGATTCTGG + Intronic
1006607126 6:35266054-35266076 GGTGAGAAGTGGTTGGCTTCTGG + Intronic
1006750250 6:36372558-36372580 AGTGAGAAGAGGTTGGATTCTGG + Intronic
1007251172 6:40496176-40496198 GGTAAGAAGGGGTTGGATTCGGG - Intronic
1007381275 6:41491751-41491773 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1007826825 6:44607119-44607141 GTGGAGAAGTTGAAGGATTCCGG - Intergenic
1008861497 6:56154548-56154570 ATGGAGAAGTAGTCAGATTCTGG - Intronic
1010354815 6:74920314-74920336 GGTGAGAAATTGTTTGATTCAGG - Intergenic
1010390111 6:75327261-75327283 AGTGAGAAGTAACTGGATTCAGG - Intronic
1011587592 6:88943424-88943446 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1012176740 6:96096281-96096303 GGTGAGAAGTAGCAAGATTCTGG - Intronic
1012188153 6:96247546-96247568 GGTGAGAAGCTGTTGGATTTAGG + Intergenic
1012547990 6:100441235-100441257 AGGGAGAAGTAGTTGGATAGTGG + Intronic
1012552551 6:100477330-100477352 GGTGAGAAGTGGCTAGATTCTGG + Intergenic
1013091470 6:106904548-106904570 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1013423230 6:109985787-109985809 GGTGAGAAGTGGCTGGATTCTGG - Intergenic
1013458642 6:110355792-110355814 GGTGAGAAGTGGTTGGTTTCTGG - Intronic
1014300523 6:119675944-119675966 AGAGGGAAGTAGTTGGATTCTGG + Intergenic
1014305873 6:119741646-119741668 GGAGAGAAGTAGATGGAGCCTGG - Intergenic
1014411095 6:121122194-121122216 GGTGAGAAGTTTTTGGATTCTGG - Intronic
1014635212 6:123837490-123837512 AGTGAGAAGTAGTTGGATTCTGG - Intronic
1014758681 6:125330152-125330174 GGTGGGAAGGGGTTGGATTCTGG + Intergenic
1015090070 6:129345201-129345223 GGGGAGGAATAGTTGGTTCCTGG + Intronic
1015111394 6:129595954-129595976 GTGGAGAAATGGTTGGATTCTGG - Intronic
1015299153 6:131633126-131633148 GGAGGGAAGTGATTGGATTCTGG + Intronic
1015300210 6:131644437-131644459 GGTAAGAAGTATTTGGATTCTGG + Intronic
1015383085 6:132592082-132592104 AGGCAAAAGTAATTGGATTCTGG + Intergenic
1015812475 6:137174824-137174846 GGTGAAAACCAGTTGGATTCTGG - Intergenic
1015868927 6:137755963-137755985 GGTGAGATGTGGTTGGATTGGGG + Intergenic
1016214953 6:141588222-141588244 GGGGAGAGGGGGTTGGATTCGGG + Intergenic
1016261953 6:142182518-142182540 GTTGAGTAGTGGTTGGATTCTGG + Intronic
1016862469 6:148734644-148734666 GGTGAGAAGTAGTCTGATTTGGG - Intergenic
1017114731 6:150966416-150966438 GGGGAGAGGTGACTGGATTCTGG - Intronic
1017298515 6:152828658-152828680 GGGGAGATAGAGTTGGATTATGG - Intergenic
1017809458 6:157974527-157974549 GGTGAGAAACGGTTGGATTCTGG - Intergenic
1019260054 7:76932-76954 GGGGAGAAGGAGGAGGAATCGGG - Intergenic
1019279059 7:191269-191291 GGGGAGAAGTTGTTCCAGTCCGG - Intergenic
1019298835 7:292926-292948 AGGGAGAAGGAGTCGGAGTCCGG + Intergenic
1020681716 7:11245266-11245288 GGTAAGAAGTGGTTGAATTCTGG + Intergenic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1022232577 7:28428472-28428494 GGTGAGAAAGAGTTGGATTTTGG + Intronic
1022578832 7:31527141-31527163 GGGGAGAAGGAGGATGATTCAGG - Intronic
1022759104 7:33327749-33327771 GGTGAGAAGTGGTTGGATTCTGG + Intronic
1024094055 7:45970297-45970319 GGGGAGAATTGGTTGGGTTGAGG + Intergenic
1024949461 7:54844420-54844442 AGTGAGAAGTGGTTGGATTCTGG - Intergenic
1025034359 7:55584054-55584076 GGAGAGAAGTAGTTAGATTCTGG + Intergenic
1025121277 7:56306090-56306112 GGGGAGATATTGTTGGATTCTGG - Intergenic
1026250978 7:68670440-68670462 GGTGACAAGTGGTTGAATTCTGG + Intergenic
1026501171 7:70944586-70944608 GAGGAGAAGTGGTCAGATTCAGG - Intergenic
1026669443 7:72375471-72375493 GGGGAGAATTACTTGAGTTCTGG + Intronic
1027422728 7:78033143-78033165 AGTGAGAAGGGGTTGGATTCAGG + Intronic
1027820221 7:83032941-83032963 GGGGAGAAGTGATTGGATCATGG + Intronic
1028441629 7:90869690-90869712 GAAGAGAAATGGTTGGATTCTGG + Intronic
1028916080 7:96260730-96260752 GGTAAGAAGTGGTTGGATTTGGG - Intronic
1029106486 7:98180962-98180984 GGGGAGGAGGAGGAGGATTCAGG + Intronic
1029174599 7:98655735-98655757 GGTGAGAAGGGGTTGGATTCTGG + Intergenic
1029522649 7:101073758-101073780 GGGGAGGAGAGGTTGGATGCTGG + Intergenic
1029908520 7:104118899-104118921 GGTGAGAAGTTGTCAGATTCTGG - Intergenic
1030546894 7:110907437-110907459 GAGGAGAAGCAGTTGGATGTTGG - Intronic
1030977817 7:116148514-116148536 GGTGAGAGGTGGCTGGATTCTGG + Intronic
1031155846 7:118111224-118111246 GGGGAGAAGTGGTAGGATTATGG - Intergenic
1031336407 7:120538673-120538695 GGGAAGAAGAAGGTGGCTTCTGG - Intronic
1031624800 7:123980058-123980080 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1032632782 7:133671699-133671721 GGGGAGAAGTGGTCACATTCTGG + Intronic
1033001910 7:137514738-137514760 GGAGAGAATCAGTTGGATTCTGG - Intronic
1033393371 7:140949978-140950000 GGGGAGAAGTAGAAAGATTCAGG - Intergenic
1033427435 7:141256781-141256803 GGTGAAAAATAGTTGGATTTGGG + Intronic
1033713111 7:143969839-143969861 GGGGAGAAGGAGTGGGAGTATGG - Intergenic
1034357944 7:150468123-150468145 GGAGAGAAGCAGGTGGATTCTGG - Intronic
1035383424 7:158455061-158455083 GGTGGGAAGTAGTGGGATTGGGG - Intronic
1035937116 8:3853013-3853035 CGGGAGATGTAGTTGGATGTTGG - Intronic
1036382656 8:8247665-8247687 GGGGAGGAGAAGATGGTTTCAGG - Intergenic
1036539858 8:9695743-9695765 GGTGAGAAGTGATTGGATTCTGG + Intronic
1037218739 8:16490161-16490183 AGTGAGAAGCAGTTGGATTCTGG - Intronic
1037363212 8:18095778-18095800 GGTGAGAAGTGGTCAGATTCGGG - Intergenic
1037762781 8:21752890-21752912 GGTGAGAAGTGTCTGGATTCTGG - Intronic
1038791476 8:30672019-30672041 GGAGGGAAGTGATTGGATTCTGG - Intergenic
1038961762 8:32527907-32527929 GGGGAGAAGCGGTTGGATAATGG - Intronic
1038982878 8:32778459-32778481 GGTGAGAAGTGATTGGATTGTGG + Intergenic
1039492826 8:37960571-37960593 GGGGAGAAGGAGATGGTTTTGGG + Intergenic
1039661347 8:39470695-39470717 GAGGAGAAGCAGCTGGATACTGG + Intergenic
1040972578 8:53152954-53152976 TGGGGGAAGTAATTGGATTATGG + Intergenic
1041090505 8:54297113-54297135 GGGGGGATGTAATTGGATTCAGG + Intergenic
1041148224 8:54902612-54902634 GGTGAGAAGTGATTGGATTCTGG + Intergenic
1041901214 8:62985190-62985212 GGTGAGATGTAATTGGAGTCAGG - Intronic
1041985510 8:63917834-63917856 GGTAAGAAGTATTTGGATCCTGG - Intergenic
1042063460 8:64846848-64846870 AGTGAGAAGTAGTTAAATTCTGG + Intergenic
1042655423 8:71090507-71090529 TAGGAGAAGTGGTTAGATTCTGG - Intergenic
1044211842 8:89559989-89560011 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1044410399 8:91875980-91876002 GGTGAAAAGTGATTGGATTCTGG - Intergenic
1044793306 8:95870439-95870461 GGTGAGAAACAGTTGGATTATGG + Intergenic
1045159846 8:99526489-99526511 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1045428014 8:102086497-102086519 GGAGAGAAGTGGCTGGATTTAGG - Intronic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1045954169 8:107887681-107887703 GGAAAGAAGTGGTTGGATTCAGG - Intergenic
1046041089 8:108905984-108906006 GGTAAGAAGTGGTTGGTTTCTGG - Intergenic
1046112157 8:109738229-109738251 AGTGAGAGGTGGTTGGATTCTGG + Intergenic
1047145243 8:122191359-122191381 GGGGATTAGTTTTTGGATTCAGG + Intergenic
1047602219 8:126437276-126437298 GGTGAGAAGTGGCTGGATTCTGG - Intergenic
1047689626 8:127338506-127338528 GGTGAAAAGTGGTTGGATTTGGG + Intergenic
1048221145 8:132543358-132543380 TGGGAGAAGTGATTGGATTTTGG - Intergenic
1048379032 8:133847598-133847620 TGGGAGATGTAGTTGGAGTGGGG - Intergenic
1048752755 8:137698275-137698297 GAGGAGAGGGAGGTGGATTCAGG + Intergenic
1049238569 8:141525148-141525170 GTAGAGAAGTGGGTGGATTCGGG + Intergenic
1050253719 9:3772445-3772467 GGAAAGAAGTGGTTGAATTCTGG - Intergenic
1050297258 9:4218219-4218241 GGGGAGAAGTAAATGGATTTGGG - Intronic
1051223812 9:14877946-14877968 AGTAAGAAGTAGCTGGATTCTGG - Intronic
1051598246 9:18846763-18846785 GGACAGAAGTAGATGAATTCAGG + Intronic
1051635421 9:19177005-19177027 GGTGAGAAGGGTTTGGATTCCGG + Intergenic
1052043807 9:23771181-23771203 GGGGAGAAGTCATCAGATTCTGG + Intronic
1052169701 9:25377797-25377819 GAGGAGAAGCAGTTGGATGATGG - Intergenic
1052757875 9:32559282-32559304 GATGAGAACCAGTTGGATTCAGG - Intronic
1052850573 9:33375993-33376015 GGTGAGGAGTGGCTGGATTCTGG + Intergenic
1052891103 9:33701126-33701148 GGGGAGGGGGAGTTAGATTCAGG + Intergenic
1055080483 9:72263927-72263949 GGAAGGAAGTGGTTGGATTCTGG + Intergenic
1055284086 9:74709542-74709564 TGGGAGAAGTGGGTGGATACTGG - Intergenic
1055322400 9:75095523-75095545 GGGGAAAAGTCATTTGATTCAGG + Intronic
1055621038 9:78125542-78125564 GGTGAGAAGTGATTGGATTCAGG - Intergenic
1057987199 9:99729491-99729513 GTTGAGAAGTGGTTGGATTCTGG - Intergenic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1058077358 9:100664524-100664546 GGGGAGTAGCAGTGGGATCCAGG + Intergenic
1058287323 9:103194982-103195004 ATGGAGAAGTAGTTGGTTCCAGG + Intergenic
1058672745 9:107374281-107374303 GGGAAGGAGTGGTTGGATTCTGG + Intergenic
1059168136 9:112098294-112098316 GGGGATAAGTGGTAAGATTCAGG + Intronic
1060647001 9:125289432-125289454 GTTGAGAAGTAGATAGATTCTGG + Intronic
1061069880 9:128302796-128302818 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1061138668 9:128751346-128751368 AGAGAGAAGGAGCTGGATTCTGG - Intronic
1062064480 9:134518716-134518738 GGAGGGAAGTGGTTGGATGCTGG + Intergenic
1062744633 9:138203510-138203532 GGGGAGAAGGAGGAGGAGTCGGG + Intergenic
1062744639 9:138203530-138203552 GGGGAGAAGGAGGAGGAATCGGG + Intergenic
1187146234 X:16639983-16640005 GGAGAGAAGTGGATGGATGCGGG - Intronic
1187328280 X:18312239-18312261 GGCAAGAAGTGGTTGGATTTTGG + Intronic
1187498156 X:19814212-19814234 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1187687085 X:21826485-21826507 GGTGAGAAGTAGTTGGATTTGGG - Intergenic
1187953163 X:24490961-24490983 GGGAAGAAGTAGAAGAATTCTGG - Intronic
1188182677 X:27075185-27075207 GGGGAGAAGTGGCTGGATGTTGG + Intergenic
1189400927 X:40667813-40667835 AGTGAAAAGTGGTTGGATTCTGG + Intronic
1189537955 X:41955969-41955991 GAGAAGAAGTAGCTGGATTCTGG - Intergenic
1189558541 X:42169469-42169491 AGTGAGAAGCAGTTGGATCCTGG + Intergenic
1189727847 X:43986446-43986468 GGTGAAATGTGGTTGGATTCTGG + Intergenic
1190118972 X:47644982-47645004 GGCGAGAAGTAGCTGGGGTCTGG + Intronic
1190876422 X:54463413-54463435 GGTGAGAAATGGTTGGATTCAGG - Intronic
1191633400 X:63350260-63350282 GGGAAATAGTAGTTGGAATCTGG + Exonic
1191968274 X:66785324-66785346 GGTGAGAAGTAGTCATATTCTGG - Intergenic
1192161927 X:68794858-68794880 GGGTAGAAGAAGTGGGAATCGGG - Intergenic
1192235288 X:69291688-69291710 GGGGAGAAGGAGGAGGAATCAGG + Intergenic
1192271420 X:69583306-69583328 GGGTAGAAGTTTCTGGATTCTGG - Intergenic
1192360779 X:70437727-70437749 GATGATAAGTGGTTGGATTCTGG - Intergenic
1192576372 X:72246290-72246312 GGAGAGAAGTGATTGGATTTGGG - Intronic
1193050931 X:77098713-77098735 AGAGGGAAGTAGTTGGATTTGGG - Intergenic
1195084387 X:101400526-101400548 GGTGAGAAGTGGTTGGAACCTGG + Intronic
1195345741 X:103949459-103949481 GGTGAGAAGTGGTTGGATTTTGG + Intronic
1195361855 X:104089979-104090001 AGTGAGAAGTGGTTGGATTTTGG - Intergenic
1195683165 X:107563816-107563838 GGGGAGAAGTAGAAGGACTCAGG - Intronic
1195910062 X:109880440-109880462 GGGGAGAAGCAGGTGGATTCAGG - Intergenic
1195911402 X:109891592-109891614 GGAGAGATGTGGATGGATTCAGG - Intergenic
1195960624 X:110382753-110382775 GGGGAGAAGGGCTTTGATTCAGG - Intronic
1196720447 X:118848758-118848780 GGGGAGAAGTTGTTGGATTTTGG + Intergenic
1196776728 X:119344947-119344969 GGTGAGAAGGGGTTGGATTATGG - Intergenic
1196928260 X:120655485-120655507 GGTGAGAACTAATAGGATTCAGG - Intergenic
1197001722 X:121447814-121447836 TTGAAGAAGTAATTGGATTCTGG - Intergenic
1197859238 X:130951483-130951505 AGAGAGAAGCAGTTGGATTCTGG - Intergenic
1198108234 X:133480903-133480925 GATGAGAAGTAGTCAGATTCTGG + Intergenic
1198217971 X:134574188-134574210 GGGGAGAAATAGTAGGGATCAGG - Intronic
1198651875 X:138872099-138872121 GGGAAGAAGTAGTTAGATTCTGG + Intronic
1198848647 X:140941292-140941314 GGGGGCAAATTGTTGGATTCTGG - Intergenic
1199138219 X:144278525-144278547 GGAGAGAAGTGGTAGGATTCTGG + Intergenic
1199496186 X:148455084-148455106 AAAGAGAAGTAGATGGATTCAGG + Intergenic
1199970098 X:152853438-152853460 GGTGAGAAGTTGTTGGATTGGGG - Intronic
1201786010 Y:17779870-17779892 AGGGAAAAGTGGTTAGATTCTGG - Intergenic
1201815543 Y:18126118-18126140 AGGGAAAAGTGGTTAGATTCTGG + Intergenic