ID: 979576448

View in Genome Browser
Species Human (GRCh38)
Location 4:122297122-122297144
Sequence CAGAGTAAACAGACAGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 460}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979576448 Original CRISPR CAGAGTAAACAGACAGAATG GGG Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
903532633 1:24043476-24043498 GAGAGAAAACAGCCAGAAAGGGG - Intergenic
905318211 1:37097038-37097060 CAGGGAGAACAGATAGAATGTGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906387232 1:45380644-45380666 CAGAGCAAAGAGAAAGAATAAGG + Intronic
906457389 1:46008818-46008840 GAGAGTACACAGACAGAAGTAGG + Intronic
906676944 1:47700169-47700191 AGGAGTAAACAAATAGAATGAGG + Intergenic
906746769 1:48227732-48227754 CAGTGTAAAGGCACAGAATGAGG - Intronic
907544144 1:55244740-55244762 CAGGGGAAAGAGAAAGAATGTGG + Intergenic
907818563 1:57944291-57944313 CATAGAAAACAGAAAGGATGGGG - Intronic
907991428 1:59586743-59586765 AAGAGTAGATAGACAGAATGAGG + Intronic
908142227 1:61198059-61198081 TAGAGTAAACAGGCAAAGTGGGG + Intronic
909088050 1:71191273-71191295 CAGTGCAGTCAGACAGAATGAGG - Intergenic
910528166 1:88204880-88204902 CAAAGTAAACACACAGAACTTGG - Intergenic
910964255 1:92792401-92792423 CAGAGAAGACAGAGAGACTGGGG + Exonic
911164330 1:94711674-94711696 CAGAGTTAACAAACAGGAGGAGG + Intergenic
911907211 1:103585573-103585595 AACAGTACACAGACTGAATGTGG - Intergenic
913071427 1:115302528-115302550 CACAGCACACATACAGAATGAGG + Intronic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915239999 1:154514464-154514486 CAGGGGAAACACACGGAATGGGG + Intronic
916599777 1:166281520-166281542 CAGAAAAGACAGACAGAATCTGG - Intergenic
916984047 1:170171311-170171333 CAGAGTAAACAGACAACCTACGG - Intergenic
917114745 1:171591644-171591666 CAGAGCAAACAGATAGGAGGAGG + Exonic
917547051 1:175981698-175981720 CAGAGTGAAAAGACAACATGTGG + Intronic
917555199 1:176078694-176078716 CAGAGTAAACAGACAGCCTAGGG + Intronic
917815486 1:178705655-178705677 CAGAGTGAAAAGTGAGAATGAGG - Intergenic
918118168 1:181514813-181514835 CAGAGGTCACAGGCAGAATGTGG - Intronic
918452639 1:184674516-184674538 CAGAGTGAAGAGACAAACTGTGG + Intergenic
919276371 1:195422800-195422822 CAGAGAACACAGAGATAATGTGG + Intergenic
919590846 1:199500037-199500059 CAGAGTGAACAGACAGCTTAAGG + Intergenic
919604200 1:199660674-199660696 CAGTGTAAACTCAAAGAATGGGG - Intergenic
920456252 1:206103750-206103772 CTGATTAGACAGGCAGAATGAGG + Intergenic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921030404 1:211331045-211331067 CAGAGAGAACAGAGAGAAAGAGG - Intronic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
922040788 1:221894328-221894350 CAGAGTAAACAGACAACCTACGG + Intergenic
924321877 1:242858890-242858912 CAGAGGAAACAGTCAGGATGGGG + Intergenic
924717876 1:246594771-246594793 AAGAGTAAGAAAACAGAATGAGG + Intronic
1062775880 10:147356-147378 CAGAGCCAACATACTGAATGGGG - Intronic
1066708424 10:38205503-38205525 AAGAGACAACACACAGAATGGGG + Intergenic
1066981082 10:42417069-42417091 AAGAGACAACACACAGAATGGGG - Intergenic
1067214666 10:44292744-44292766 CAGAGTGAGAAGACAAAATGAGG + Exonic
1068534432 10:58225544-58225566 TAGAGTATACAGAAAGAATTTGG - Intronic
1071027621 10:81134803-81134825 CAGGGAAGACAGACAGAATAAGG + Intergenic
1072068655 10:91895030-91895052 CAGATTAAACAAAGAAAATGTGG - Intergenic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072304165 10:94091081-94091103 AGGAGAAAAAAGACAGAATGAGG - Intronic
1072483896 10:95835766-95835788 CAGAGTAAACACACAAAAAGTGG - Intronic
1073196603 10:101696155-101696177 CAGGATAAACAGACAGAAATTGG - Intergenic
1074041051 10:109789073-109789095 CAGAGTGAAGAGACAGCCTGTGG - Intergenic
1074638526 10:115349890-115349912 AAGAGAAAACCTACAGAATGGGG - Intronic
1075079697 10:119375109-119375131 TAAAGAAAACAGACAGAAAGTGG - Intronic
1076328966 10:129651090-129651112 CAGAGAAATCAGACAGCATGTGG - Intronic
1077396119 11:2323025-2323047 CAGAGTAAACACACAGCCTAAGG + Intergenic
1077915633 11:6609907-6609929 AAGAGAAAACAGATAGAAGGAGG - Intronic
1078435054 11:11317677-11317699 CAGAGTAAACAGACAACCTACGG - Intronic
1078755737 11:14207410-14207432 CAGAGTAAACAGACAACCTACGG + Intronic
1078816549 11:14828369-14828391 CAGAGTAAACAGACAACCTATGG + Intronic
1079622337 11:22568970-22568992 CAGAGTAAACCGACAACCTGCGG - Intergenic
1079840287 11:25388617-25388639 CAGATTAAACAAATAGACTGAGG - Intergenic
1080147896 11:29009885-29009907 CAGAGTAAACAGACACCCTACGG - Intergenic
1081681926 11:45012742-45012764 AAGAGGCAACATACAGAATGGGG - Intergenic
1082712160 11:56566224-56566246 CAGAGTAAAAAGACAGCCTATGG - Intergenic
1083569122 11:63746973-63746995 GAGAGTAAGGAGACAGGATGAGG - Intronic
1085163091 11:74367154-74367176 CAGAGATAACAGACTGAAGGAGG + Intronic
1086295162 11:85358296-85358318 GAGAGTAAACACAGAGAGTGAGG - Intronic
1087419644 11:97905551-97905573 CAGAGAAAAGAGAAATAATGAGG + Intergenic
1087716549 11:101614864-101614886 CATAGGAAGCAGACAGAAAGAGG - Intronic
1088241707 11:107779958-107779980 CAGTGTACCCAGACAGAACGAGG + Intergenic
1089332859 11:117701924-117701946 CAGGGTAAACAGACAGCGCGTGG + Intronic
1089709126 11:120302377-120302399 TAGAGGAAACAGGAAGAATGGGG - Intronic
1089819551 11:121212371-121212393 CAGAGATCACATACAGAATGAGG + Intergenic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1092043967 12:5412379-5412401 CAGAGCAAACACATAGTATGTGG - Intergenic
1092774292 12:11929088-11929110 AAGAGTAAATAAACAAAATGTGG - Intergenic
1093429691 12:19070728-19070750 AAAAGTAAAAAGAAAGAATGTGG - Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1093892882 12:24544968-24544990 AACAGTAAACACACAGAAAGGGG - Intergenic
1095776496 12:46016155-46016177 ATGAGTAGACAGAGAGAATGTGG - Intergenic
1096021683 12:48330277-48330299 AAGAGGAAACAGACACAAGGTGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097374208 12:58820983-58821005 AAGATTAAACAGACAAAATACGG - Intergenic
1097461875 12:59872192-59872214 CAGAATAAACTAACAGAATAAGG + Intergenic
1099045816 12:77718018-77718040 CAGAGTAAAAAGGCAAACTGTGG - Intergenic
1099631776 12:85157749-85157771 CAGAGTGCTCAGAGAGAATGGGG + Intronic
1100952817 12:99870863-99870885 CAGAGTAAACAGACAACCTATGG - Intronic
1101111280 12:101488693-101488715 CAGAGTAAAGAGACAGCCTATGG - Intergenic
1102447000 12:113010872-113010894 CAGAGGAAACAGACAGGACGTGG - Exonic
1102972928 12:117185013-117185035 CAATGTAAACAGAGGGAATGGGG + Intronic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1104517843 12:129444309-129444331 CAGAGTAAACAGACAACTTACGG + Intronic
1105958019 13:25301952-25301974 CAGAGGGAAGAGACAGGATGGGG - Intronic
1106170857 13:27286714-27286736 CAGAGAGAACAGACGGGATGAGG + Intergenic
1106937740 13:34742615-34742637 CAGAGTAGACAGACACAGAGTGG - Intergenic
1107485096 13:40818923-40818945 CAGAGTAAACAGACAACCTACGG + Intergenic
1108644519 13:52413207-52413229 CAGATTAATCTGAGAGAATGTGG - Exonic
1108841710 13:54625936-54625958 CAGGGTAAAGGGACAGAAAGGGG + Intergenic
1109371493 13:61426045-61426067 CAGAGAAATCAAACTGAATGTGG - Exonic
1110159945 13:72363818-72363840 CAGAGTAAAGAGAGAGAAACTGG - Intergenic
1110976649 13:81844731-81844753 AAGAGTAAAAAAACAGAATTGGG + Intergenic
1111428457 13:88121008-88121030 CAGAGTGAACAGACAATGTGTGG - Intergenic
1111873726 13:93866813-93866835 CATAGTAAACATACGTAATGGGG - Intronic
1112137488 13:96597627-96597649 CAGAGTAAACAGACACCCTATGG - Intronic
1112831591 13:103459274-103459296 CAGAGTAAACAGACAACCTATGG - Intergenic
1113553212 13:111209302-111209324 CAAAGTAAACAGACAGTAAGAGG - Intronic
1114494854 14:23125721-23125743 CAGTTTAAGCAGACAGAATTCGG + Exonic
1114971544 14:28035908-28035930 CAGAGTGAACAGACAATCTGTGG + Intergenic
1116440202 14:44942278-44942300 CAGAGTAAATTGACAGGATTTGG - Intronic
1116996030 14:51325961-51325983 AAGAGAAAAAAGAGAGAATGAGG - Intergenic
1117595453 14:57322653-57322675 AAAAGTTAACAGACAGAATCTGG + Intergenic
1118571775 14:67201397-67201419 CAGAGCAAAAAGAGAGAATTGGG - Intronic
1118681666 14:68248178-68248200 AAGAGTAAACAGAAAAAATGTGG - Intronic
1119359702 14:74038022-74038044 AAGATAAAAAAGACAGAATGGGG - Intronic
1120164739 14:81185238-81185260 CAGAGTAAACAGCCACTTTGAGG - Intronic
1120503765 14:85328327-85328349 CACTGTAGACAGACAGACTGGGG - Intergenic
1121385774 14:93523239-93523261 CTCAGTATACACACAGAATGAGG - Intronic
1122170676 14:99872054-99872076 AATAGTACACAGACAGGATGGGG - Intronic
1123738225 15:23207058-23207080 CAGAGGTTAAAGACAGAATGGGG - Intergenic
1124289434 15:28435722-28435744 CAGAGGTTAAAGACAGAATGGGG - Intergenic
1124293788 15:28481586-28481608 CAGAGGTTAAAGACAGAATGGGG + Intergenic
1125646481 15:41276961-41276983 CAGTGCCACCAGACAGAATGAGG + Intronic
1126413992 15:48398995-48399017 CAGAGTAAACATGCAGAATTGGG - Intergenic
1126945788 15:53818395-53818417 CAAAGTAAACGGAGAGAAAGAGG + Intergenic
1127065096 15:55229142-55229164 CAGAGTACCAAGACAGAATAAGG - Intronic
1127342158 15:58058421-58058443 AAGATTAAACAGTCAGAAAGTGG - Intronic
1128288757 15:66460793-66460815 CAGAGTGAAGGGACAGGATGGGG + Intronic
1129514131 15:76146550-76146572 CAGAGGAAAAAAACATAATGGGG + Intronic
1129824784 15:78627741-78627763 CATAGTAACAACACAGAATGTGG - Intronic
1129971890 15:79785832-79785854 CAGAGTAAACAGACAACCTATGG + Intergenic
1130129192 15:81122981-81123003 CAGAGTAAACAGACAACCTATGG - Intronic
1130270412 15:82443333-82443355 CAGGGAACAGAGACAGAATGAGG - Intergenic
1130275556 15:82474498-82474520 CAGGGAACAGAGACAGAATGAGG + Intergenic
1130462757 15:84170652-84170674 CAGGGAACAGAGACAGAATGAGG - Intergenic
1130485771 15:84397617-84397639 CAGGGAACAGAGACAGAATGAGG - Intergenic
1130489920 15:84424135-84424157 CAGGGAACAGAGACAGAATGAGG + Intergenic
1130501508 15:84502885-84502907 CAGGGAACAGAGACAGAATGAGG + Intergenic
1133443892 16:5843525-5843547 CAGAGTAGACAAAGAAAATGTGG - Intergenic
1134290234 16:12898881-12898903 CAGAGAAAAGAGACAAAATCTGG - Intergenic
1136054223 16:27676116-27676138 GAGAGGAAAGAGACAGACTGAGG - Intronic
1137747511 16:50834016-50834038 CAGAGTAAACAAATACAAAGAGG - Intergenic
1138068385 16:53965690-53965712 CAGAGAGAAAAGAGAGAATGAGG - Intronic
1138989009 16:62367695-62367717 CAGAGTTTACACACAGAATGTGG - Intergenic
1139708736 16:68760558-68760580 CAGATTAAAGAGAAAGAATGGGG - Intronic
1140579858 16:76217330-76217352 CACAAAAAACAGACAGTATGTGG + Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141740766 16:85891104-85891126 TAGAGTAAAGAAACAGATTGCGG + Intergenic
1141817038 16:86418063-86418085 AAGATCAAACATACAGAATGTGG + Intergenic
1142787953 17:2239374-2239396 CAGAGAAAACATACAAAAAGTGG + Intronic
1143089786 17:4442846-4442868 CAGAGTTAAAAGACAGACTCTGG - Intronic
1143396451 17:6602381-6602403 GAGAATGAACAAACAGAATGTGG + Intronic
1143456156 17:7069450-7069472 CAGAGAAGACAGAAATAATGGGG - Intergenic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1143978643 17:10848753-10848775 CAGCTTAAACAGTAAGAATGTGG - Intergenic
1144595925 17:16570036-16570058 CAGAGGCTACAGACATAATGAGG - Intergenic
1144762844 17:17717113-17717135 CAGGGTCAAGAGTCAGAATGTGG + Intronic
1144808753 17:17985164-17985186 CTGGGTAAGCAGACAGAAAGAGG - Intronic
1146202986 17:30876284-30876306 AAGAGTAGAAATACAGAATGTGG + Intronic
1146807164 17:35873904-35873926 CCAAGTAACCAGCCAGAATGTGG + Intronic
1147783399 17:42960311-42960333 CAGAGGAGCCAGACTGAATGTGG + Intronic
1148008891 17:44458478-44458500 CAAAGTCAACAAACAGACTGGGG - Intronic
1148027082 17:44595779-44595801 CAGAAAAAAAAGAGAGAATGAGG - Intergenic
1148259964 17:46173082-46173104 CAGAGAAGTCAGATAGAATGGGG - Intronic
1149154728 17:53614086-53614108 AAGATTAAACAGACAGTATGTGG - Intergenic
1149532998 17:57410362-57410384 CTGGGTAAACAGCCAGCATGGGG + Intronic
1149975937 17:61266351-61266373 CAGAGAAAACGGCCAGTATGTGG + Intronic
1150240360 17:63626929-63626951 CATAGTAAACAGACACCATACGG + Intronic
1150294344 17:63999652-63999674 CAGAGTCAGGAGACAGAATGGGG + Intronic
1150641075 17:66949900-66949922 CAGAATAAAAACACAGAAAGAGG - Intergenic
1151153493 17:72108090-72108112 CAGTGAATATAGACAGAATGAGG - Intergenic
1151925751 17:77194965-77194987 CAGAGCAAACAGAGAGAAAACGG - Intronic
1153423834 18:4939982-4940004 CATACTAAACAGTTAGAATGAGG - Intergenic
1154078454 18:11229421-11229443 TAGAGAAAACAGAGAGAAGGAGG - Intergenic
1156460136 18:37316983-37317005 CAGGGCACACAGACAGAAAGTGG - Intronic
1156601234 18:38609714-38609736 CAGTGGAAAAGGACAGAATGAGG + Intergenic
1156627079 18:38921927-38921949 CAGAGTTTACAGTCAGATTGGGG + Intergenic
1157698883 18:49746857-49746879 GAGAGAAAACAGAATGAATGTGG - Intergenic
1158460638 18:57643413-57643435 CAGAGTAGCCAGATAGAGTGTGG + Intergenic
1158755402 18:60318423-60318445 CAGAGTAAACAGACAACCTATGG - Intergenic
1159845497 18:73454746-73454768 CTGAGAAAAGACACAGAATGCGG - Intergenic
1159983295 18:74812400-74812422 CAGAGAAAACAGCCAGAATTTGG + Intronic
1160144067 18:76349625-76349647 CTTAGTAAGCAGAGAGAATGTGG + Intergenic
1160201414 18:76799159-76799181 CAGAGGAAAGAGAAAGAATAAGG + Intronic
1161264330 19:3357362-3357384 GAGAGGAAATAGACAGATTGAGG + Intergenic
1164477973 19:28589893-28589915 CAGAGAAAACAGAGATGATGGGG - Intergenic
1164629770 19:29754490-29754512 CACAGTGAACCGGCAGAATGTGG - Intergenic
1164960897 19:32428577-32428599 CAGAGTGACCAGACATTATGTGG + Intronic
1165831298 19:38731813-38731835 GAGAATGAACACACAGAATGGGG - Intronic
1165967989 19:39600578-39600600 GAGAGTAAACAGACAGCCTAAGG + Intergenic
1166050302 19:40255277-40255299 CAGAGGGAACAGACAGCAGGGGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167945446 19:52984675-52984697 TAGAGTAAACAGAGAGGAAGGGG + Intergenic
1168198056 19:54790446-54790468 CAAAGCAAACATACAGAAAGAGG + Intronic
925017303 2:540628-540650 CAGAGTTAACAGACAACCTGTGG + Intergenic
925419433 2:3699938-3699960 CAGAGTAAACAGACAACCTACGG - Intronic
926046014 2:9710112-9710134 CAGAGCAATAAGACAGAAGGAGG + Intergenic
927041670 2:19236826-19236848 CTGAGGAAACAGAGAGAATGGGG - Intergenic
927426906 2:22991156-22991178 CAAAGTAAACGGAAAGACTGAGG + Intergenic
928138620 2:28708208-28708230 CAGGGAAGACAGAAAGAATGAGG + Intergenic
928328829 2:30341684-30341706 AGGAGTAAACAGACAGAAGAGGG + Intergenic
928724939 2:34161525-34161547 CAGATGAAACAGAGAGAATGTGG + Intergenic
929135417 2:38619204-38619226 CAGGACAAACAGACAGGATGGGG - Intergenic
929742952 2:44623265-44623287 CAGAGTAAACAGACAGCCTACGG - Intronic
930170793 2:48249589-48249611 CTGAGAAAACAGACACGATGAGG + Intergenic
930567831 2:53045272-53045294 CAGAGTGAAGAGACAACATGTGG - Intergenic
930638101 2:53828048-53828070 CTGAGTAAACAGTCAGGAAGAGG + Intergenic
930677099 2:54214182-54214204 CAGAGTAAACAGACAACCTATGG - Intronic
931075800 2:58710195-58710217 CAGGGTAAAAAGTGAGAATGTGG - Intergenic
931087666 2:58851457-58851479 CAGAATAAAAAGGCAGAATGGGG + Intergenic
931892524 2:66689498-66689520 GAGAGTAGAGAGAGAGAATGTGG + Intergenic
932148195 2:69343367-69343389 CAGAGTAGACAGACTGAAAATGG - Intronic
933884203 2:86702668-86702690 CAGTGTGAACAGACAAAATGAGG + Intronic
935685470 2:105679132-105679154 AAGAGAAAACAGACAAAATTGGG - Intergenic
936703365 2:115040449-115040471 TAGAGTAAACAGTCACAATTTGG + Intronic
936720939 2:115252509-115252531 TAGAGTTAACAAACATAATGAGG - Intronic
936862729 2:117037083-117037105 CAGAGTAAACAGACAGCCTATGG + Intergenic
937447836 2:121973852-121973874 CAGAGTAAACAGACAGCCTAAGG + Intergenic
937524329 2:122748539-122748561 AAGAGTAAACAGAGAGAACAAGG - Intergenic
937551927 2:123104988-123105010 CAGAGTAAACAGACAACTTACGG + Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
937958859 2:127439371-127439393 CAGCGAATACAGACAGAATGGGG + Intronic
938599375 2:132821604-132821626 CAGAGTGGACAGACAGGAAGGGG + Intronic
939270014 2:139927340-139927362 CAAAGTAAACAAAACGAATGTGG - Intergenic
939601927 2:144203244-144203266 GAGAGCAAAGAGACAGAAAGAGG + Intronic
940174088 2:150859825-150859847 CAGAGGTTACAGAAAGAATGGGG + Intergenic
940324154 2:152407633-152407655 CAGAGCCAACAGACTCAATGGGG - Intronic
940611534 2:155998693-155998715 CAGAGTAAACAGATAACCTGTGG + Intergenic
940611860 2:156003429-156003451 CAGAGTCTTCAGACATAATGAGG - Intergenic
940648814 2:156419668-156419690 AAGATTGAAGAGACAGAATGTGG + Intergenic
940942490 2:159578188-159578210 CAGAGTCAAGAAACAGACTGTGG + Intronic
941566110 2:167110115-167110137 CAGAGTAAACAGACAACTTACGG - Intronic
942344861 2:174992209-174992231 AAGAATAAACACAAAGAATGTGG + Intronic
942835799 2:180295852-180295874 CAGAGTAAACAGACAACCTACGG - Intergenic
942852473 2:180505470-180505492 CAGAATAAACTGACATTATGTGG + Intergenic
942880132 2:180849923-180849945 AAGAAAAAACAGACAGAATCAGG + Intergenic
942881382 2:180865276-180865298 CAGAGCAAAAAGAAAGAATCTGG + Intergenic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943164777 2:184307134-184307156 CAGAGTAAACAGACAAATTATGG - Intergenic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943814460 2:192234986-192235008 CAGGTTAAACAGAGTGAATGTGG - Intergenic
944615342 2:201453187-201453209 CAGAAGAAACAGACACAATCTGG - Intronic
944620749 2:201513136-201513158 CAGAGTAAACAGACAACCTACGG + Intronic
944623373 2:201542790-201542812 AAGAGGAAACCTACAGAATGGGG - Intronic
944950192 2:204739750-204739772 CAGATAAAATAGACATAATGAGG - Intronic
945629960 2:212262089-212262111 CAGAGTACACAGCCAAAAAGTGG - Intronic
946011444 2:216567338-216567360 GAGAGAAAACTGAGAGAATGGGG + Intronic
1169008842 20:2232788-2232810 CAAAAGAAACAGCCAGAATGTGG - Intergenic
1169538265 20:6570718-6570740 CAGAGTAAACAGACAACCTATGG + Intergenic
1170351260 20:15444281-15444303 CTGAATGAACAGACAAAATGTGG - Intronic
1170397317 20:15940824-15940846 CAGAGCGAAAAGACAGAAAGTGG + Intronic
1170533470 20:17317041-17317063 CAGGGCAAAAAGAGAGAATGTGG - Intronic
1171748113 20:29019860-29019882 CAGAGTAAACAGAAAAACTATGG + Intergenic
1172462690 20:35132105-35132127 CTGAGAAATCAGACAGATTGCGG - Intronic
1172965781 20:38833778-38833800 GAGAGTAAGCAGGCAGAATGGGG - Intronic
1173804240 20:45913371-45913393 CAGAAAAAAAAGACACAATGGGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1174954497 20:55082110-55082132 CAGAGACAACAGAGAAAATGTGG - Intergenic
1175376659 20:58531477-58531499 CAGAATGAGAAGACAGAATGAGG - Intergenic
1175480954 20:59310487-59310509 AAGAATAGACAGACAGGATGAGG + Intronic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1177490768 21:21823229-21823251 CAGAGTAAACAGACAGTTTATGG - Intergenic
1177564050 21:22795795-22795817 CAGAGTAAACAGACAACCTAGGG + Intergenic
1177857747 21:26418945-26418967 CAGAGTAAAAAGGCAGCATATGG + Intergenic
1178530373 21:33370991-33371013 CTGAGTGTACAGACAGAATGGGG - Intergenic
1178806162 21:35841383-35841405 CAGAGTGAGAAGACAGAGTGTGG + Intronic
1179911582 21:44452342-44452364 CAGAGCAAGTAGACAGAAAGTGG + Intergenic
1179924410 21:44526292-44526314 CTGTGTGAACATACAGAATGAGG + Intronic
1179972766 21:44845629-44845651 CACAGAAGCCAGACAGAATGGGG - Intergenic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1181566574 22:23742416-23742438 CGGGGAAGACAGACAGAATGTGG + Exonic
1182108994 22:27709645-27709667 CACAGTGAACAAACAGTATGTGG + Intergenic
1184879812 22:47297625-47297647 CAGAGGGAACAGACAGTGTGGGG + Intergenic
950916242 3:16648086-16648108 CAGAGCAAACAGGCAGAAGAAGG - Intronic
951226334 3:20125452-20125474 TACAGTAAGCAGACAAAATGTGG - Intronic
953336403 3:42098065-42098087 GAGAGGAAACAGACAGAAAGTGG - Intronic
955148513 3:56344055-56344077 CAGAGTAAACAGGCAGAGAGAGG + Intronic
955457657 3:59141575-59141597 CTGAGGAAACTGACAGAATTAGG + Intergenic
955806638 3:62742838-62742860 AACAGAAAACCGACAGAATGGGG + Intronic
955839910 3:63101156-63101178 CTGAATAAACAGAGACAATGCGG + Intergenic
955962432 3:64354754-64354776 CACTGTAAAAAGACAGAATTTGG - Intronic
956104646 3:65805137-65805159 CAGAGCAAACAGACAACCTGTGG + Intronic
956558360 3:70545648-70545670 CACAATGAACAGACAGCATGAGG + Intergenic
956577518 3:70769762-70769784 CAGAGTAAACAGACAACCTACGG - Intergenic
957615831 3:82525623-82525645 TAGAGAAAACCCACAGAATGGGG - Intergenic
957843079 3:85696207-85696229 CAGAGTAAACAGATAACAAGTGG - Intronic
958496996 3:94857629-94857651 CAGATTAAACAGACAGTGTACGG - Intergenic
959094485 3:101938810-101938832 CAGAGACAACAGGGAGAATGAGG - Intergenic
960735329 3:120773076-120773098 CAGACAAGAAAGACAGAATGGGG + Intronic
963297926 3:143567167-143567189 CATTGTACACATACAGAATGTGG - Intronic
963465647 3:145678090-145678112 CAGAGAAAACAGAGACAATGTGG + Intergenic
964784284 3:160377103-160377125 GATTGGAAACAGACAGAATGGGG + Intronic
965236212 3:166127016-166127038 CAGAGTATACAGAAAGCACGGGG + Intergenic
965318207 3:167217171-167217193 CAGAGTAAACAGACAACCTATGG + Intergenic
966570889 3:181441693-181441715 CAGAGTAAACAGCCCAGATGGGG + Intergenic
967668384 3:192202218-192202240 CAAAAGAAACAGACAGATTGAGG + Intronic
968020062 3:195378002-195378024 TAGAGTCAACAGAGAGTATGAGG + Intronic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
969889611 4:10247732-10247754 AACAGGAAACATACAGAATGGGG - Intergenic
970122347 4:12770685-12770707 AAGACTAAACAGTCACAATGGGG - Intergenic
970297109 4:14641923-14641945 CAGAGAAAACCAACAGGATGTGG - Intergenic
970301092 4:14682023-14682045 AATAGTAAACAGATACAATGAGG - Intergenic
970677737 4:18471771-18471793 CAGACAAAACACAAAGAATGTGG - Intergenic
971229541 4:24789890-24789912 TAGAGAAAACAGAGGGAATGCGG - Intronic
971983666 4:33790877-33790899 CAGAGGAAACAGACTAGATGAGG - Intergenic
972047853 4:34691739-34691761 CAGAATAATCAGACATAATGTGG + Intergenic
974213538 4:58814681-58814703 AATAGTAAACAGAAAGAATATGG - Intergenic
974623808 4:64396595-64396617 CAGAGTAAACAGACAACCTAAGG - Intronic
975396436 4:73879455-73879477 CAGAGTAAACAGACAGCCTATGG - Intergenic
975478422 4:74849785-74849807 CAGAGTAAACAGACAACCTACGG - Intergenic
975604405 4:76139452-76139474 CAGAAGAAAAATACAGAATGGGG + Intronic
975912411 4:79282588-79282610 TAGAGCAAACAGATAGATTGTGG + Intronic
976015467 4:80547574-80547596 CAGAGTAAAAAGACAGCCTACGG + Intronic
976311797 4:83620510-83620532 CACAGAAAACACACAGACTGGGG - Intergenic
976376081 4:84346635-84346657 CAGAGTAAACAGACAACCTACGG + Intergenic
976766703 4:88605535-88605557 ATGAGTAAACAGACAGAATATGG - Intronic
977088807 4:92642573-92642595 CAGAGTAAACAGACAACCTACGG - Intronic
977442129 4:97081138-97081160 TAGAGTAAACAGACAACTTGTGG - Intergenic
977562821 4:98549824-98549846 GAGAGTAAACCTACAGAATGAGG - Intronic
977650248 4:99460930-99460952 CAGAGTGCAGGGACAGAATGAGG + Intergenic
978490310 4:109304672-109304694 CAGAGGAAGCAGACAGAATTTGG - Intergenic
978571929 4:110147477-110147499 CAGAGTGAACAGACAGCCTTTGG + Intronic
979031718 4:115657517-115657539 AAGAGTAGAGAGAAAGAATGAGG - Intergenic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
980859584 4:138483017-138483039 CACAGTTAACAGACAGCAGGAGG - Intergenic
980948016 4:139342139-139342161 CAGAGTTAACATACATAAAGAGG - Intronic
981041547 4:140227497-140227519 CAGAGTAAATAAATAGCATGAGG - Intergenic
981302178 4:143199917-143199939 CAGAGTAAACAGACAACCTACGG - Intronic
981602624 4:146507708-146507730 CATAGTAAAGGGACAGAGTGAGG - Intronic
982192541 4:152872457-152872479 CAGAGAACACAGACAAAAAGTGG + Exonic
984162115 4:176265719-176265741 CACAGTATACAGAGAGAATGAGG - Intronic
984309742 4:178041847-178041869 CAGAGTAAACAGACAATCTACGG - Intergenic
984715695 4:182922805-182922827 TAGAGTAGAAAGTCAGAATGTGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986170350 5:5309886-5309908 CAGAGAAAGCAAACGGAATGTGG + Intronic
987206850 5:15636231-15636253 CAGAGGAAAGATACAGTATGTGG - Intronic
987261627 5:16210202-16210224 CTGAGAAAACAGACACAAGGAGG + Intergenic
987652026 5:20753817-20753839 CAGCATAAAAAGAGAGAATGAGG - Intergenic
988275863 5:29080410-29080432 CAAATTATACAGACAGAATCTGG - Intergenic
988740576 5:34065092-34065114 CAGAGTAAACAGACAACCTATGG + Intronic
988743535 5:34107659-34107681 CAGCATAAAAAGAGAGAATGAGG + Intronic
988935003 5:36072977-36072999 CAGAGTAAACAGACAACCTATGG - Intergenic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
989483372 5:41959334-41959356 CAGAGTAAAGAGACAACATATGG - Intergenic
989722406 5:44545072-44545094 CAGAGTAAACAGACAACCTACGG + Intergenic
989770927 5:45144280-45144302 CAGAGTAAACAGACAATCTAAGG - Intergenic
989784404 5:45310214-45310236 CAGAGTAAACAGACAACCTGTGG + Intronic
990130724 5:52579838-52579860 AAAAGTAAACAGAAAGAGTGAGG - Intergenic
990167704 5:53013042-53013064 CAGAGTAAACAGACAACCTATGG - Intronic
990771517 5:59251793-59251815 CAGATTAGACAAAGAGAATGAGG + Intronic
990903233 5:60776030-60776052 CAGAGTAAACAGACAACCTATGG + Intronic
990934842 5:61136996-61137018 CAGAGTAAGCTGAGAGAATATGG + Intronic
992441446 5:76800970-76800992 CAGGGTAAGGAGAGAGAATGAGG + Intergenic
993064533 5:83081205-83081227 CAAAGTAAAAAGAGAAAATGGGG - Intronic
993465864 5:88246107-88246129 CATAGTAAAGAGATAGAGTGAGG - Intronic
993514229 5:88810477-88810499 CACAGGATACAGAAAGAATGGGG + Intronic
993784346 5:92110075-92110097 CAAAGGAAACAAACACAATGGGG + Intergenic
994031119 5:95144347-95144369 CAGAGTAAGCAGACAGCCTATGG - Intronic
994614258 5:102083611-102083633 CAGAGTAAACAGACAATCTGTGG + Intergenic
995058993 5:107793570-107793592 CAGAGTAAACAGACAACCTAAGG + Intergenic
995991976 5:118250957-118250979 CACAGTTAACATACTGAATGGGG + Intergenic
996982220 5:129512647-129512669 CACAGGAAACTGACAGATTGGGG + Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997629297 5:135354642-135354664 CACAGAAAAGAGACAGCATGGGG + Intronic
997898193 5:137738887-137738909 CAGAGTAAACAGACAATGTACGG + Intergenic
998801165 5:145870814-145870836 CAAAGAAAACAGAGATAATGAGG + Intronic
999413419 5:151372927-151372949 CAGATGAAGAAGACAGAATGTGG + Intergenic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
999843570 5:155454416-155454438 TAGAGCCAACAGAGAGAATGGGG - Intergenic
1001884037 5:175272240-175272262 CAGAGTAAAGCAATAGAATGAGG - Intergenic
1002592539 5:180300650-180300672 CAAAGTACACAAAAAGAATGAGG + Intergenic
1003236222 6:4297431-4297453 CTGAGTAAGAAGAGAGAATGAGG + Intergenic
1003253528 6:4454660-4454682 CAGAGGAAAAAGAAAGAATGAGG + Intergenic
1003305083 6:4919966-4919988 CTGAATAAATAGACAAAATGTGG + Intronic
1003483278 6:6552773-6552795 CAGAGGAAACAGAATGAAAGGGG + Intergenic
1003550796 6:7100621-7100643 CAGAGAAACCACACAGAATGTGG - Intergenic
1005209441 6:23443486-23443508 CAGAGAAAAAAGGCAGAATCAGG - Intergenic
1005704795 6:28440800-28440822 CAGAGTATACAGAGAAAATAGGG - Intronic
1005946183 6:30597654-30597676 AAGAAAAAACAGACAGATTGGGG - Intergenic
1006339778 6:33440507-33440529 CAGAGGGAACAGACAGATTAGGG - Intronic
1007349891 6:41263659-41263681 CACAGCCAACAGACTGAATGGGG + Intergenic
1008424307 6:51339055-51339077 AACAGAAAACAGAGAGAATGAGG - Intergenic
1009002683 6:57738506-57738528 CAGAGCCAACTTACAGAATGGGG + Intergenic
1010867734 6:81000718-81000740 CAGAGTAAACAGACAATCTATGG - Intergenic
1011136762 6:84108621-84108643 CAGAGTAAACAGACAACCTATGG - Intergenic
1011731974 6:90274049-90274071 GAGATTAAACAGACAGATAGGGG + Intronic
1011995434 6:93581223-93581245 CAGAGTACACAGAGAATATGAGG + Intergenic
1012256429 6:97038228-97038250 TAGAGCAAACCCACAGAATGGGG + Intronic
1012902441 6:105021761-105021783 CAGAGTGAACAGACACCCTGCGG - Intronic
1014055728 6:117013629-117013651 CAGAGTTTATAGACAGAATTTGG - Intergenic
1014097119 6:117472540-117472562 CAGATTAAACAGACCTAAGGTGG + Intronic
1014186246 6:118437428-118437450 CAGAGTTATCATACTGAATGGGG - Intergenic
1014793184 6:125698283-125698305 AAGATTAAACAAACAAAATGTGG + Intergenic
1016188219 6:141224285-141224307 CACAGAAAACAGACTGATTGTGG - Intergenic
1016708122 6:147137698-147137720 GAGAGTAAATGGAAAGAATGAGG + Intergenic
1016897884 6:149071670-149071692 CAGAGTGAAAAGACAGCCTGTGG + Intronic
1017604958 6:156123937-156123959 CAGAGAAAGCGCACAGAATGGGG + Intergenic
1017990697 6:159486320-159486342 AAGAGAGAAAAGACAGAATGAGG + Intergenic
1018849803 6:167578710-167578732 TAGAGAAAACAGAGAGAGTGTGG - Intergenic
1019227024 6:170521530-170521552 CAGAGTAAACAGACAACCTACGG + Intergenic
1020573697 7:9898525-9898547 CATAGTTAACATACTGAATGGGG + Intergenic
1020592229 7:10154869-10154891 CAGAGTGAACAGACAACCTGAGG + Intergenic
1020628472 7:10611867-10611889 CACAGGAAACATACAGAATGGGG - Intergenic
1020917555 7:14215189-14215211 CAGAATAAACAGGAAGAATATGG + Intronic
1021252766 7:18352184-18352206 CAGATTAAACAGACAGCCTAAGG - Intronic
1021323548 7:19240205-19240227 CACTGTCAAGAGACAGAATGGGG + Intergenic
1022545258 7:31181513-31181535 CAGAGTAAACAGACAACTTATGG - Intergenic
1023515038 7:40993363-40993385 CAGGGTAAGCAGACAGCATCAGG - Intergenic
1024328839 7:48136226-48136248 CAGTTTACACAGACAGAAAGAGG + Intergenic
1026411231 7:70125355-70125377 CAAAGTACTCAGTCAGAATGGGG - Intronic
1026497033 7:70912332-70912354 CAGAAGAAAGAGAAAGAATGAGG + Intergenic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027665158 7:81035700-81035722 CAGAGAAAACAGATTGAATATGG + Intergenic
1029240376 7:99157151-99157173 CAGAAGAAACAGTCAGAATCGGG - Intergenic
1030223681 7:107125620-107125642 GAAAGTAAACAGCCAGAAAGCGG - Intronic
1030451156 7:109713829-109713851 CAGAGTAAACAGACAACCTATGG + Intergenic
1031573434 7:123386673-123386695 CAGAGGAAACAGACTGAAGTAGG - Intergenic
1033015283 7:137664688-137664710 GAGAGAAAACAGACAGAACCAGG + Intronic
1034023991 7:147677453-147677475 AAGAGAAAACCTACAGAATGGGG - Intronic
1034569013 7:151940369-151940391 AAGAGGAAAAAGACAGAAAGTGG + Intergenic
1035241396 7:157532413-157532435 CAGAGTAAACAGACAACCTACGG - Intergenic
1035388881 7:158491830-158491852 CAGAGAATGCAGACTGAATGTGG - Intronic
1037373711 8:18206288-18206310 CAGAGGGAACACACAGAAGGTGG - Intronic
1037750538 8:21679257-21679279 AAGAATAGACAGAAAGAATGAGG - Intergenic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038625712 8:29190888-29190910 CAGAGGAAACACACAGTTTGGGG + Intronic
1038694502 8:29794090-29794112 CAGAGTACAAAGAGAGAAAGAGG + Intergenic
1039072941 8:33662665-33662687 CTGAGGAAACAGACAGCATTAGG - Intergenic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1039546799 8:38416281-38416303 CAAAATAAACAGACAAACTGGGG - Intronic
1039655165 8:39396604-39396626 CAGAGTGAACACACAAATTGTGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1041507920 8:58621911-58621933 CAGAGTAAACAGACAGCCCACGG - Intronic
1041554967 8:59143214-59143236 CAGAGCAAACATATAGGATGAGG + Intergenic
1041571997 8:59348104-59348126 CAGAGTAAACAGACAACATACGG + Intergenic
1041750787 8:61258913-61258935 TAGAGTAAACAGAGAGGAGGAGG + Intronic
1042634539 8:70859057-70859079 AAGAGACAACACACAGAATGAGG + Intergenic
1044789676 8:95834673-95834695 CAGAGAAGACAGAGAGAATATGG + Intergenic
1044815094 8:96103677-96103699 AAGAGCAAACAGAATGAATGAGG + Intergenic
1045868733 8:106900880-106900902 CAGAGTAAACAGACAGCCTAAGG - Intergenic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1046725569 8:117669941-117669963 CACAGAAACCACACAGAATGTGG + Intergenic
1047021183 8:120776422-120776444 CAGAGTAATGAGACACAAGGAGG + Intronic
1047148144 8:122229336-122229358 CACAGCAAACATACTGAATGGGG + Intergenic
1047392459 8:124464395-124464417 GAAAGTAGACACACAGAATGAGG - Intergenic
1048218961 8:132524014-132524036 CAGTGTAAATAAACACAATGTGG + Intergenic
1048409687 8:134159628-134159650 CAGAGAAAACACAGAGACTGTGG - Intergenic
1048744974 8:137604353-137604375 CATAGTAAGCAGAAAGACTGAGG + Intergenic
1049545777 8:143229843-143229865 CAGAGGAAGGTGACAGAATGTGG + Intergenic
1050214750 9:3309954-3309976 CAGAATAAAAGGACAGAGTGGGG + Intronic
1050599653 9:7237627-7237649 CAGAGTAACAAGAGAGAGTGTGG + Intergenic
1052216985 9:25978691-25978713 AAGAGAAAAGAGAAAGAATGGGG - Intergenic
1053051924 9:34969150-34969172 CACAGTAAAGAGACTGATTGTGG + Intronic
1054351331 9:64019164-64019186 CAGAGTAATCAGACAAAAGAAGG - Intergenic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1055774028 9:79748585-79748607 GAGAGTGAACAGAGAGAATAAGG + Intergenic
1058616451 9:106833920-106833942 CAGAGTAAACAGACAATCTATGG + Intergenic
1059096955 9:111427181-111427203 AAAAGAAAACAGACTGAATGTGG + Intronic
1059737726 9:117118908-117118930 CAGGGTAAAAAGATAGAGTGAGG - Intronic
1059937468 9:119325440-119325462 CAAAGTAAATTGACAGGATGTGG - Intronic
1060057311 9:120425959-120425981 CAGAGGAGACAAACAGAATCTGG + Intronic
1060147108 9:121262439-121262461 TAGAGTAAGCACTCAGAATGTGG + Intronic
1061061449 9:128252546-128252568 CAGAGAACAGAGACAGAATGAGG + Intronic
1061328547 9:129878568-129878590 CAGGGTGAACAGAGAGCATGGGG + Intronic
1062647831 9:137558459-137558481 GAGGATGAACAGACAGAATGTGG + Intronic
1203366203 Un_KI270442v1:259214-259236 CAGAGTGAACAGGCAAAATATGG + Intergenic
1185595248 X:1302408-1302430 CAGATCACACAGACAAAATGGGG + Intronic
1186032553 X:5385653-5385675 CAAAGAAAACAAACAGAATGGGG - Intergenic
1186101815 X:6165360-6165382 CAAAGTCAAGAGACAGAATCAGG + Intronic
1187039904 X:15582756-15582778 CAAAAAAAACAGAAAGAATGAGG + Intronic
1187128578 X:16478580-16478602 CAGACTTAATAAACAGAATGAGG + Intergenic
1187150736 X:16679429-16679451 CAGAGGAAAAAGAGAGAAAGTGG + Intronic
1187852159 X:23601705-23601727 CAGAGTAAAAATGCAGAATCTGG + Intergenic
1188276052 X:28202199-28202221 CAGAGTAAACAGAGATCTTGAGG - Intergenic
1188330300 X:28862752-28862774 CAGAGTAAAAAGCCACAATTTGG + Intronic
1188737120 X:33730919-33730941 AAGAGTAAACAGTTAGAAAGTGG + Intergenic
1188935071 X:36165798-36165820 CACAGAAAAAAGACAAAATGAGG - Intergenic
1189570405 X:42289892-42289914 CAGAGGAGACAGAGAGAAAGAGG - Intergenic
1190222434 X:48521058-48521080 CAGAGCAACCAATCAGAATGGGG - Intergenic
1190585963 X:51942427-51942449 CAGAGTAAACAGACAACTTACGG + Intergenic
1190817617 X:53942205-53942227 AAGTGTAAACAGCCAGACTGTGG - Intronic
1191112270 X:56813274-56813296 CAGAGTCCACAAAAAGAATGGGG - Intergenic
1191153017 X:57241343-57241365 CAGAGTAAACAAACAGCCTATGG + Intergenic
1191747677 X:64507762-64507784 AAGAGGAAACCTACAGAATGGGG + Intergenic
1191789869 X:64958531-64958553 AAGAGTCAACAGATAAAATGTGG - Intronic
1191853254 X:65601812-65601834 CAGAGGAAACAGATAGACTGAGG - Intronic
1192030142 X:67501992-67502014 CAGACTAAGGAGAAAGAATGAGG + Intergenic
1192245413 X:69367792-69367814 CTGAGAAAACAGACAGAAGGGGG - Intergenic
1192397670 X:70799039-70799061 CAGAGTGAAGAGACAGCCTGTGG + Intronic
1193282556 X:79670881-79670903 CAGAGACAACACACAGAATAGGG - Intergenic
1193467153 X:81864322-81864344 CAGAGTAAACAGACAACCTCTGG + Intergenic
1193471000 X:81903356-81903378 CAGAGTAAACAAACAACCTGTGG - Intergenic
1193594401 X:83428537-83428559 AAGAGACAACACACAGAATGGGG + Intergenic
1193744840 X:85264792-85264814 ATGAGGAAACAGACAGAAGGGGG - Intronic
1194007732 X:88517746-88517768 CAGGGTAAACAGATATAATGAGG - Intergenic
1194406455 X:93502196-93502218 CAGAGTAAACAGACAACCTTTGG + Intergenic
1194454148 X:94081265-94081287 CAGAGTAAACAGACAACAAGAGG - Intergenic
1194805906 X:98327929-98327951 CACAGTACACAGACAGGATCTGG + Intergenic
1194911032 X:99644860-99644882 CAGAGTGAACAGACAGCCTATGG - Intergenic
1195483338 X:105373459-105373481 CAGAGTAAACAGACAACCTAAGG - Intronic
1195917379 X:109949005-109949027 CAGAGAAAAAAGTCAGAATCTGG + Intergenic
1196238544 X:113311824-113311846 CAGAGTAAACAGACAACCTATGG + Intergenic
1196431738 X:115634212-115634234 CAGATTATACAGACAGAACTGGG + Intronic
1197007955 X:121525908-121525930 CAGAGTAAACAGACAATCTGTGG + Intergenic
1197113314 X:122801551-122801573 AAGAGACAACAGACAGAATGGGG + Intergenic
1197263564 X:124342124-124342146 CATAGTAAATAAAGAGAATGAGG + Intronic
1197350393 X:125375001-125375023 CAGAGTAAACAGACAACCTATGG - Intergenic
1197368620 X:125598959-125598981 AACAGAAAACATACAGAATGAGG - Intergenic
1197487143 X:127066879-127066901 AAGAGAAAACCTACAGAATGGGG - Intergenic
1199418228 X:147611796-147611818 CACAGTAAGCAGAAAGAAGGTGG + Intergenic
1201495234 Y:14585804-14585826 CAAAGTCAAGAGACAGAATCAGG - Intronic
1201668245 Y:16484035-16484057 CAGAGTGAAGAGGCAGAATGAGG - Intergenic
1202368270 Y:24181237-24181259 CAGGGAACAGAGACAGAATGAGG - Intergenic
1202372427 Y:24207945-24207967 CAGGGAACAGAGACAGAATGAGG + Intergenic
1202498358 Y:25462175-25462197 CAGGGAACAGAGACAGAATGAGG - Intergenic
1202502515 Y:25488880-25488902 CAGGGAACAGAGACAGAATGAGG + Intergenic