ID: 979582768

View in Genome Browser
Species Human (GRCh38)
Location 4:122379544-122379566
Sequence GCTTCAGGCCGCTCTGCGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979582768_979582777 9 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582777 4:122379576-122379598 AGGCTGGGAGGTGGGAGCAACGG 0: 1
1: 1
2: 10
3: 168
4: 1089
979582768_979582775 0 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582775 4:122379567-122379589 GAGAGGTTGAGGCTGGGAGGTGG 0: 1
1: 0
2: 9
3: 270
4: 2894
979582768_979582774 -3 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582774 4:122379564-122379586 AGCGAGAGGTTGAGGCTGGGAGG 0: 1
1: 0
2: 6
3: 46
4: 385
979582768_979582779 15 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582779 4:122379582-122379604 GGAGGTGGGAGCAACGGCGGCGG 0: 1
1: 0
2: 1
3: 38
4: 492
979582768_979582772 -7 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582772 4:122379560-122379582 CTGAAGCGAGAGGTTGAGGCTGG 0: 1
1: 0
2: 2
3: 33
4: 358
979582768_979582778 12 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582778 4:122379579-122379601 CTGGGAGGTGGGAGCAACGGCGG 0: 1
1: 0
2: 3
3: 48
4: 502
979582768_979582780 18 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582780 4:122379585-122379607 GGTGGGAGCAACGGCGGCGGCGG 0: 1
1: 2
2: 2
3: 57
4: 691
979582768_979582776 1 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582776 4:122379568-122379590 AGAGGTTGAGGCTGGGAGGTGGG 0: 1
1: 0
2: 6
3: 102
4: 1134
979582768_979582773 -6 Left 979582768 4:122379544-122379566 CCTCGCGCAGAGCGGCCTGAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 979582773 4:122379561-122379583 TGAAGCGAGAGGTTGAGGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979582768 Original CRISPR GCTTCAGGCCGCTCTGCGCG AGG (reversed) Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
904388210 1:30161463-30161485 GCTCCTGGCCGCTCTCCCCGTGG + Intergenic
904701684 1:32361864-32361886 GCCCCGGGGCGCTCTGCGCGGGG + Exonic
906290710 1:44617697-44617719 GTTTCAGGCCCCTCTGCTCAGGG - Intronic
914827410 1:151145859-151145881 CCTTCAGCCCGCTCGGCCCGGGG - Intronic
922612395 1:226940188-226940210 GCCGAATGCCGCTCTGCGCGTGG - Intronic
1062899020 10:1127766-1127788 GCTCCAGGACGCTCAGCACGGGG - Intronic
1070594715 10:77824504-77824526 GCCTGAGGCCGCTCTGCCTGTGG - Intronic
1075555382 10:123427160-123427182 GCTTCAGCCCTCTTTGGGCGAGG - Intergenic
1077014642 11:394167-394189 TCTTCAGGCGGCTCTGGGTGAGG + Intronic
1083891807 11:65599378-65599400 GCTTCAGGCCACTCACCGCGGGG + Exonic
1088918087 11:114242210-114242232 GCTGCAGTGCGCTCTGCGCCTGG - Exonic
1089615255 11:119691464-119691486 GCTGAAGGCTGCTCTGCGGGTGG + Intronic
1096585167 12:52615177-52615199 GCTCCAGGCCCTTCTGCGGGGGG + Intronic
1097261753 12:57724479-57724501 GCTTCAGGCCGCTGTGGCCTTGG + Intronic
1098416668 12:70243035-70243057 GCTTCAGTCCGCCCTCCCCGGGG - Exonic
1108662653 13:52600487-52600509 TCTGCAGGCAGCGCTGCGCGGGG - Intergenic
1114035896 14:18626926-18626948 GGCTCAGGCTGCGCTGCGCGCGG - Intergenic
1114354699 14:21894512-21894534 GCTTCTGTCCGCTCTGCTCAGGG + Intergenic
1117252945 14:53953739-53953761 GCTTCAGGTGGCCCGGCGCGGGG - Intronic
1122688672 14:103521629-103521651 GCCCCAGGCCGCTGTGGGCGCGG + Intronic
1122883779 14:104701569-104701591 GGTCCAGGCCGCTCTGCTCCAGG - Exonic
1122959246 14:105087107-105087129 GGTGCAGTCAGCTCTGCGCGGGG + Intergenic
1123112245 14:105878405-105878427 GCTGCAGGCAGCTCTGGGGGTGG - Intergenic
1132606153 16:794575-794597 GCTTCCTGCCGCCCTGCCCGCGG + Intronic
1137036732 16:35574860-35574882 ACTTCAGACAGCTCAGCGCGGGG + Intergenic
1138560610 16:57798703-57798725 GCTTCAGGCTGCTCTGCCTAAGG + Intronic
1141479757 16:84298643-84298665 GCTACAGGCAGCCCTGCGCTTGG - Intronic
1141955090 16:87365475-87365497 GAGCCAGGCCGCTCTGGGCGTGG + Intronic
1142587030 17:979997-980019 GCTGCCGGCCGCGGTGCGCGGGG + Intergenic
1151516128 17:74597176-74597198 GCATCAGGCCGCTCTGCAGTGGG + Intergenic
1152815293 17:82404271-82404293 GCCTCTGGCTGCTCTGTGCGTGG - Intronic
1154025531 18:10704342-10704364 GCTTCAGGCGGCTATGCAAGGGG - Intronic
1155074949 18:22346503-22346525 GCTTCAAGCTGCTCTGAGCAAGG - Intergenic
1161960350 19:7519752-7519774 GCTTCTCGCCGCTGTGCGTGCGG - Exonic
1168257593 19:55175174-55175196 GCTGCAGGCGGCTCCGCGGGAGG - Exonic
925079846 2:1055277-1055299 GCTTGGGGCCGCTCTGCTCGGGG + Intronic
932385885 2:71332144-71332166 GCGTCAGGCAGCTCTTCTCGAGG - Intronic
935123286 2:100200257-100200279 GGTTCAGGCTGCTCTCCGCTGGG - Intergenic
942043502 2:172085962-172085984 CCTCCAGGCGGCTCTGGGCGAGG - Exonic
1168897822 20:1336064-1336086 GCTTCATGTCTCTCTGCGCTGGG - Intronic
1170737070 20:19021749-19021771 GCTTCAGGCCACTCTCAGCAAGG + Intergenic
1175367720 20:58467228-58467250 GCTGCAGGCGGCGCTGCACGCGG + Exonic
1177795891 21:25778449-25778471 GCGGCAGGCCGCTCTGAGTGCGG - Intergenic
1183939705 22:41286369-41286391 GGTGGAGGACGCTCTGCGCGCGG - Intergenic
1184378805 22:44132158-44132180 GCTTCAGGGCTCTCTGTGCTGGG + Intronic
961831791 3:129626872-129626894 GCTTCCGGCCTCTCTCTGCGGGG - Intergenic
962613479 3:137101446-137101468 GCTACAGGCTGCTCTGCCTGTGG - Intergenic
968441437 4:626471-626493 GCTTCAGGGCTCTCTGGGCTGGG + Intronic
968571920 4:1346640-1346662 GGTTCAGGGCGCCCTGCGCGGGG + Intergenic
968750187 4:2384832-2384854 GCTTCAGCCCACTCTGCACAAGG + Intronic
969412940 4:7041867-7041889 GCGCCAGGCTGCTCTGCGAGAGG - Exonic
977576791 4:98683497-98683519 GCTTCAGGCCGCTCTCATGGTGG - Intergenic
979582768 4:122379544-122379566 GCTTCAGGCCGCTCTGCGCGAGG - Intronic
986091428 5:4512223-4512245 GCTCCAGGCCTCTCTCCGGGAGG + Intergenic
988117959 5:26920620-26920642 GCTGCAGGCAGCTCAGCGCAGGG + Intronic
996259250 5:121445779-121445801 GCTTCAGGCTGCACTGCCTGAGG - Intergenic
1002526439 5:179818361-179818383 GATTCAGGCCGCACTGCTCTGGG - Intronic
1006096680 6:31660673-31660695 GCGTCCGGGCGCTGTGCGCGGGG + Exonic
1006944677 6:37777560-37777582 GCTTCAGGCCCCGCTGCTTGTGG - Intergenic
1007821522 6:44563808-44563830 GCTTGAGTCCGCTCTGCTCAGGG - Intergenic
1019195561 6:170280439-170280461 GCTTCCGGCTGCTCTTAGCGTGG - Intergenic
1019312045 7:367621-367643 GCCTCAGGCCGCTGTGCCCACGG + Intergenic
1021510272 7:21427138-21427160 GCTCCAAGCCGCTCCCCGCGGGG - Intergenic
1029453818 7:100657048-100657070 TCTTCAGGCTGCTCTGAGCCCGG + Intergenic
1035305357 7:157928299-157928321 GCATCAGGCCTCTCTGCTCTTGG + Intronic
1035761240 8:2070357-2070379 GCTGCTGGCCGCTGTGGGCGTGG + Intronic
1052242390 9:26290153-26290175 GCTTCAGGCAGCTCTGATCTTGG - Intergenic
1057054282 9:91949396-91949418 GCATCAGGCCGCCCTGGGGGTGG + Intronic
1061455423 9:130693953-130693975 GCTTCAGGGCTCTCTGCACGTGG + Intronic
1062336801 9:136074842-136074864 GCTTCCTGCCGCTCTGTGTGAGG - Intronic
1062537673 9:137028016-137028038 GCCTCTGGCCGCGGTGCGCGCGG + Intronic
1062638899 9:137506676-137506698 GCTTCATCCCGCTCAGCCCGAGG - Intronic
1185691113 X:2155954-2155976 GCTTCTGGACGCTCTACGGGAGG + Intergenic
1196083151 X:111655081-111655103 GCTCCAGGCCGCCCTCCCCGGGG + Intergenic