ID: 979580879

View in Genome Browser
Species Human (GRCh38)
Location 4:122358386-122358408
Sequence ATTTCAATGGGAAAAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979580872_979580879 4 Left 979580872 4:122358359-122358381 CCGTTTTAATATAAACTGTTATA 0: 1
1: 0
2: 4
3: 68
4: 681
Right 979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG 0: 1
1: 0
2: 5
3: 36
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979580879 Original CRISPR ATTTCAATGGGAAAAGGGGG TGG Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
903203975 1:21766600-21766622 CTTTGAATGGGAAAGGGGGTAGG + Intronic
903858403 1:26350882-26350904 AGGACAATGGGAAATGGGGGAGG - Intronic
904839975 1:33366274-33366296 ATTTCTATGGTAAAACAGGGTGG + Intronic
904912301 1:33944488-33944510 ATTTTAATGGGGAAGGGTGGAGG - Intronic
904967763 1:34391934-34391956 ACTTCAATGGGAAAGGGGAAAGG + Intergenic
906248411 1:44293197-44293219 ACTTCAATGGCAGAAAGGGGTGG + Intronic
907789523 1:57648319-57648341 AGTTCAATGAGAAATGGGGTTGG - Intronic
907933592 1:59022126-59022148 ATTTTAATTGGGAAAGGGGCTGG + Intergenic
909582949 1:77258691-77258713 TTTCCAAAGGGAAATGGGGGAGG + Intergenic
909866603 1:80681168-80681190 TTGTCAATGGGAAGAGGAGGGGG - Intergenic
909917360 1:81336817-81336839 ATTCGAGTGGGAAAACGGGGAGG - Intronic
910207771 1:84764959-84764981 AATTCAAGGGGCCAAGGGGGAGG - Intergenic
912635745 1:111290979-111291001 ATTGCAATGGGAAAGGGAGAAGG - Intronic
912770533 1:112460290-112460312 ATTTTGTTGGGAAGAGGGGGTGG + Exonic
913309505 1:117474263-117474285 ATGTAAATGGGAAAAGTAGGTGG - Intronic
915692269 1:157701433-157701455 ATTTTCATGGAAAAAGGGGGTGG - Intergenic
916271750 1:162950464-162950486 ATTCCAAAGGGAAAAGTGGCAGG + Intergenic
917118161 1:171623192-171623214 GTTTCAAAAAGAAAAGGGGGTGG + Intergenic
917178515 1:172265982-172266004 CTTTCTATAGGAAAAGGGGGAGG - Intronic
917332058 1:173891324-173891346 ATTGCAAAGGGAAAAGGTAGGGG - Exonic
918513447 1:185336569-185336591 ATTTGATTGGGAAGAGAGGGAGG + Intergenic
919519791 1:198573386-198573408 ATAAAAATGGGAAAACGGGGAGG + Intergenic
919550595 1:198981154-198981176 ATTTCTATGAGAAAGGGGGAGGG + Intergenic
920701935 1:208224510-208224532 GATTTAAAGGGAAAAGGGGGAGG + Intronic
921127632 1:212191339-212191361 ATTTCAATAGGAAAAAGGTTGGG + Intergenic
922031976 1:221810022-221810044 ATTCCCAAGGGGAAAGGGGGTGG + Intergenic
922380204 1:225015750-225015772 ATTGCAATGGGAAGAGGAGAAGG + Intronic
923456975 1:234173152-234173174 ATTTCACTAGGAACAGGTGGAGG + Intronic
923774007 1:236962034-236962056 GTTTCAAGGAGAAAAGGGGCAGG + Intergenic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1063807004 10:9656812-9656834 ACATTAATGGGAAAGGGGGGTGG - Intergenic
1064265051 10:13819357-13819379 ATTTAAATGGGAAGGGGGAGGGG - Intronic
1065023384 10:21518683-21518705 TTTCCAAAAGGAAAAGGGGGTGG - Exonic
1065916271 10:30356981-30357003 ATCTGAATGAGAAAAGGCGGTGG + Intronic
1066441280 10:35441461-35441483 TTTTCAATGGAAAAAGCGGTAGG + Intronic
1068303033 10:55170488-55170510 CCTTCATTCGGAAAAGGGGGTGG - Intronic
1068729786 10:60344027-60344049 ATGTGAAGGGGAAAAGGGAGAGG + Intronic
1069132946 10:64728911-64728933 ATTTCAATGGTCAGAGGTGGAGG + Intergenic
1069277615 10:66612284-66612306 AACTGAATGGGAAAAGGGAGAGG - Intronic
1071871314 10:89797664-89797686 ATTGCAATGGGAAAGGGAGAAGG - Intergenic
1071959046 10:90791072-90791094 ATTTCATTTTGAAAAGGGGCAGG + Intronic
1072195500 10:93114448-93114470 GTTTCAATGGGAGAAAGAGGAGG - Intergenic
1073271379 10:102267136-102267158 GTTTCATTTGGAAAATGGGGAGG + Intronic
1073820296 10:107254290-107254312 ATTTCATTTGAAAAAGAGGGTGG + Intergenic
1074105880 10:110389317-110389339 ATTTCCATGGCACACGGGGGTGG + Intergenic
1074425941 10:113351421-113351443 ATTTCAGAGGGAATTGGGGGAGG - Intergenic
1078225368 11:9386997-9387019 ATTTAAATGGAAGAAGGGAGAGG - Intronic
1078367563 11:10719357-10719379 ATTTCAATGAGTGAAGAGGGAGG - Intergenic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1080004393 11:27391261-27391283 TTTCCAATGGGAAAATGGGGGGG + Intronic
1080231382 11:30020279-30020301 ATTTAAATGGGCAAAGAGGTAGG - Intergenic
1080595080 11:33765804-33765826 AGATCAATAGGAAGAGGGGGAGG - Intronic
1081217997 11:40425850-40425872 ATTTAAATGAGACAAGTGGGTGG - Intronic
1081260794 11:40957903-40957925 ATTTGAATTGGAAAGGGGGGAGG - Intronic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1082032474 11:47615509-47615531 ATGTCACTGGCAAGAGGGGGAGG + Intergenic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1083144774 11:60750089-60750111 AATCCAGTGGGAAAAGGGAGAGG - Intergenic
1086153440 11:83639190-83639212 ATCTCACTTGGGAAAGGGGGAGG - Intronic
1086211838 11:84330140-84330162 ATTACAATGGAAATAGGGAGAGG - Intronic
1087517280 11:99180248-99180270 ATTGCAATGGGAAAGGGAGAAGG + Intronic
1091382707 12:72690-72712 ATTTCCATGGAAGAAAGGGGTGG + Intronic
1091562455 12:1625498-1625520 ATTTCCATGGGACAGGGGAGGGG - Intronic
1092125784 12:6074138-6074160 ATTTCATGGGGAAAAGGAGGAGG - Intronic
1092954025 12:13532764-13532786 ATTTCATAGGGAGAATGGGGAGG + Intergenic
1092979935 12:13784558-13784580 ATTTCAAGGGGGCAGGGGGGTGG - Intronic
1093010601 12:14102444-14102466 ACATCCATAGGAAAAGGGGGAGG + Intergenic
1093172661 12:15876478-15876500 ACATCCATAGGAAAAGGGGGAGG + Intronic
1093539120 12:20260060-20260082 ATTCCAATGGGCAATGGGTGAGG - Intergenic
1093959221 12:25253995-25254017 ATCACAATGGGAAAGGGGGGAGG + Intergenic
1095249753 12:39964510-39964532 AATGCTATGGGAAAAGGAGGAGG + Intronic
1096113699 12:49043017-49043039 TTTTCTATGGGAGAAGGAGGAGG - Intronic
1097295576 12:57958667-57958689 ACATCCATCGGAAAAGGGGGAGG + Intergenic
1098118841 12:67212830-67212852 AATTCAATGAGAAAAGGGTAGGG + Intergenic
1098282346 12:68874317-68874339 CTTTAAATGTGAAAAGGGGCTGG + Intronic
1098890633 12:76006786-76006808 ATTTGGATGGGACAAGGGGTGGG - Intergenic
1099472958 12:83074184-83074206 ACATCCATAGGAAAAGGGGGAGG - Intronic
1100707189 12:97213705-97213727 ATTTCACTGGGAAAAGGTACAGG + Intergenic
1101037845 12:100722532-100722554 ATGTCAAGGGGAAAAGAGAGGGG - Intronic
1101047418 12:100823406-100823428 ATTTAAATGACAAAAAGGGGTGG - Intronic
1101059711 12:100958322-100958344 AGTGAAATGGGAAAAGAGGGAGG - Intronic
1101062648 12:100988036-100988058 TTTTCAATGGGAAAAGGTGTAGG - Intronic
1101438313 12:104683083-104683105 GTTGAAATGGCAAAAGGGGGCGG + Intronic
1102999433 12:117374193-117374215 ATGTAAAAGGGAAAAGGGGCTGG + Intronic
1105427930 13:20311791-20311813 ATTTCTAAGGGAGGAGGGGGAGG - Intergenic
1106095953 13:26644049-26644071 CTTTAAATGGGAAAGGAGGGAGG + Intronic
1106168531 13:27270023-27270045 ATTAATATGGGAAAAGGGCGGGG - Intergenic
1106385174 13:29277638-29277660 ATGTCCAGGGGAAAAGGGAGTGG - Intronic
1107788757 13:43979885-43979907 ATGTAAAAGGGAAAAGAGGGGGG + Intergenic
1108916319 13:55617298-55617320 ATTGGAATGGGAAAAAGGGAAGG - Intergenic
1111445141 13:88338016-88338038 ATTTCTAGGGGAAATGGGGAGGG - Intergenic
1111847041 13:93524000-93524022 ATTTCAGTGGAAAGAGAGGGGGG + Intronic
1111984957 13:95056609-95056631 AATTCAAAGGGAAAAGAGGTAGG - Intronic
1112321058 13:98407982-98408004 ATCTCTAAGGGAAAAGGTGGAGG - Intronic
1112484083 13:99804037-99804059 ACTTCAAAGAGAAAAGGGAGTGG + Intronic
1113400631 13:109989428-109989450 ATTTGAATGGGCAAAGCCGGTGG + Intergenic
1114892737 14:26945661-26945683 TTTTCAGTGGAAAAAGGGGTAGG + Intergenic
1115049136 14:29035127-29035149 ATTTCAATGGGAAAATATGTTGG + Intergenic
1116407908 14:44587818-44587840 ATTGGAATGGGAAAAGGTGGTGG - Intergenic
1118166162 14:63338811-63338833 ATTTCAAGGGGAAAAGGGAAAGG + Intergenic
1118446294 14:65854060-65854082 ATTTCAAAGGGAAAAGAAGCTGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1120323945 14:83001943-83001965 ATTTCCATGGGCAAAGGATGAGG + Intergenic
1121169829 14:91844336-91844358 ACTTCAATAGGAAACGGGGGAGG + Intronic
1124960998 15:34394797-34394819 ATTTTAATTGGCAAAGGAGGCGG - Intronic
1124977628 15:34541018-34541040 ATTTTAATTGGCAAAGGAGGCGG - Intronic
1125802509 15:42462694-42462716 ATTTAGAGGGGAAAGGGGGGTGG + Intronic
1127899890 15:63333292-63333314 AAGACAATGGGAAAAGGGGCTGG - Intronic
1129448514 15:75635745-75635767 TTTTTAATGTGAAAAGGTGGGGG - Intergenic
1130406745 15:83609548-83609570 ATTTCAAGGGGCAAAGGGGATGG - Intronic
1130788596 15:87127177-87127199 ACTTCACTGGGAAAAGGAGTTGG + Intergenic
1131053077 15:89360674-89360696 AATTCAATAGGAAATGGGGGAGG + Intergenic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1131669525 15:94605255-94605277 ATTTCAATGAGAAAAAGTGGAGG - Intergenic
1131978935 15:97976600-97976622 AATTAAATGAGAAAATGGGGGGG + Intergenic
1136415037 16:30097682-30097704 CCTCCAATGGGAAAAGGGAGAGG + Intergenic
1136932608 16:34432688-34432710 TTCTCAATGGGAAGAGAGGGCGG - Intergenic
1136971964 16:34979126-34979148 TTCTCAATGGGAAGAGAGGGCGG + Intergenic
1137747938 16:50836909-50836931 ATTTCATCGGGAACAGGGGTTGG + Intergenic
1140517818 16:75556944-75556966 ATTGCAATGGGAAGAGGAGAAGG - Intergenic
1141123134 16:81377856-81377878 ATATCAAAAGGAAAAGGGAGTGG + Exonic
1141589056 16:85055702-85055724 ATTTCAAAAGGAGAAGGTGGCGG - Intronic
1146370314 17:32262059-32262081 AGTCCAGTGGGATAAGGGGGAGG - Intergenic
1146609379 17:34290870-34290892 ATTTGAATGGCACAAGGGGTGGG - Intergenic
1147038660 17:37700626-37700648 AGTTCACTGGGAAAAGGTGCTGG + Intronic
1148479915 17:47953292-47953314 GGGTCAGTGGGAAAAGGGGGTGG + Intronic
1148712897 17:49694820-49694842 AGGTCAATAGGAAAAGGGGTGGG - Intergenic
1152219081 17:79051048-79051070 ATTCCCATGGGAAAAGAGGCAGG + Intergenic
1153230809 18:2933808-2933830 AATTCAAAGGGAAAATGGTGCGG + Intronic
1156658234 18:39312985-39313007 ATTTAAATAAGAAAATGGGGAGG + Intergenic
1157466356 18:47949658-47949680 ATTTTAAAGGCAAATGGGGGAGG + Intergenic
1158233842 18:55290177-55290199 AATTCAAAGGGAAAAGGGTAGGG - Intronic
1158248477 18:55459049-55459071 CTTTCACTGGGAACAGTGGGTGG + Intronic
1158867982 18:61656493-61656515 AGTTAAATAGGAAAAGGGAGAGG + Intergenic
1159088557 18:63821247-63821269 TTTCCAATGGGAAATGGGGATGG + Intergenic
1159562051 18:70006561-70006583 ATTCTAATGGGAAAAGAGGGGGG - Intronic
1159989741 18:74890741-74890763 ATTTGAATGGGAAAAGAGAGAGG + Intronic
1160362999 18:78299857-78299879 ATTTTAATGGGAAAATGTTGGGG + Intergenic
1161681680 19:5682790-5682812 AAGTCAATGGGACAAGGGGAAGG - Intronic
1161741553 19:6024074-6024096 ATGTCTATGGGAAAATGGGCTGG - Intronic
1163748672 19:19062845-19062867 GTTTCATTTGGAAAAGAGGGGGG - Intergenic
1163888537 19:19990676-19990698 ATTGCAATGGGAAAGGGAGAAGG + Intergenic
1163934753 19:20432742-20432764 ATTGCAATGGGAATAGGAGAAGG - Intergenic
1163935810 19:20442078-20442100 ATTGCAATGGGAAGAGGAGAAGG + Intergenic
1164188849 19:22897041-22897063 ATTTTTATGGGAAAGGGGGAAGG + Intergenic
1164454033 19:28392173-28392195 AAGTCAAGGGGAACAGGGGGTGG + Intergenic
1164704144 19:30307244-30307266 ATATCAATCAAAAAAGGGGGGGG - Intronic
1165084057 19:33330365-33330387 AATTCAATGGGAAAAGGAGGGGG + Intergenic
1165114445 19:33520810-33520832 AGTTCAATGGGAGAAGGTGTGGG - Intronic
1165117916 19:33540126-33540148 ATTTTAAAGGGAAAAGGGGGTGG - Intergenic
1165898594 19:39157544-39157566 ACTTCAGTGGGAGAAGGTGGGGG - Intronic
1166823123 19:45592608-45592630 ATTTCAATGGGGGCAGGGGAGGG + Exonic
1167765113 19:51477466-51477488 TTTTCAATGGAAAAATGAGGAGG + Intergenic
926106077 2:10152242-10152264 TTTTAAATGGGCAAAGGGGCCGG - Intronic
926952469 2:18258190-18258212 ATTTTAATGGGAATATGAGGTGG + Intronic
927082310 2:19642652-19642674 CTTACAGTGAGAAAAGGGGGTGG + Intergenic
927234537 2:20858482-20858504 ATTCCAATGGTAAAAGTGAGAGG + Intergenic
927245277 2:20952432-20952454 ATTTCAAGGGGAAATGGAGGGGG + Intergenic
927267390 2:21165830-21165852 ATATCAATGAGGAAAGGAGGAGG - Intergenic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
929914376 2:46121978-46122000 ATCTCAATGGGAAAAAAGGAGGG - Intronic
930092467 2:47541154-47541176 AAATCAATTGGAAAAGGGTGAGG - Intronic
931020323 2:58037426-58037448 TTTTCTATGGGAAAGGGGGCAGG + Intronic
931895937 2:66729694-66729716 ATTCCAATGAGAAAAAAGGGAGG + Intergenic
932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG + Intronic
932217731 2:69977765-69977787 AGTTCAATGGGAAAGTTGGGTGG + Intergenic
932472917 2:71974529-71974551 ATTTAAATGGAAAAAGGGAATGG + Intergenic
938340631 2:130533759-130533781 ATTTCAACGGGTAGAGTGGGCGG - Intergenic
938349199 2:130586960-130586982 ATTTCAACGGGTAGAGTGGGCGG + Intergenic
938643483 2:133307586-133307608 ATTTCAATGGGCATTTGGGGTGG - Intronic
938873654 2:135509751-135509773 ATTTCAATGGTAAAAACGGTAGG + Intronic
938897511 2:135767006-135767028 AGTTTACTGGAAAAAGGGGGCGG - Intronic
938960338 2:136335132-136335154 ATGTCAATGGGAAACAGGGAGGG - Intergenic
939248497 2:139656261-139656283 ATTTCAATTGGAAAAACAGGAGG - Intergenic
942091410 2:172495108-172495130 AGTTCAATGAGAACAGTGGGTGG + Intronic
944099906 2:196013200-196013222 ATTTAAACAGGAAAAGAGGGAGG + Intronic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
944640630 2:201721530-201721552 GATTCAATGGGAAAAGGTGTTGG + Intronic
945743898 2:213697200-213697222 ATTTGAAAGGGAAGAGTGGGTGG + Intronic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
947757525 2:232578249-232578271 CTTGCAAAGTGAAAAGGGGGAGG - Intronic
947998644 2:234549113-234549135 ATTACAATCTGGAAAGGGGGCGG + Intergenic
1168968984 20:1917912-1917934 ATCTCAAAGGGAAAAAGGGAAGG + Intronic
1169621595 20:7512991-7513013 ATTATAATGGGAAGAGGAGGAGG + Intergenic
1173036180 20:39413356-39413378 ATGTCAAATGGAAAAAGGGGTGG + Intergenic
1173656579 20:44703995-44704017 TTTTCAATGGGAAGAGTGAGAGG - Intergenic
1176214078 20:63940050-63940072 AGTTCCCTGGAAAAAGGGGGGGG + Exonic
1176282479 20:64322066-64322088 ATTTCCATGGAAGAAAGGGGTGG - Intergenic
1181449073 22:23005118-23005140 ATATAAATGGGAAGAGTGGGCGG + Intergenic
1182212258 22:28686406-28686428 ATTTCCTTAGGAAATGGGGGTGG - Intergenic
1182598989 22:31444974-31444996 AGTACAATGGGAAAATGGAGGGG + Intronic
949338201 3:2999876-2999898 ATTTCAATAGGAAAAGTTTGAGG - Intronic
949478882 3:4474501-4474523 ATTTGAAAAAGAAAAGGGGGCGG - Intergenic
949510054 3:4759613-4759635 GTTTCAATGGCAAGAGGGAGGGG + Intronic
951597720 3:24336029-24336051 TTTCCAATGGGAAAAGGAGAGGG + Intronic
951995227 3:28720204-28720226 ATTTCAGAGGGCAAAGGGGATGG - Intergenic
952157267 3:30656822-30656844 ATTTCAATTGGAAAAGGGGTGGG - Intronic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
953349654 3:42205870-42205892 AGTTCTATGGGAAAAGGGCACGG - Intronic
953404897 3:42655169-42655191 ATTTCCAAGGGAAAGAGGGGAGG + Intronic
954922795 3:54206143-54206165 ACTTCATTGGGAAAGGGGAGTGG + Intronic
955805933 3:62734460-62734482 ACTTCAGAGGGAAAAGGAGGGGG - Intronic
956064013 3:65378044-65378066 AATACAATGGGAGAAGGGGAAGG - Intronic
956633538 3:71340138-71340160 ATGTCAGTGGGAAAATAGGGGGG - Intronic
958918027 3:100071502-100071524 ATTTACATGGGAGAAGGGTGGGG + Intronic
961565125 3:127758130-127758152 ATGACCAGGGGAAAAGGGGGTGG - Intronic
962838598 3:139213198-139213220 ATTGCAATGGGAAGAGGAGAAGG - Intronic
962959270 3:140294880-140294902 CTTTCATGGGGAGAAGGGGGTGG + Intronic
963124120 3:141799127-141799149 AATTCACTGGGATAAGGGGAAGG + Intronic
964779127 3:160315687-160315709 ATGGCAAAGGGAAAAGAGGGTGG - Intronic
965837710 3:172869543-172869565 ATTTCACTGGGAAAATGGAATGG + Intergenic
966202499 3:177371990-177372012 ACTTCAATAGGCAAAGGGGGTGG - Intergenic
970333885 4:15011624-15011646 ATTTTTTTGGGAAGAGGGGGTGG - Intronic
970608038 4:17700124-17700146 AATTAAACGGGAAAAGGGGGTGG + Intronic
970768080 4:19575609-19575631 ATTGAAAAGGGAAAAGGGGAAGG + Intergenic
970904003 4:21193969-21193991 TTTTCATTGTGTAAAGGGGGAGG + Intronic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
971483646 4:27137958-27137980 AGTTCCATGGGAAAAGGAAGTGG - Intergenic
971636575 4:29067869-29067891 ATTTCAATGGGACTTGGGGGAGG - Intergenic
971895220 4:32584500-32584522 ATTTTAATGTGAAAAAGGAGTGG - Intergenic
972731400 4:41798697-41798719 ATTTCAAGGGGGAAGGGGAGCGG - Intergenic
973668304 4:53186273-53186295 AATATAGTGGGAAAAGGGGGAGG - Intronic
973830387 4:54753445-54753467 ATTACAATGGGATCAGGGGTAGG + Intergenic
973830548 4:54754987-54755009 ATTGCAATGGGATCAGGGGTAGG + Intergenic
973857761 4:55030583-55030605 AGATATATGGGAAAAGGGGGAGG - Intergenic
974070409 4:57118315-57118337 ATTTCAATGGCTAAAGAGGTAGG - Intergenic
974274709 4:59703708-59703730 ATGGGAATGGGAGAAGGGGGAGG - Intergenic
974837059 4:67263965-67263987 ATTTCAATGAGAAATGGGGATGG + Intergenic
977126098 4:93170382-93170404 ATTACAATTAAAAAAGGGGGGGG - Intronic
977697478 4:99982218-99982240 GTGTCAATGGGAGAAGGGTGAGG - Intergenic
978093944 4:104752103-104752125 ATTTGAATGGGAGTGGGGGGTGG - Intergenic
978243389 4:106542994-106543016 CTTTCAGAGGGTAAAGGGGGTGG + Intergenic
978930585 4:114306609-114306631 ATTTAAGTGGGTAAAGGTGGGGG - Intergenic
979460165 4:120973331-120973353 ATTACCATGGAAAAAGAGGGGGG - Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980843149 4:138291191-138291213 CTTTCAATGGGAGAAGGGGGAGG - Intergenic
981220491 4:142227129-142227151 ATTACAAAGGGAAAATGGAGTGG + Intronic
981689716 4:147494342-147494364 AGTACAATGGGAAAAGAGAGTGG + Intronic
983103931 4:163661773-163661795 GTTGCAAGGGGAAAAGGGAGAGG - Intronic
984055612 4:174925696-174925718 ATTTCAAAGGGAAAAGGAAGTGG + Intronic
985632422 5:1020978-1021000 GTTTAAATGGGAAAACGTGGAGG - Intronic
986469338 5:8058781-8058803 AATTCCATGGGCAAAGGTGGAGG - Intergenic
986537494 5:8805919-8805941 ATATCCATGGGTAAAGTGGGAGG - Intergenic
986586033 5:9319569-9319591 ATGTAAATGGGAAGATGGGGCGG + Intronic
986710423 5:10484606-10484628 ATTTCCATGGGAAGAGGTGAGGG + Intergenic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
987240827 5:15996947-15996969 ACTACAATGGGAAAAAGGGCTGG - Intergenic
987577808 5:19752962-19752984 ACATCCATAGGAAAAGGGGGAGG + Intronic
988851785 5:35187806-35187828 ATTTCACTGGGTAAACAGGGAGG - Intronic
988852052 5:35189980-35190002 ATTTCACTGGGTAAACAGGGAGG - Intronic
989990600 5:50760341-50760363 ATTACAAAAGGAAAATGGGGAGG + Exonic
990014364 5:51041051-51041073 ATGTCACTGGGAGAAGGGGTGGG + Intergenic
991512923 5:67399682-67399704 ATTTCAATGGTGGAGGGGGGGGG + Intergenic
993025316 5:82638646-82638668 ATTGCAATGGGATAAGGGAAAGG - Intergenic
997290260 5:132727397-132727419 ATTGTAATGGGAAAAAGGAGAGG + Intronic
998508215 5:142689517-142689539 ATTTCAGTGGGATCAGGGTGAGG - Intronic
999901126 5:156088048-156088070 AGTTCTATGGGAAAGGGGGATGG - Intronic
1000418448 5:161009592-161009614 TTTTCAAAGGGAAAAGAGAGAGG + Intergenic
1001260529 5:170224758-170224780 ATTTAAAGGGGAAAATGGGTAGG - Intergenic
1003816498 6:9847272-9847294 ATCTCAATGGGAAACGGAAGAGG - Intronic
1005364613 6:25064496-25064518 ATTTCAAGGAGAAAAGGTTGAGG + Intergenic
1005564652 6:27078806-27078828 TGTGCACTGGGAAAAGGGGGTGG + Intergenic
1008387422 6:50908215-50908237 TTTTCAATGGGCAGAGGTGGAGG - Intergenic
1008723995 6:54393900-54393922 ATTTCAAAGGAAAAAAAGGGAGG + Intergenic
1008970026 6:57356698-57356720 AATTCAAAGGGTAAAAGGGGAGG + Intronic
1009439379 6:63658399-63658421 ATTTTAATGGGATTTGGGGGTGG + Intronic
1011175714 6:84558392-84558414 ATTTAAAAGTGAAAAGGAGGTGG - Intergenic
1011233412 6:85188406-85188428 ACGTCCATAGGAAAAGGGGGAGG + Intergenic
1011899979 6:92281230-92281252 ATTTCAGTTGGAAAAGGGTCAGG + Intergenic
1012303972 6:97627149-97627171 ATTTTAATTGGAAAAAGGGAAGG + Intergenic
1012307112 6:97672386-97672408 ATTGCAATGGAGAGAGGGGGAGG - Intergenic
1012550732 6:100463248-100463270 ATTTCAAAGGCAGAAGGGGCCGG - Intronic
1016440468 6:144078196-144078218 ATTGTAATGGGAAGAGGGGTAGG - Intergenic
1017156553 6:151327591-151327613 ATTCCTATGGTAAAAGGAGGTGG + Intronic
1017455628 6:154598584-154598606 ATTTCAATAGGAAGAGAGGAGGG - Intergenic
1018304881 6:162444552-162444574 ATTTCAATAGGAAGAGGAGAAGG - Intronic
1022451070 7:30515677-30515699 ATCTCAAAGGGCAAAGAGGGAGG - Intronic
1023030125 7:36083907-36083929 AATTCCCTGGGAAAAGGGTGAGG - Intronic
1023274528 7:38503475-38503497 ATTTCAATGGGAATTTGGGGCGG + Intronic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023656399 7:42426058-42426080 CTTCCAGTGGGAAAAGGGGTGGG - Intergenic
1024387939 7:48774884-48774906 ATTCCCTTGGGAAATGGGGGTGG - Intergenic
1025080801 7:55980802-55980824 AATTCAATGGGCCAAGGGGATGG - Intronic
1027185320 7:75967651-75967673 TTTTTAATGGGAAACGGGGAGGG + Intronic
1027515908 7:79141359-79141381 ATTTGAAAGGGAAAACTGGGAGG - Intronic
1027658630 7:80962288-80962310 ATAACAATGTGAAGAGGGGGTGG + Intergenic
1029181883 7:98708154-98708176 TTTTTAATGGGCAAAGGGGCCGG + Intergenic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030189203 7:106793966-106793988 ATTTTAAAGGGAAAATGGTGGGG + Intergenic
1030609993 7:111678975-111678997 ATTTAAAGGGGAAAAGTGGGTGG + Intergenic
1031845461 7:126800395-126800417 ATTTAAATGGGAAAAATGGGGGG - Intronic
1032631598 7:133659037-133659059 ATATAAATGGGAAAAGGGGCTGG + Intronic
1032780419 7:135161365-135161387 ATTCAAATGGGAAAAGTGAGAGG + Intronic
1033772118 7:144564263-144564285 ATTTCAATGGCAAATGGCGAAGG + Intronic
1034287536 7:149897988-149898010 GTTGCAATGAGAAAAGGAGGTGG - Intergenic
1034663591 7:152794919-152794941 GTTGCAATGAGAAAAGGAGGTGG + Intronic
1035154234 7:156899175-156899197 AATTCAGTGGGGAAGGGGGGTGG - Intergenic
1035552843 8:543909-543931 ACTGCAATGGAAAAAGGGAGGGG + Intronic
1035787343 8:2272102-2272124 ATTTCCATGGGAAGTGGAGGAGG + Intergenic
1035805464 8:2449614-2449636 ATTTCCATGGGAAGTGGAGGAGG - Intergenic
1037496983 8:19450031-19450053 GTTTCAAGGGCAAAATGGGGTGG + Intronic
1038247028 8:25867982-25868004 ATTTCAGTGGGCAGAGGGGGAGG - Intronic
1038304922 8:26391288-26391310 ATGGCAATGGGAAAAATGGGGGG + Exonic
1039131000 8:34263982-34264004 CTTAGAATGGGAAAAGGGAGTGG + Intergenic
1039290476 8:36089079-36089101 ATTTTTATGGGTAAAGGGTGGGG + Intergenic
1039356240 8:36819830-36819852 ATTTAAATGGGAGAAGGGGCAGG - Intronic
1039501242 8:38019172-38019194 ATTTAAAGGGGAAAAGCAGGTGG - Intergenic
1040006369 8:42624599-42624621 ATTTTAAAGGGAAAAGGGTGTGG - Intergenic
1044116270 8:88338420-88338442 ACTACAAAGGGAAAAGGAGGAGG - Intergenic
1044516405 8:93143770-93143792 ATTTCAAAGGGAAAAGGTTCAGG + Intronic
1046716154 8:117569706-117569728 ATTTCAGTGGCAAATTGGGGTGG + Intergenic
1047185382 8:122628363-122628385 ATTGCAAAGGCAAATGGGGGAGG + Intergenic
1048519652 8:135141836-135141858 TTTTCAAAGGGAAAACAGGGTGG + Intergenic
1048803734 8:138219732-138219754 AATGCAATAGGAAATGGGGGAGG - Intronic
1049639558 8:143708663-143708685 ATTTCACTCGGGAAACGGGGGGG - Intronic
1050429125 9:5543861-5543883 ATTTCAATGGGGTGGGGGGGAGG + Intronic
1051504006 9:17808188-17808210 ATTTTTAAGAGAAAAGGGGGAGG - Intergenic
1051648594 9:19296224-19296246 TTTTCAATGGGAAGAGGATGTGG - Exonic
1053215306 9:36265689-36265711 TTTTCCATGGGAAGTGGGGGTGG + Intronic
1055750663 9:79501172-79501194 CTTTCAGAGAGAAAAGGGGGAGG + Intergenic
1056132506 9:83600194-83600216 ATTTCCATGGGAAAGGAGGCTGG + Intergenic
1056700308 9:88899399-88899421 AATTCAATGGGAAAAGGATATGG - Intergenic
1057272213 9:93657662-93657684 TCTTCAATGGGAAGAGGGAGGGG + Intronic
1057731295 9:97611139-97611161 ATTTAAAGGGGAAAGGGGGCAGG + Intronic
1058122755 9:101156757-101156779 ATGTCAATGGGAAGAGGAGAGGG + Intronic
1059612209 9:115910823-115910845 ATTTCAATTTTAAAAGAGGGAGG - Intergenic
1060861480 9:126958196-126958218 ATTTCAAGGGGAATGGGGGAGGG + Intronic
1185775444 X:2799419-2799441 ATTTAAAGGGGAAAGGGTGGGGG + Intronic
1186732791 X:12428165-12428187 ATTAAAATGGAAAAATGGGGAGG - Intronic
1187699113 X:21947687-21947709 TTTTAAATGGGAAAAGGGACAGG - Intronic
1189081631 X:37979210-37979232 ATTTAAACGGGAAAAGTGGGCGG + Intronic
1189532242 X:41897660-41897682 TTTTCAATGGGAAAATGGGAAGG - Intronic
1189603260 X:42649263-42649285 ACATCCATAGGAAAAGGGGGAGG + Intergenic
1190074055 X:47302698-47302720 ATTTAAAGTGGAAAAGGGGGCGG - Intergenic
1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG + Exonic
1193578603 X:83233293-83233315 ACATCCATAGGAAAAGGGGGGGG + Intergenic
1195580738 X:106498565-106498587 AATTCAATGGGAGAAAAGGGTGG - Intergenic
1202244525 Y:22805331-22805353 TGTGCAATGGGAAAAGGAGGTGG - Intergenic
1202397514 Y:24439077-24439099 TGTGCAATGGGAAAAGGAGGTGG - Intergenic
1202473267 Y:25231010-25231032 TGTGCAATGGGAAAAGGAGGTGG + Intergenic