ID: 979578539

View in Genome Browser
Species Human (GRCh38)
Location 4:122325889-122325911
Sequence ATACCCTTCCCCAGGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979578539 Original CRISPR ATACCCTTCCCCAGGACAGC TGG (reversed) Intronic
900383863 1:2400219-2400241 ATACCCTACTCCCTGACAGCAGG - Intronic
900691104 1:3981160-3981182 ATTCCCTTCCCAAGGCCTGCAGG + Intergenic
900795068 1:4702848-4702870 TGCCCCATCCCCAGGACAGCAGG - Intronic
900977313 1:6025771-6025793 GTACCCCTTCCCAGGGCAGCAGG + Intronic
901740135 1:11336262-11336284 CTGCCCTTCCCCAGCAAAGCAGG + Intergenic
902386652 1:16079715-16079737 AGAGCCCTCCCCAGGAAAGCAGG + Intergenic
902583475 1:17423869-17423891 CAAGCCTTCTCCAGGACAGCTGG - Intronic
904597644 1:31656883-31656905 ATTCCTCTCCCCAGGACAACAGG + Intronic
905612875 1:39370254-39370276 ATACATTTCCCCACCACAGCTGG - Intronic
905797592 1:40824240-40824262 CTACCTTTCCCCAGGGCAGAAGG - Exonic
907405686 1:54252105-54252127 ACCCCCTACCCCAAGACAGCAGG - Intronic
908852185 1:68387206-68387228 TGACCCTGCCCCAGGAAAGCGGG - Intergenic
909222859 1:72984558-72984580 TTGCCCTGCCCCAGGAAAGCGGG + Intergenic
915073689 1:153292477-153292499 ACACCCTGCCCCAGGGCTGCGGG - Intergenic
915399488 1:155611907-155611929 CTGCCCTTCCCCAGGACAAGAGG + Intronic
915416601 1:155747487-155747509 CTGCCCTTCCCCAGGACAAGAGG + Intergenic
919466219 1:197923327-197923349 ATCTCCTGCCCCAGCACAGCAGG - Intronic
919974241 1:202600471-202600493 CTGCTCTTCCCCTGGACAGCCGG - Exonic
920054100 1:203180408-203180430 ATCACCTTCCCCAGGGCTGCTGG + Intronic
921001292 1:211046411-211046433 ATGCCCTTCCCCAGGAGCGAGGG + Intronic
921212207 1:212910474-212910496 TTGCCCTGCCCCAGGAAAGCGGG - Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
924614771 1:245603600-245603622 ATAGCCTTGACCAGGTCAGCTGG + Intronic
1066051181 10:31637148-31637170 AAGCCCTTCCCCAGGAGAGAAGG + Intergenic
1069682042 10:70292211-70292233 ATTCACTTCCACAGCACAGCCGG + Intergenic
1070162956 10:73876635-73876657 CTACCCCTCCCCAGGGCAACAGG + Intergenic
1071457823 10:85864272-85864294 GTGCCCTCTCCCAGGACAGCTGG - Intronic
1074700556 10:116088373-116088395 ATCCCCTTCTCCAGCATAGCGGG + Intronic
1075216730 10:120543030-120543052 ACACCCATCCCCAGGACGGTGGG + Intronic
1075567319 10:123514062-123514084 CTCCCCTTCCCCAGGACTCCAGG - Intergenic
1075734459 10:124655342-124655364 AGGCCCCTCCCCAGGCCAGCAGG - Intronic
1076409002 10:130232652-130232674 TTCCCCTTCCCCAGGGCAGCTGG - Intergenic
1076630072 10:131847031-131847053 ATCGCCAGCCCCAGGACAGCAGG + Intergenic
1076813801 10:132904213-132904235 AGGCCCTTCCCCAGTCCAGCAGG - Intronic
1077840791 11:5972591-5972613 ATCCCCTTCTCCAAGCCAGCTGG + Intergenic
1081356606 11:42121557-42121579 TTCCCCTGCCCCAGGAAAGCGGG - Intergenic
1081591294 11:44425078-44425100 AAACCCTGCCCCAGGCCATCCGG + Intergenic
1081594978 11:44452828-44452850 ATACCCTTGGGCAGGTCAGCGGG + Intergenic
1084572781 11:69969553-69969575 ATGCACTTTCCCAGGAGAGCTGG - Intergenic
1088397016 11:109380060-109380082 ATACCCTTTCATAGGACAGGGGG - Intergenic
1089832061 11:121337715-121337737 TTCCCATTCCCCAGGACACCAGG - Intergenic
1091080297 11:132660783-132660805 ATACCCTGCTCCATGACAGTCGG + Intronic
1099245575 12:80189751-80189773 ATATCATTCACAAGGACAGCAGG + Intergenic
1102708424 12:114903336-114903358 TTACCCTGCCCTAGGACGGCAGG + Intergenic
1106414427 13:29534596-29534618 TCCCCCTTCACCAGGACAGCTGG - Intronic
1107875071 13:44783167-44783189 ATAATCTTCCCCTGGCCAGCCGG + Intergenic
1110645053 13:77873176-77873198 ACACTCTTCCTCAGAACAGCTGG + Intergenic
1110701745 13:78556374-78556396 ATAACTCTCCCCAGCACAGCTGG - Intergenic
1112155908 13:96816635-96816657 ATACCTTTCCCCTGGACAGCTGG - Intronic
1113324037 13:109265980-109266002 TTCCCCTTCCCCAGAAAAGCGGG - Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1119854830 14:77891696-77891718 ATACCCTTCAGGAGAACAGCTGG + Intronic
1121514119 14:94537802-94537824 ATTCCCTTCCCCAGCACATGGGG + Intergenic
1122616672 14:103022652-103022674 ATACCCTGCCCCCTAACAGCTGG - Intronic
1122772594 14:104103972-104103994 ACACCCTTGTCCAGCACAGCAGG - Intronic
1124090819 15:26598578-26598600 CTCCCCTTCCCCAAGTCAGCAGG + Intronic
1124235381 15:27985161-27985183 ACACCCGTCCCCGGGAGAGCCGG + Exonic
1124983585 15:34584456-34584478 ACACACATCCCCAGGAGAGCCGG + Intronic
1127691915 15:61404915-61404937 ATAACTTTCCCGAGGGCAGCTGG + Intergenic
1128065026 15:64759169-64759191 CTCCCCTTCCCCAGGACCCCAGG - Intronic
1128090775 15:64917300-64917322 ACACCCTCCCCCAGGACAGCTGG - Intronic
1128212950 15:65915129-65915151 ATAACCTACCCAAGGACACCTGG + Intronic
1129227237 15:74177085-74177107 AAACCATCCCACAGGACAGCTGG + Intergenic
1129408025 15:75332207-75332229 ATACCTCTTCCCAGGGCAGCAGG + Intergenic
1130407518 15:83614879-83614901 CTACCCCTCCCCAGGACAAAGGG + Intronic
1132932488 16:2466034-2466056 CTTCCCTTCCCCAGGAAGGCAGG + Intergenic
1133025829 16:2988604-2988626 CTACCTTTCCCCAGGCCAGGAGG - Intergenic
1133282307 16:4673671-4673693 AGAACCTTCCACAGAACAGCCGG - Intronic
1135733511 16:24913323-24913345 ATACCCCTTCCCAGGAGGGCTGG - Intergenic
1140093516 16:71855925-71855947 CTTCCCTACCCCAGGAAAGCTGG - Exonic
1142068202 16:88074649-88074671 AGCCCCTTCCCCCAGACAGCTGG - Intronic
1142128472 16:88421587-88421609 TTCCTCTGCCCCAGGACAGCAGG - Intergenic
1142410545 16:89913748-89913770 GTACAGCTCCCCAGGACAGCTGG - Intronic
1144082906 17:11781005-11781027 AGAGGCTTCTCCAGGACAGCTGG - Exonic
1144104398 17:11972648-11972670 TGACCCTTCCCCAGAAAAGCGGG - Intergenic
1148454206 17:47802207-47802229 ACATCCCTCCCAAGGACAGCTGG - Intergenic
1148736139 17:49865920-49865942 ATGCCCTCCCCCAGGAATGCAGG - Intergenic
1149611714 17:57962310-57962332 GGATCCTTCCCCAGGACACCAGG - Intergenic
1151009195 17:70473422-70473444 ATTCCCATCCCCAGCAAAGCTGG + Intergenic
1152368156 17:79869362-79869384 AGGCCCTTCCCCAGGATAACAGG + Intergenic
1152725331 17:81942198-81942220 ACACCCCTCCCCCGCACAGCTGG - Intronic
1153691103 18:7594594-7594616 ATTTCCTTCTGCAGGACAGCAGG - Intronic
1153988905 18:10377701-10377723 ATACCCTTCCCCAGGAAGAAAGG - Intergenic
1154338864 18:13487230-13487252 CTGCTCTTCCCCAGCACAGCAGG - Intronic
1155920032 18:31594479-31594501 CTGCACTTCTCCAGGACAGCAGG - Intronic
1157734046 18:50030722-50030744 ACACCCCTCCCCAGGACCCCAGG + Intronic
1158693670 18:59683931-59683953 CCTCCCTTCCCTAGGACAGCAGG + Intronic
1160805217 19:989624-989646 CTGCCCTGCCCCAGGACTGCGGG - Intronic
1160918261 19:1507828-1507850 CCGCCCTTCCCCAGGACAGATGG - Intronic
1161626630 19:5330759-5330781 ATGCCCTTCCCCAGCAGGGCCGG + Intronic
1162420945 19:10565809-10565831 ATGCCCCCCCCCAGGTCAGCCGG + Intronic
1162576864 19:11504552-11504574 CACCCCTTTCCCAGGACAGCAGG - Intronic
1165702583 19:37949717-37949739 GTACCCTAGGCCAGGACAGCAGG - Intronic
1166375784 19:42326083-42326105 GTACCCTTCGCCGGGACTGCCGG + Intronic
1166805980 19:45487439-45487461 AGCCCCTTCTCCAGCACAGCTGG - Intronic
1167664211 19:50814046-50814068 AGTCCCTTCCTTAGGACAGCAGG - Intergenic
1168120193 19:54247684-54247706 CCTCCCTTCCCCAGCACAGCAGG + Intronic
1168121160 19:54253335-54253357 CCTCCCTTCCCCAGCACAGCAGG + Intronic
925829175 2:7877960-7877982 TTGCCCTTCCCCAGAAAAGCAGG + Intergenic
929113109 2:38421906-38421928 AGTCTCTTCCCCAGGACAGATGG + Intergenic
929598688 2:43191712-43191734 GTTCCCCTCTCCAGGACAGCTGG + Intergenic
930940099 2:57001878-57001900 AAACCTTTCCACAGGGCAGCAGG + Intergenic
932735214 2:74249640-74249662 CTGCCCTTCCCCAGCACAGCAGG - Intronic
933769268 2:85733020-85733042 ACACCCTTCCCCAGCACTCCTGG + Intergenic
933793505 2:85902396-85902418 CTCCCCTTCCCCAGGACTCCCGG + Intergenic
935255529 2:101307130-101307152 ATACCATTCCCTAGGGCAGCAGG - Intronic
936004336 2:108869359-108869381 ATTCCCTTCCTCAGGAGAGAAGG + Intronic
937301580 2:120846028-120846050 CTGCCTTTCCCCAGGTCAGCTGG + Intronic
938591126 2:132737148-132737170 ACACCAGTCCCCAGGACAACTGG + Intronic
938678053 2:133658502-133658524 ATGCCCACTCCCAGGACAGCAGG - Intergenic
941864210 2:170317149-170317171 ATAGCCTTCCCCAGGAAGGCTGG + Intronic
945288257 2:208103732-208103754 ATAACCCTTCCCAGGAGAGCTGG + Intergenic
948430379 2:237914836-237914858 GTAACCTTTCCCAGGACACCGGG + Intergenic
948545942 2:238728972-238728994 ATATCCTTCCCCAGAAGGGCTGG + Intergenic
949027191 2:241771850-241771872 CTCCCCTCCCCCAGGACGGCTGG + Intergenic
1169687311 20:8289732-8289754 ATACACTGCCCCAGGACACTCGG + Intronic
1172596922 20:36156013-36156035 ACACCCTTGCCCGGGACAGGAGG - Intronic
1173781412 20:45760213-45760235 TTACCCTTCCCCAGAAAAGCGGG - Intronic
1174436637 20:50511321-50511343 ATCCCCTTCTCTAAGACAGCCGG - Intronic
1175196183 20:57244791-57244813 CCTCCCTTCCCCAGGACAGGAGG + Intronic
1175423787 20:58852020-58852042 TAACCCTTCCCTAGAACAGCAGG + Intronic
1175810989 20:61857133-61857155 ATACCCCTCCCCGGGGCAGAGGG + Intronic
1176075335 20:63245653-63245675 ATTTCCATCCCCAGCACAGCTGG + Intronic
1176299977 21:5094911-5094933 AAACCCTTCCCCAGGGCTTCAGG - Intergenic
1177647944 21:23923191-23923213 ATACAGTTTCCCAGGCCAGCTGG + Intergenic
1178940717 21:36902752-36902774 AGCGCCTTCCCCAGGGCAGCTGG + Intronic
1178940792 21:36903404-36903426 ATCACTTTCCCCAGGGCAGCTGG + Intronic
1179579437 21:42331527-42331549 ATACCTTTCTCCAGGGCAGCAGG + Intergenic
1179857045 21:44167000-44167022 AAACCCTTCCCCAGGGCTTCAGG + Intergenic
1180988470 22:19919499-19919521 ACCTCCTTCCCCAGGACACCCGG + Intronic
1181588836 22:23870318-23870340 GTTCCCCTCCCCAGGACAGGGGG + Intronic
1182551838 22:31104850-31104872 ATGCCCGTCCCCGGGCCAGCAGG - Exonic
1183170459 22:36183841-36183863 AAACCCATCCCCAGGACTGTTGG + Intergenic
1185279776 22:49965102-49965124 TCACCCTTCCCCTGGAGAGCAGG + Intergenic
950023257 3:9803669-9803691 ACACCCTCCCCCAGAGCAGCTGG + Intronic
952229969 3:31419490-31419512 GTATCCTGCCTCAGGACAGCAGG + Intergenic
953407411 3:42666303-42666325 CTTCTCTCCCCCAGGACAGCAGG - Intergenic
955905289 3:63801075-63801097 TTTCCCTTCCCCAGGGCAGACGG - Intergenic
955936727 3:64109538-64109560 TTTCCCTTCCCCAGTGCAGCTGG - Intronic
958463611 3:94429945-94429967 GTTTGCTTCCCCAGGACAGCAGG + Intergenic
963521397 3:146362956-146362978 TTCCCCTTCCCCAGAAAAGCAGG - Intergenic
965713186 3:171577361-171577383 TGCCCCTTCCCCAGGAAAGCGGG - Intergenic
968059315 3:195714954-195714976 AGACTCATCCCCAGGACAGGTGG - Intergenic
969096112 4:4734106-4734128 AGTAGCTTCCCCAGGACAGCAGG - Intergenic
969116439 4:4873224-4873246 GGACCCTTTCCCAGCACAGCAGG - Intergenic
969147733 4:5138922-5138944 AAATCCTTCCCCAGGGCTGCAGG - Intronic
969611992 4:8232592-8232614 AAACCCTGCCCCAGGGAAGCAGG - Intronic
969854017 4:9984751-9984773 AGTCCCTTCCCCTGAACAGCTGG + Intronic
970816851 4:20166951-20166973 ATACCCTTTCTCAGGTCAGGAGG - Intergenic
974027885 4:56749920-56749942 ATCTACTTCCCCAGGACAGTGGG - Intergenic
975865345 4:78718800-78718822 TGCCCCTTCCCCAGGAAAGCAGG + Intergenic
976370460 4:84282343-84282365 ATGCCCTTCTGCAAGACAGCTGG + Intergenic
976649043 4:87415795-87415817 ATACACTGGCCCTGGACAGCTGG - Intergenic
977415050 4:96722074-96722096 ATACTCTGCCCCAGGATACCCGG - Intergenic
979578539 4:122325889-122325911 ATACCCTTCCCCAGGACAGCTGG - Intronic
979720832 4:123898509-123898531 ATACCTTTCCACAAGACAGTTGG - Intergenic
981423656 4:144579452-144579474 ATACCCTCCATCAGGACAGTTGG + Intergenic
982596295 4:157389088-157389110 ATAGGCTACCCCTGGACAGCTGG + Intergenic
984818271 4:183858061-183858083 ATAGGCCTCCCCAGCACAGCTGG + Intronic
985695720 5:1339044-1339066 AAAACCATGCCCAGGACAGCAGG + Intronic
986424252 5:7614624-7614646 ATTCACTTCCACAGGACAGCAGG - Intronic
987251893 5:16108627-16108649 CTCCCCTGCCCCAGGCCAGCTGG - Intronic
987498328 5:18673545-18673567 TTCCCCTGCCCCAGGAAAGCGGG + Intergenic
997951503 5:138246109-138246131 TAACTCTCCCCCAGGACAGCAGG + Intergenic
999429704 5:151515556-151515578 ATACCCTTCCCCAGGCCTGCTGG + Intronic
1000665306 5:163987738-163987760 ATACCTTTCCCAAGGTCAGATGG - Intergenic
1000722766 5:164729081-164729103 TTACCCAACCCAAGGACAGCAGG - Intergenic
1001287444 5:170434467-170434489 ATACCTCTCCCCAGGAGATCAGG + Intronic
1001721071 5:173857381-173857403 ATCCCCATCCCCTGGACATCTGG + Intergenic
1002189764 5:177472510-177472532 ATCCCCTCCCCCAGCTCAGCGGG + Intronic
1008642983 6:53483794-53483816 TTACCCATACCCAGGAGAGCAGG + Intergenic
1011836337 6:91435902-91435924 ATTACTTTCCCCAGGACAGTTGG - Intergenic
1016560575 6:145391781-145391803 TTACTCTTCCCCAGTGCAGCTGG - Intergenic
1018100910 6:160438832-160438854 AGACCCTTCCCCAGAACCTCTGG - Intronic
1019967836 7:4514555-4514577 GATCCCTTCCCCAGAACAGCTGG + Intergenic
1029990235 7:104956546-104956568 ATTCACTTCCCAAGGATAGCTGG - Intergenic
1031121246 7:117725124-117725146 ACACCCTAGCCAAGGACAGCAGG - Exonic
1032264852 7:130363519-130363541 CAACCCTGCCCCAGGACAGCAGG - Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1035335692 7:158126045-158126067 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335705 7:158126089-158126111 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335718 7:158126133-158126155 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335755 7:158126262-158126284 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335768 7:158126306-158126328 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335793 7:158126392-158126414 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335806 7:158126436-158126458 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335819 7:158126480-158126502 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335845 7:158126567-158126589 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035335871 7:158126654-158126676 ACACCAGCCCCCAGGACAGCGGG + Intronic
1035727519 8:1834002-1834024 TTACCCTTCCCCGGGAGGGCTGG - Intronic
1036256385 8:7209968-7209990 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036308435 8:7668553-7668575 ATGCACTTCCCCAGGTCAGCTGG + Intergenic
1036361100 8:8077524-8077546 ATGCACTTCCCCAGGTCAGCTGG - Intergenic
1036897475 8:12647638-12647660 CTGCACTTCCCCAGGTCAGCTGG + Intergenic
1039521818 8:38177496-38177518 CTTCCCTTCCCCGGGAGAGCCGG - Intronic
1041423323 8:57693483-57693505 ACCTCCTTCCACAGGACAGCTGG - Intergenic
1043800934 8:84608549-84608571 TTGCCCTTCCCCAGGGCTGCGGG + Intronic
1043972256 8:86544527-86544549 ATCCCCATCCCAAGGATAGCTGG + Intronic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1049710511 8:144060942-144060964 CTCCCCTTGCCCAGGACACCTGG - Intronic
1050722674 9:8608575-8608597 ATCCCCTGCTCCAGGGCAGCAGG + Intronic
1053188732 9:36041395-36041417 ATTCCCTTCCCCACTGCAGCAGG - Intronic
1054205805 9:62129390-62129412 ACACCCTTGCTCAGGACACCTGG + Intergenic
1057242541 9:93424003-93424025 ATACCCTTCCCCTCAACAACAGG + Intergenic
1060529268 9:124338959-124338981 ATCCCCTTCCCCTGGGCAGCTGG + Intronic
1061616688 9:131784935-131784957 TTTCCCTTCCCCAGGGCTGCCGG - Intergenic
1062490940 9:136804655-136804677 CTGCCCATCCCCATGACAGCTGG + Intronic
1203783186 EBV:112475-112497 ATATCCTCCCCCAGGACAACAGG - Intergenic
1186896565 X:14009734-14009756 AAACACTGCCCCAGGCCAGCAGG + Intronic
1188463608 X:30453930-30453952 TTGCCCTTCCCCAGAAAAGCGGG + Intergenic
1196572264 X:117280039-117280061 TTCCCCTTCCCCAGAAAAGCGGG - Intergenic
1200659374 Y:5942021-5942043 TGCCCCTTCCCCAGGAAAGCGGG - Intergenic