ID: 979573867

View in Genome Browser
Species Human (GRCh38)
Location 4:122263235-122263257
Sequence CAGGGGAAATTCTATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979573867 Original CRISPR CAGGGGAAATTCTATGTTGC TGG (reversed) Intronic
906897479 1:49791999-49792021 CTGGGGTAATTTTATGTTGTAGG - Intronic
907708736 1:56856586-56856608 CATGTGAAATTTTATTTTGCAGG - Intronic
911249832 1:95562711-95562733 AAGTTTAAATTCTATGTTGCTGG + Intergenic
913429102 1:118769716-118769738 CTGGGTAAATTGCATGTTGCTGG - Intergenic
917216492 1:172683687-172683709 ATGGGTAAATTGTATGTTGCTGG + Intergenic
918821147 1:189255662-189255684 AAGGGTAAATTGTATGTTGCTGG + Intergenic
1064839921 10:19580085-19580107 CAGGGGACCTTCTGGGTTGCAGG + Intronic
1064953898 10:20885565-20885587 CATGTTAAGTTCTATGTTGCAGG + Intronic
1068088433 10:52403389-52403411 CAGGGTAAATTGCATGTTGCAGG + Intergenic
1068248723 10:54408259-54408281 GAGAGGAAATTATATGTTGTGGG - Intronic
1068385273 10:56317928-56317950 CAGTGAAAATTCTCTGCTGCTGG - Intergenic
1069828622 10:71269509-71269531 CTTGGGAAATTCCATGCTGCAGG - Intronic
1070884823 10:79882408-79882430 CAGAGGAAAAACTATGTTTCTGG + Intergenic
1071240270 10:83697383-83697405 CAAGGGAAAGTCTATGTCCCTGG - Intergenic
1071702008 10:87949064-87949086 CATTGGAAATCCTATATTGCAGG + Intronic
1078877649 11:15414161-15414183 GAGGGGAATTTCTAAGTTCCAGG + Intergenic
1084407201 11:68981009-68981031 AATGTGAAATTCTGTGTTGCTGG + Intergenic
1086286877 11:85261469-85261491 TAGGGTCAATTCTATGATGCAGG - Intronic
1086346032 11:85897715-85897737 CACATGAAATTCTATGTTGGAGG + Intronic
1087387186 11:97486480-97486502 AAGGGTACATTGTATGTTGCTGG - Intergenic
1087443189 11:98210899-98210921 CAGAGGAAATTCTAATTTGAAGG - Intergenic
1087919542 11:103850453-103850475 GAGGGGGAATTCTCTGTTGCTGG - Intergenic
1088531983 11:110820290-110820312 CTGGAGAAATTCTAGGTTGATGG + Intergenic
1088577146 11:111283352-111283374 CAAGGGAAACTTTATGTAGCCGG + Intronic
1092802590 12:12185304-12185326 CAGGGAAAATTCTCTTTTGAGGG + Intronic
1094566598 12:31604180-31604202 CAAGAGAAATTGTATGTAGCAGG - Intergenic
1096451373 12:51744900-51744922 CAGGGGAGATTGTATGAGGCTGG - Intronic
1097303557 12:58043949-58043971 CAGGGGAAACAGTATGTTGTAGG + Intergenic
1098379936 12:69857770-69857792 CTTGGGATATTCTATGTTGAAGG + Intronic
1100029058 12:90163726-90163748 CAAGGGAGATTCTCTGTTGATGG + Intergenic
1100382776 12:94077132-94077154 CAGGGGAACTTGTATATTTCTGG - Intergenic
1101271608 12:103151988-103152010 CAGGGGAGATTCTCCTTTGCTGG + Intronic
1101318415 12:103650824-103650846 CAGGGGGCCTTCTAGGTTGCTGG - Intronic
1101657474 12:106735898-106735920 AAGGAGAGATTCTATGTGGCTGG + Intronic
1105073740 12:133255952-133255974 AAGGAGACATTCTATGTGGCTGG + Intergenic
1105887918 13:24658288-24658310 TAGGGGAAAGTGTATGTTGGGGG + Intergenic
1109806128 13:67445643-67445665 CAAGGGAAGTTCTCTGTTGCTGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1118801509 14:69193927-69193949 CTGGTGAAATTCTTTGTTGTGGG - Intronic
1119657192 14:76425568-76425590 CAGGGAAAGCTCTATGTTGGAGG - Intronic
1120414276 14:84199642-84199664 CAGGTAAAATTCTATGCAGCTGG - Intergenic
1132806247 16:1776391-1776413 CAGGGGAAGTTTTAGGTAGCTGG + Intronic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1143059788 17:4190062-4190084 CAGGATAAATTCTTTGTTGTGGG + Intronic
1143891269 17:10104265-10104287 AAGGGGACATTGAATGTTGCTGG - Intronic
1146647506 17:34584918-34584940 CAGGAGAAACTCAAGGTTGCTGG - Intronic
1148441343 17:47713246-47713268 CAGGGGAATGTCCAGGTTGCAGG - Intergenic
1149494801 17:57110338-57110360 CTGGAGGAATTCCATGTTGCAGG - Intronic
1150323439 17:64236027-64236049 TAGGGAAAAATCTGTGTTGCAGG - Intronic
1151145798 17:72039808-72039830 CAGTGTAAATTCTATCTTGCTGG + Intergenic
1157062589 18:44309411-44309433 CTTGGGAAATTGTATGTTCCAGG + Intergenic
1157976949 18:52338839-52338861 CAGGGAAACTCCTATGATGCTGG - Intergenic
1159602050 18:70437366-70437388 CAGGGCAATTACTATGTTTCAGG - Intergenic
1161646107 19:5454472-5454494 CATGGGAAAGACTATGTTACAGG + Intergenic
1164431352 19:28191658-28191680 CTGGGTAAATTTCATGTTGCAGG + Intergenic
1168168030 19:54567144-54567166 CTGGGGCAATTCTATGTCTCAGG + Intergenic
926531294 2:14049566-14049588 AAGGGTAAATTTCATGTTGCAGG + Intergenic
927604611 2:24475361-24475383 CAGGGGATGTTCTGGGTTGCTGG + Intergenic
932476117 2:72007001-72007023 CAGCTGACATTCTATGTTCCAGG + Intergenic
932823046 2:74917475-74917497 CAGGGGAAGGTGCATGTTGCAGG - Intergenic
933195871 2:79388892-79388914 CAGGTGAATTTTTATGTTGCAGG - Intronic
935496072 2:103783095-103783117 TAGGGGACATTCTATGTTAGAGG + Intergenic
936906053 2:117536750-117536772 CTGGGAAAATTGTACGTTGCTGG - Intergenic
937964628 2:127493937-127493959 CAGGGGAAACTATCTGTGGCAGG - Intronic
938556119 2:132425759-132425781 AGGGAGAAATTCTCTGTTGCTGG + Intronic
939756901 2:146125327-146125349 ATGGGGAAATTCCATGTTGTTGG - Intergenic
940558467 2:155263470-155263492 GAGGGGAAATGCTATGTCGGGGG + Intergenic
940764762 2:157778309-157778331 AAGTGGAAATTCTGTGTTCCAGG + Exonic
942015546 2:171810335-171810357 TGGGGGAAACTCTTTGTTGCTGG - Intronic
944943869 2:204660437-204660459 CAGGGAATATGCTAAGTTGCGGG + Intronic
945816470 2:214610846-214610868 CTGGGGGAATTCTAAGGTGCAGG + Intergenic
1172977449 20:38917754-38917776 CTGGGGAGATACTATGTTGAAGG - Intronic
1177770752 21:25512873-25512895 CCAGGGAGATTCTATGTTGTTGG + Intergenic
1180193275 21:46179348-46179370 GATGGGATCTTCTATGTTGCTGG - Intronic
1181627287 22:24130558-24130580 CAGGGCAGGTTCTATGCTGCAGG + Intronic
1182486381 22:30641463-30641485 TTGGGGCAATTCTATGTTCCTGG + Intronic
1182487419 22:30647757-30647779 CAGGGGGGCTTCTATGCTGCTGG + Exonic
1183550139 22:38477535-38477557 ATGGGGGAATTCTATCTTGCAGG + Intronic
949247634 3:1943744-1943766 CAGGAGAAATTCTCTGTGCCTGG + Intergenic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
954827084 3:53383544-53383566 CTAGGGATATTCTATTTTGCTGG + Intergenic
958916157 3:100052920-100052942 TAGGGGAAATTATATATTACAGG - Intronic
960794375 3:121470006-121470028 CATTGAAAATTCTAGGTTGCTGG + Intronic
963288317 3:143460078-143460100 CAAGAGAAATTCTTTGTTTCTGG - Intronic
965449711 3:168822577-168822599 CAGGGGAGTTTCTCTGTTCCAGG + Intergenic
966220579 3:177547350-177547372 CACAGGAAATTCTATTTTGGAGG - Intergenic
966833131 3:184028176-184028198 GAGGGTAAAATCTATCTTGCAGG - Intergenic
973143916 4:46801660-46801682 ATGGGTAAATTGTATGTTGCTGG - Intronic
974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG + Intronic
976650634 4:87430134-87430156 CAGAGAGATTTCTATGTTGCTGG + Intronic
976825234 4:89253474-89253496 CAGGAGATATTCTGTGTTCCTGG - Intronic
978062974 4:104361044-104361066 CAGGTAAAATTCTATGTTTATGG - Intergenic
979573867 4:122263235-122263257 CAGGGGAAATTCTATGTTGCTGG - Intronic
982157823 4:152538719-152538741 GAGGGGAACTTCTGAGTTGCTGG - Intergenic
983509799 4:168595867-168595889 AAGGGTAAATTGCATGTTGCTGG - Intronic
984552143 4:181173480-181173502 CATGGGAGATTCTGTGTTTCTGG + Intergenic
985855761 5:2425324-2425346 CAGGGGATATTCTACTGTGCTGG - Intergenic
986147155 5:5089108-5089130 CAGGGAAAAACTTATGTTGCTGG - Intergenic
993593909 5:89828902-89828924 CAGGTGAAATTTTATGCTGTGGG - Intergenic
997224492 5:132198725-132198747 CAGGGGAAACTCTTCGTTACTGG - Intronic
997257033 5:132437045-132437067 CAGGGGGAATGCAAAGTTGCTGG - Intronic
998583744 5:143404735-143404757 CAGGCGAAATAGTAAGTTGCTGG + Intronic
999399108 5:151250831-151250853 CAGAGGAAATTGTAAGTTTCTGG - Intronic
1005619801 6:27609317-27609339 CAGGGAAAATTAGTTGTTGCTGG + Intergenic
1009500680 6:64408844-64408866 ATGGGCAAATTGTATGTTGCTGG + Intronic
1010707053 6:79127393-79127415 CAGGACAAATAATATGTTGCTGG + Intergenic
1011202474 6:84852335-84852357 CTAGGGAGATTCTCTGTTGCTGG + Intergenic
1011215281 6:84999069-84999091 CAGGGGAAATATTAAGTTGGAGG - Intergenic
1011937961 6:92804890-92804912 CATGGGAACTTCAACGTTGCAGG + Intergenic
1011974564 6:93280012-93280034 CATGAGAAATTATATGTTGAAGG - Intronic
1012358139 6:98341801-98341823 CAGGGGAAACTCTCTGTTCAGGG - Intergenic
1014361380 6:120480012-120480034 CTGGGAATATTCTATGTGGCTGG - Intergenic
1016089761 6:139962649-139962671 CAGAGTATATTCTAGGTTGCGGG + Intergenic
1017761739 6:157574571-157574593 CAGGGGAGTTTCTGTGGTGCTGG - Intronic
1018446906 6:163866578-163866600 CAGGGGAAATTCCTTATTGGAGG - Intergenic
1019869114 7:3742346-3742368 CAAGGAAAATTTTATGTTTCAGG - Intronic
1022321601 7:29293275-29293297 CAGGGGAAAATCGAGGATGCAGG - Intronic
1022924824 7:35046401-35046423 CAGGGGAAGGTCTAGGTTACAGG - Intergenic
1029822832 7:103161109-103161131 CAGGGGAAGGTCTAGGTTACAGG - Intergenic
1029939688 7:104466815-104466837 CTGGGCAAATGCTATGCTGCTGG - Intronic
1030761325 7:113356084-113356106 CAAGGGAGATTCTCTGTGGCTGG + Intergenic
1032009076 7:128330080-128330102 GAAGGAAAACTCTATGTTGCAGG - Intronic
1032246153 7:130215003-130215025 CGGCGGAAATTCTATGTTAAGGG - Intronic
1032332542 7:130993744-130993766 CAGGGGTCTTTCTATGTTGCAGG - Intergenic
1032532594 7:132634556-132634578 TAGAGGAAGTTCTATGTTTCTGG - Intronic
1032789429 7:135231711-135231733 CAGGGCAGAATCTATGTTGCTGG + Intergenic
1034926748 7:155128950-155128972 CTGGGGAAATCCTTTGTTTCTGG + Intergenic
1035340107 7:158154770-158154792 AAGAGAAAATTCTAAGTTGCTGG + Intronic
1035494311 7:159309379-159309401 AAGGAGACATTCTATGTGGCTGG + Intergenic
1036970365 8:13348268-13348290 CATGAGAAGTTCCATGTTGCTGG + Intronic
1037158042 8:15729803-15729825 CATGGGAAATTGCATGTCGCCGG - Intronic
1038854377 8:31315055-31315077 CAGGGAAAATTTGATGATGCCGG + Intergenic
1039527025 8:38226082-38226104 GAAGGGAATTACTATGTTGCTGG - Intronic
1041017617 8:53607589-53607611 CTGGGTAAATTGTGTGTTGCTGG - Intergenic
1042916963 8:73884857-73884879 CATGGGGAATTCCAGGTTGCAGG + Intergenic
1046960794 8:120110716-120110738 CAGGTGAAATTCTAGGTATCAGG - Intronic
1047147911 8:122226397-122226419 GAGGGGAAATTCTTTTTTGAAGG - Intergenic
1047543529 8:125793677-125793699 TAGTGGAAATTTTATTTTGCTGG - Intergenic
1049318919 8:141985545-141985567 CAGGGGATACACTATGATGCAGG - Intergenic
1050156507 9:2672420-2672442 ACGGGGAAATTGTGTGTTGCAGG - Intergenic
1051666164 9:19468659-19468681 CATGGGAAATTTCATTTTGCTGG + Intergenic
1059525065 9:114983867-114983889 CCTGGATAATTCTATGTTGCAGG + Intergenic
1059920039 9:119150098-119150120 CAAAGGAAATTGTATGTTGATGG + Intergenic
1060651022 9:125327415-125327437 TAGAGCAAATTGTATGTTGCTGG + Intronic
1186130673 X:6462089-6462111 CAAGGGAAATTCTTGGTTCCTGG - Intergenic
1187301253 X:18052295-18052317 ATGGGTAAATTGTATGTTGCTGG + Intergenic
1188029666 X:25250415-25250437 ATGGGGAAATTGTGTGTTGCGGG + Intergenic
1189440998 X:41036198-41036220 CAGAATAAATTCTATGTAGCTGG + Intergenic
1190542336 X:51490184-51490206 CAGGTGAAATGATATGTTACTGG - Exonic
1191954025 X:66624915-66624937 CTGGGGAAAGTCTAATTTGCAGG + Intronic
1192743815 X:73919001-73919023 CTTGAGAAATTCTCTGTTGCTGG + Intergenic
1194656647 X:96581493-96581515 CAAGAGAAATTCTCTATTGCTGG - Intergenic
1200380745 X:155834752-155834774 CAGTGGAAACTCTGTGTTGGGGG - Intergenic