ID: 979568113

View in Genome Browser
Species Human (GRCh38)
Location 4:122179903-122179925
Sequence GTACCATTCCAGATCAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979568108_979568113 -4 Left 979568108 4:122179884-122179906 CCCCCACATACAGACAGGGGTAC 0: 1
1: 0
2: 1
3: 20
4: 151
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568111_979568113 -7 Left 979568111 4:122179887-122179909 CCACATACAGACAGGGGTACCAT 0: 1
1: 0
2: 0
3: 13
4: 98
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568102_979568113 2 Left 979568102 4:122179878-122179900 CCCTGCCCCCCACATACAGACAG 0: 1
1: 0
2: 6
3: 77
4: 896
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568109_979568113 -5 Left 979568109 4:122179885-122179907 CCCCACATACAGACAGGGGTACC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568107_979568113 -3 Left 979568107 4:122179883-122179905 CCCCCCACATACAGACAGGGGTA 0: 1
1: 0
2: 0
3: 13
4: 139
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568110_979568113 -6 Left 979568110 4:122179886-122179908 CCCACATACAGACAGGGGTACCA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568103_979568113 1 Left 979568103 4:122179879-122179901 CCTGCCCCCCACATACAGACAGG 0: 1
1: 0
2: 3
3: 82
4: 638
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data
979568101_979568113 5 Left 979568101 4:122179875-122179897 CCTCCCTGCCCCCCACATACAGA 0: 1
1: 1
2: 3
3: 88
4: 800
Right 979568113 4:122179903-122179925 GTACCATTCCAGATCAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979568113 Original CRISPR GTACCATTCCAGATCAATGG AGG Intronic
No off target data available for this crispr