ID: 979582788

View in Genome Browser
Species Human (GRCh38)
Location 4:122379622-122379644
Sequence GCTGCTGCTGCGCCTCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 502}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979582788_979582801 26 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582801 4:122379671-122379693 GAAGGACAACTTTGGTGGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 192
979582788_979582794 4 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582794 4:122379649-122379671 CGTCTTCCCACATAGAGGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 77
979582788_979582791 0 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582791 4:122379645-122379667 TGCCCGTCTTCCCACATAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 97
979582788_979582799 21 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582799 4:122379666-122379688 GGCAGGAAGGACAACTTTGGTGG 0: 1
1: 1
2: 4
3: 15
4: 271
979582788_979582795 8 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582795 4:122379653-122379675 TTCCCACATAGAGGGCAGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 231
979582788_979582790 -1 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582790 4:122379644-122379666 CTGCCCGTCTTCCCACATAGAGG 0: 1
1: 0
2: 1
3: 5
4: 82
979582788_979582798 18 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582798 4:122379663-122379685 GAGGGCAGGAAGGACAACTTTGG 0: 1
1: 0
2: 1
3: 45
4: 331
979582788_979582803 28 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582803 4:122379673-122379695 AGGACAACTTTGGTGGGTAGGGG 0: 1
1: 0
2: 1
3: 19
4: 223
979582788_979582800 22 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582800 4:122379667-122379689 GCAGGAAGGACAACTTTGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 179
979582788_979582802 27 Left 979582788 4:122379622-122379644 CCGGCCTGAGGCGCAGCAGCAGC 0: 1
1: 0
2: 3
3: 52
4: 502
Right 979582802 4:122379672-122379694 AAGGACAACTTTGGTGGGTAGGG 0: 1
1: 0
2: 2
3: 25
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979582788 Original CRISPR GCTGCTGCTGCGCCTCAGGC CGG (reversed) Intronic
900093195 1:929480-929502 GCTGCAGCTGCCCCTGAGCCGGG + Intronic
900205834 1:1431519-1431541 GCTGCTCCTGGCCCTCAGGCTGG - Intergenic
900590634 1:3457927-3457949 CCTGCTGCTTCTCCTCAGGGTGG - Intronic
901297137 1:8169358-8169380 GCTGTTGTTGCGGCCCAGGCTGG - Intergenic
901781808 1:11599195-11599217 GCTGCTGCCACCCCTCAGGGTGG + Intergenic
902187323 1:14735169-14735191 GCTGCTCCTGAGGCTGAGGCAGG - Intronic
902333952 1:15744279-15744301 CCTGCTGCTGAGCCTCGGGCTGG + Exonic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
902429550 1:16352443-16352465 GCAGCTGCTGCTGCTCAGGCCGG + Exonic
902586226 1:17439898-17439920 GCTGCTCCTGCGCCTTTCGCGGG + Intergenic
902795859 1:18800009-18800031 GGTGCTGCTGTGCCTGGGGCTGG + Intergenic
903189532 1:21649025-21649047 GCTGCTGCTTCACCTCCAGCAGG - Intronic
903542940 1:24107096-24107118 CCGGCTGCTGCGCCAGAGGCGGG - Exonic
904236653 1:29121471-29121493 GCGGCTGCGGCTCCTCGGGCCGG - Exonic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904882670 1:33712474-33712496 CCTGCTGCCGAGGCTCAGGCTGG - Intronic
905463896 1:38138758-38138780 GCTGCCTCTGCCACTCAGGCCGG - Intergenic
905534399 1:38708956-38708978 GCTGCTGCTGCTGCTCAGCGCGG + Intergenic
905848506 1:41255532-41255554 GGAGCTGCTGTGGCTCAGGCTGG - Intergenic
905876079 1:41432888-41432910 GCTGCTGCAGCGCCCCCTGCTGG + Intergenic
905990631 1:42334810-42334832 GCTGCTGCTGCCCCTCAGCTGGG - Intronic
907394027 1:54177245-54177267 GCTGCAGCTGTGGCCCAGGCAGG + Intronic
908718060 1:67091076-67091098 GCTGCTGCTGCTCTCCAGCCTGG + Intergenic
909489230 1:76207979-76208001 TCTGCTGCTGTGCTTCAGGGGGG + Intronic
910005221 1:82388242-82388264 GCTGCAGCTGCGTCTAAGGAAGG - Intergenic
910254626 1:85235545-85235567 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
912527472 1:110294494-110294516 CCTGATGCTGTCCCTCAGGCAGG - Intergenic
912574682 1:110657156-110657178 GCTACTGCTGAGGCTGAGGCAGG - Intergenic
912793390 1:112674886-112674908 GCGGCGGCTGCGGCCCAGGCAGG - Exonic
912993498 1:114511145-114511167 GCTGCGGCTGCGGCTGGGGCTGG - Exonic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
914879526 1:151536816-151536838 GCTGCTCCTCCACCTCACGCTGG - Exonic
914993111 1:152515493-152515515 CCTCCTGCTGCGGCTCCGGCAGG + Exonic
915244160 1:154544407-154544429 GCTGCTCCTCCGCCTGAGCCAGG - Exonic
915336688 1:155147493-155147515 GCTACTCCAGCGCCTGAGGCAGG + Intergenic
916056022 1:161069442-161069464 ACTGCTTCTGCCCTTCAGGCTGG + Intronic
918082450 1:181218030-181218052 TCTGCTGCTGCTCCTCATACAGG - Intergenic
919712156 1:200739213-200739235 TCCGCTGCTGCGTCTCCGGCGGG + Intergenic
920079234 1:203360327-203360349 GCTCCTGGTGGCCCTCAGGCAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921188403 1:212689207-212689229 GGTGCTGTGGCGCATCAGGCAGG - Intronic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921217548 1:212950653-212950675 GCTGCTGCTGGGCCTGGGGCTGG - Exonic
921909066 1:220528217-220528239 GCCGCCGCCGCGCCTCAGTCAGG - Intronic
922200192 1:223394384-223394406 GCTGCTGCTGCGGCAGAGCCAGG + Exonic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
923460450 1:234205583-234205605 GCTGTTTCTGCCCCTCAGACTGG - Intronic
924527423 1:244864380-244864402 GCTGCGGCTGCTCCTCGGCCCGG + Exonic
924795833 1:247291616-247291638 GCTGCAGCAGAGGCTCAGGCAGG - Intergenic
1064444137 10:15378775-15378797 GCTGCTCCTGTGCCCCAGTCAGG + Intergenic
1065140532 10:22714655-22714677 GCGGCTGCGGCGCCGCGGGCGGG + Intergenic
1066374588 10:34846196-34846218 GGTGCTGCTGCACTTCAGCCTGG - Intergenic
1067098198 10:43316049-43316071 GCTGGTGCTGCGCCTTTGTCAGG + Intergenic
1067522228 10:47016617-47016639 ACTGCGGCTGGGACTCAGGCAGG + Intergenic
1067753322 10:48985896-48985918 CCTGCTTCTGGGCCCCAGGCAGG - Intergenic
1070801845 10:79248501-79248523 GCTGCTGCTGAGTAGCAGGCAGG + Intronic
1071857870 10:89644681-89644703 GCTGCGGCTGCAGCTCCGGCAGG + Exonic
1072102321 10:92240293-92240315 GCTGCTGCTGGGGCTGGGGCTGG + Exonic
1072961543 10:99933846-99933868 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1073008557 10:100342611-100342633 GCTCCTCCTGGGCCCCAGGCTGG - Intergenic
1073214500 10:101829137-101829159 GCTGCTCCAGACCCTCAGGCCGG + Exonic
1075099465 10:119496017-119496039 GCTACTGGGGAGCCTCAGGCAGG - Intergenic
1075483414 10:122800469-122800491 GCTGCTGCTGGGACCCAGGTGGG - Intergenic
1075815827 10:125264231-125264253 GCAGCTGCTGGGACGCAGGCTGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076217728 10:128710112-128710134 GCTGCTGCTCCGTGTCGGGCCGG + Intergenic
1076587767 10:131560949-131560971 GCTGATGCTGAGGCTGAGGCTGG + Intergenic
1076917319 10:133430750-133430772 GGGGCTGCGGAGCCTCAGGCTGG + Intergenic
1076937416 10:133575509-133575531 GGGGCTGCGGAGCCTCAGGCTGG + Intergenic
1077184248 11:1229278-1229300 GCTGCTTCTGCCCCCCAGGCAGG + Exonic
1077237305 11:1487933-1487955 GCTGCTGCTGCTGCTTAGGGAGG - Intronic
1077301096 11:1847297-1847319 TCTGCGGCTGCCCCTCCGGCAGG + Intergenic
1077360114 11:2137122-2137144 CCTGCTGCCCTGCCTCAGGCTGG + Intronic
1077469158 11:2748703-2748725 GCTGCTGCTGCCCCTCCCTCTGG + Intronic
1077877540 11:6320559-6320581 GCTCCAGCTGTGACTCAGGCAGG + Exonic
1078192374 11:9101996-9102018 GCTGCTCCTGCCCCTTAGGTTGG - Intronic
1080208391 11:29756710-29756732 TCTGCTGCTGCGACTCAGCTAGG - Intergenic
1080541319 11:33268097-33268119 GCTGCTCCGGAGCCTGAGGCAGG + Intronic
1082076765 11:47980987-47981009 GCTGCTGCTGCGCCTGGGCCAGG + Exonic
1082177886 11:49082728-49082750 GCTTCTGCAGCTCCTCAGCCTGG - Intergenic
1082784300 11:57308562-57308584 GCTGCCATTGTGCCTCAGGCCGG + Exonic
1083151474 11:60794356-60794378 GTTGCTGCTTGACCTCAGGCAGG - Intronic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083417681 11:62536050-62536072 GCTGCTGCTGCCCAACTGGCAGG - Exonic
1083540926 11:63511084-63511106 CCTGCTGATGAGCCCCAGGCTGG + Exonic
1083871276 11:65489895-65489917 GCTGCTGCTGCTGTTCAGGAAGG - Intergenic
1083892144 11:65600814-65600836 CCTGCTGCTGCACTCCAGGCAGG - Intronic
1084004772 11:66317006-66317028 GATGCTGCTGCGCCTGTTGCTGG - Exonic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084191695 11:67502340-67502362 GCTGCTGCCCCCCATCAGGCAGG + Exonic
1084514499 11:69629145-69629167 GCTACTGCTGTGGCTCAGCCTGG + Intergenic
1085186204 11:74578141-74578163 GCTGCTGCTTCTCATCTGGCTGG - Intronic
1085252153 11:75150997-75151019 GCTGAGGCTGAGCCTCAGGGAGG + Exonic
1085274434 11:75289345-75289367 GCTGCCGCTGCCCACCAGGCTGG + Intronic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1085410471 11:76287704-76287726 GCTGTTGCTGCCCCTCAGGCAGG + Intergenic
1085688384 11:78646434-78646456 GCTGCTGCTGTGCCTGAGGTTGG - Intergenic
1086455329 11:86954986-86955008 GTTGCTGCTGCTCCTGGGGCCGG - Exonic
1086718019 11:90086762-90086784 GCTTCTGCAGCTCCTCAGCCTGG - Intergenic
1088173177 11:107019142-107019164 ACTGTTGCTGAGCCTCAGCCGGG + Intergenic
1089813972 11:121156216-121156238 CCTGCTGCTGCACTTCAGCCTGG - Intronic
1090205254 11:124880271-124880293 GCTGCTCCTCAGCCCCAGGCTGG + Intronic
1090699381 11:129279910-129279932 GCTGCTGCTGCGGCGGCGGCCGG - Intergenic
1092570377 12:9715059-9715081 GCTGCAGCTCCTCCTCATGCAGG + Intergenic
1093107457 12:15105902-15105924 GCTACTGCTGAGGCTGAGGCAGG - Intergenic
1093548014 12:20369893-20369915 GCTGGTGCTGAGGCTGAGGCTGG + Exonic
1093763840 12:22939979-22940001 GCTGCTGCTGCACTCCAGCCTGG - Intergenic
1095812175 12:46383235-46383257 CCCGCTGCAGCGCCCCAGGCTGG - Intergenic
1096094494 12:48925368-48925390 GCTGCTGCTGCTGCTCAGTGCGG - Exonic
1096579119 12:52573193-52573215 GGTGCAGCTGGGCCTCAGGAAGG - Intronic
1097457007 12:59812172-59812194 GCCGCTGCTGCTCCCCGGGCTGG + Intergenic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1098473713 12:70874808-70874830 GCTGCTCCAGAGCCTGAGGCAGG + Intronic
1098543592 12:71686389-71686411 GCCGCTTCAGCGCCTCACGCCGG - Exonic
1100165881 12:91917013-91917035 GCTGCTACCTCCCCTCAGGCTGG - Intergenic
1102418844 12:112788041-112788063 CCTGCTGCAGTGCCACAGGCTGG + Intronic
1102848834 12:116218843-116218865 GCTGCTGGGGTGGCTCAGGCTGG - Intronic
1103698524 12:122835577-122835599 GCGGGTGCTGAGCCGCAGGCCGG + Exonic
1103808604 12:123594509-123594531 GCTGCTTCTGAGCCTGAGGCAGG + Intronic
1104642006 12:130473409-130473431 GCTGCTGCTGCTCCTGCCGCAGG - Intronic
1104963334 12:132498338-132498360 GCTGCTGCGGCGCCTCTGCAAGG - Intronic
1104980266 12:132570428-132570450 GCTGGTGCTGCGCCTGGGACCGG - Exonic
1105271003 13:18875338-18875360 GGTGCTGCAGCGTCTGAGGCGGG - Intergenic
1105312589 13:19226172-19226194 GCTGCTGCAGAAACTCAGGCAGG + Intergenic
1105335691 13:19466044-19466066 GCTGCTAATGCACATCAGGCAGG + Intronic
1105476169 13:20729846-20729868 GCTGTTGCTGCACCCCAGGGAGG - Intronic
1105858910 13:24392766-24392788 GCTGCTGCTCCCCCTCCTGCAGG + Intergenic
1105935613 13:25095911-25095933 GCTGCTGCGGGGCCGCTGGCGGG - Exonic
1106350454 13:28924595-28924617 GCTGCTGCTGCCCCTCTGTGTGG + Intronic
1106583056 13:31034077-31034099 TCTGCTGCTGCTGCTCACGCTGG - Intergenic
1106720157 13:32428019-32428041 GCTGCTGCTGCTGCTGGGGCTGG + Exonic
1106780600 13:33055686-33055708 GGTGCTGCTGAGACTGAGGCAGG + Intronic
1106953772 13:34913166-34913188 GCTGCTGCTGCTACTGAAGCCGG + Intergenic
1107372255 13:39766042-39766064 GCAGCTGCTGAGTCTCAGCCAGG - Intronic
1108267957 13:48731078-48731100 GCTGCTGCTGAGGCCCAGGGAGG + Intergenic
1108383004 13:49872198-49872220 CCTGCTTCTGCTCCTGAGGCTGG - Intergenic
1108408293 13:50125393-50125415 GCGGCAGCTGTGCCTCAGCCAGG + Intronic
1108662738 13:52601147-52601169 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1110169960 13:72488583-72488605 GCTGCTGCTTCTCCTCATGTTGG - Intergenic
1111403547 13:87771557-87771579 GCACCTGCTGCTCCTGAGGCTGG + Intergenic
1111583461 13:90253790-90253812 CCTGCTGCTCTGCCTGAGGCTGG + Intergenic
1112006552 13:95258698-95258720 TCTGCTGCTGCTCTTCAGCCTGG - Intronic
1112326726 13:98446584-98446606 GCTGCTGCCCCGCATCAGACAGG - Intronic
1112525970 13:100147401-100147423 GCTGCTGCTGGGGCTCTGGTAGG + Intronic
1113055411 13:106261898-106261920 CCTGCTGCTGAGCTTCAGGTTGG - Intergenic
1113403604 13:110018299-110018321 GCTGCTGCTGAGGCTGAGGATGG - Intergenic
1113852893 13:113428130-113428152 GCTGCTTCGGCGGCTGAGGCAGG + Intronic
1114199916 14:20510513-20510535 GCTGCTGCTGGGCCTGGGGATGG + Exonic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114543787 14:23483450-23483472 GCTGCTGTTGCTCTGCAGGCAGG + Intronic
1114670469 14:24408231-24408253 GCTGCTGCTGAGCCTGGTGCGGG + Exonic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1117107645 14:52414662-52414684 GCTGCTGGTGAGGCTGAGGCAGG + Intergenic
1119840711 14:77790775-77790797 GCTGCTGCTGCCCTTCCTGCTGG - Intergenic
1119951661 14:78751781-78751803 GCTACTGCTGCTCCTCCAGCAGG - Intronic
1120823015 14:88930417-88930439 GCTGCGGCTGGGGGTCAGGCTGG - Intergenic
1120849641 14:89158282-89158304 CCTGATGCTGTCCCTCAGGCAGG + Exonic
1120998133 14:90432218-90432240 GCTGCAGCTGTAACTCAGGCAGG - Intergenic
1121317242 14:92969596-92969618 GCTGTCGCTGTCCCTCAGGCAGG - Intronic
1121653066 14:95574201-95574223 GCTGCTGCCACCCCTGAGGCTGG - Intergenic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122260538 14:100517730-100517752 GCTGCTCCTGGGGCTGAGGCAGG + Intronic
1122546964 14:102528412-102528434 GCTGCTTCAGAGGCTCAGGCAGG + Intergenic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1123500804 15:20878791-20878813 GCTCCTGCGGCGCCGCAGCCTGG - Intergenic
1124964661 15:34424027-34424049 TCTGCTGCTTGGCCTCAGGCAGG - Intronic
1124981278 15:34570253-34570275 TCTGCTGCTTGGCCTCAGGCAGG - Intronic
1125734884 15:41917966-41917988 GCTGCTGCTGCCCCTCACACAGG - Intronic
1125974127 15:43936220-43936242 TCTGTTGCTGAGGCTCAGGCTGG + Intronic
1126890146 15:53196407-53196429 GCTGCTGCTGTGCCTTTAGCTGG + Intergenic
1127359331 15:58230998-58231020 GCTCCAGCTCCGCCCCAGGCAGG + Intronic
1127510884 15:59639860-59639882 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1128226943 15:66008492-66008514 GATGCTTCTGCCCCTCAGGAGGG + Intronic
1128390700 15:67180676-67180698 GAAGCTGCTGCTCCACAGGCTGG + Intronic
1128459917 15:67859341-67859363 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1128531354 15:68450432-68450454 GCTGCTGCTGAGTGTGAGGCAGG + Intergenic
1128638470 15:69318162-69318184 GCCCCTGCTGCAGCTCAGGCTGG - Intronic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1128944276 15:71810783-71810805 GCTGCAGCTGCGCCTGCAGCTGG + Exonic
1129104565 15:73297154-73297176 GCTGCTTCTGCCCCACAGGGTGG + Intronic
1129260726 15:74365805-74365827 GATGCTGCAGGGCCGCAGGCCGG + Intronic
1129274033 15:74433801-74433823 GCTGCTGCTGCTGCTCTGGGCGG - Exonic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129681493 15:77660888-77660910 GCTGCGGCTGTGCCTGAGCCTGG + Intronic
1130518699 15:84645757-84645779 CCTTCTGCTGTGCTTCAGGCCGG - Exonic
1132630677 16:915779-915801 GCGACTGCGGTGCCTCAGGCGGG + Intronic
1132731111 16:1362462-1362484 GCCGCTGCAGGGCCTCTGGCAGG - Exonic
1132806439 16:1777243-1777265 GCTGCCGCCGGGCCTCAAGCAGG - Exonic
1132807149 16:1780052-1780074 GCTGCTGTTCCGGCTCAGCCAGG - Intronic
1133139174 16:3731735-3731757 GCTGCAGCCGTGCCTCTGGCCGG - Intronic
1133145498 16:3782753-3782775 GCTGCAGCTGCGTCTGGGGCTGG + Exonic
1133216200 16:4293966-4293988 GCTGCTGCTGCTGCTGAAGCCGG - Intergenic
1133288283 16:4701491-4701513 GCTGCTGCTGCTGCTCTGGACGG + Exonic
1133924436 16:10182042-10182064 CCTGCTGCAGAGCCTCCGGCTGG - Exonic
1134544061 16:15094248-15094270 GCGACCGCTGCGCCTCAGGCCGG + Exonic
1135361632 16:21820399-21820421 GCGACCGCTGCGCCTCAGGCCGG + Intergenic
1136068620 16:27775108-27775130 GCAGCTCCTGGCCCTCAGGCGGG + Intronic
1136128918 16:28206502-28206524 TGTGCTGCTGCGCCCCAGCCTGG + Intronic
1136260901 16:29074996-29075018 GCGACCGCTGCGCCTCAGGCCGG - Intergenic
1136451995 16:30358767-30358789 GGTCCTGCTGCGCCACACGCTGG - Exonic
1136687334 16:32003044-32003066 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136768139 16:32810028-32810050 GCTACTACTGTGGCTCAGGCGGG - Intergenic
1136787944 16:32946595-32946617 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1136881837 16:33907194-33907216 GCAGCTGCCCCGCCCCAGGCAGG - Intergenic
1136996793 16:35196092-35196114 GCTGCTGGTGCCGCTCGGGCAGG - Intergenic
1138382066 16:56609338-56609360 GCAGCTGCTGCGCCTGATGCTGG + Exonic
1138388042 16:56649498-56649520 GCAGCTGCTGTGCCTGATGCTGG + Intronic
1138390444 16:56666873-56666895 GCAGCTGCTGCGCCTGATGTCGG - Exonic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1139805945 16:69565800-69565822 GCTGCTGCTGTTCCTGAGCCGGG - Intronic
1139950520 16:70666128-70666150 GCTGCTGATGCGCATCAGGTGGG + Intronic
1141194931 16:81853217-81853239 GCTACTCCTGAGGCTCAGGCAGG + Intronic
1141283785 16:82652644-82652666 GCTGCTGCTGCTGCTGAGGTTGG + Intronic
1141463146 16:84190146-84190168 GCTGCTGCTGCTGCTGAAGCTGG - Intergenic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141629276 16:85277857-85277879 GCTGCTGCTGGGCCTCTGCCTGG + Intergenic
1141777395 16:86133595-86133617 GCCGCTGCTGTGCTGCAGGCTGG - Intergenic
1142200894 16:88760701-88760723 GGTGCTGCTGCGTCAAAGGCGGG - Intronic
1142411565 16:89919582-89919604 GCTGCTGCAGCACCGCAGCCCGG - Exonic
1203090174 16_KI270728v1_random:1208252-1208274 GCAGCTGCCCCGCCCCAGGCAGG + Intergenic
1142699119 17:1649014-1649036 GCAGCTGCAGCGCCTCCTGCTGG - Exonic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1143150968 17:4807469-4807491 GCTGCTGCGCCGCCCCAGGTCGG + Intronic
1143345072 17:6243271-6243293 CCTGCTGCTGCAGCCCAGGCAGG + Intergenic
1143472512 17:7184839-7184861 GCTGATGGAGGGCCTCAGGCTGG - Intergenic
1143631039 17:8140569-8140591 CCTGGTGCTGCCCCTCAGGTGGG - Exonic
1143758806 17:9086254-9086276 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
1144021280 17:11241443-11241465 GCTGCTGCTGCTGCTCTCGCTGG + Exonic
1144615256 17:16765279-16765301 GCTGCTCCTGAGGCTGAGGCAGG + Intronic
1144878074 17:18412700-18412722 GCTACTCCAGCGCCTGAGGCAGG + Intergenic
1144891043 17:18494559-18494581 GGTGCTGCTGCGGCTGAGGAAGG - Exonic
1144897445 17:18550377-18550399 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
1144960446 17:19041505-19041527 GCTGCTGTGTGGCCTCAGGCAGG - Intronic
1144974714 17:19133019-19133041 GCTGCTGTGTGGCCTCAGGCAGG + Intronic
1145134927 17:20395340-20395362 GCTGCTCCTGAGGCTGAGGCAGG + Intergenic
1145154156 17:20531725-20531747 GCTACTCCAGCGCCTGAGGCAGG - Intergenic
1145295912 17:21592732-21592754 GCTGCTCCTGCCCCGCAGGTGGG + Intergenic
1145296092 17:21593569-21593591 GCTGCTTCTGCCCCGCAGGTGGG - Intergenic
1145367699 17:22278492-22278514 GCTGCTCCTGCTCCGCAGGTGGG + Intergenic
1145367873 17:22279330-22279352 GCTGCTCCTGCCCCGCAGGTGGG - Intergenic
1145794743 17:27649174-27649196 GGTGCTGCTGCGGCTGAGGAAGG - Exonic
1146398747 17:32487598-32487620 GGTGCTGCTGCGCGCCGGGCGGG - Exonic
1146721803 17:35129299-35129321 GCTCCTGCTGGGGCCCAGGCAGG - Intronic
1146957666 17:36946244-36946266 CCTCCTGCTGCGCCTCCTGCGGG - Intergenic
1146968613 17:37054217-37054239 GCTGCTCCTGGGCCCCAGGGAGG + Intronic
1147123904 17:38352533-38352555 CCTGCTGCCGCCCCGCAGGCCGG + Exonic
1147191302 17:38739581-38739603 GCCGCTGCTGAGCATCAGGTGGG - Exonic
1147540180 17:41350723-41350745 GCTGGTGCGGCAGCTCAGGCTGG + Exonic
1147542195 17:41369706-41369728 GCTGGTGCGGCAGCTCAGGCTGG + Exonic
1147545408 17:41397495-41397517 GCTGGTGCGGCAGCTCAGGCTGG + Exonic
1147969325 17:44211128-44211150 GCTGCTGCTCCTCCTCAGGCAGG + Exonic
1148083125 17:44978362-44978384 GCTGCTGCTCTGCCAGAGGCTGG - Intergenic
1148177795 17:45582855-45582877 GCTGCTGGGGAGCCTGAGGCAGG + Intergenic
1148715934 17:49715924-49715946 GCTCCTGCTGCGCTTGTGGCTGG + Intronic
1149512265 17:57253707-57253729 GCTGTTGCAGGGCCTCAGGTGGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1152568569 17:81111319-81111341 GCTGGCGCTGCGAGTCAGGCGGG - Intronic
1152674189 17:81628988-81629010 GCTGCTGGTGAGGCTGAGGCAGG - Intronic
1152746364 17:82041665-82041687 GCTGGTTTTGCGGCTCAGGCGGG - Intergenic
1152919361 17:83058194-83058216 GCTGGTGCGGCTCCCCAGGCCGG - Intergenic
1153794415 18:8609544-8609566 GCTGCAACTGCGCCGCCGGCCGG - Exonic
1153796313 18:8625937-8625959 GCTGCAGCTGCGGCCCAGACAGG - Intronic
1154070492 18:11148531-11148553 GCTGCTGCTGCCCATCTGCCTGG - Exonic
1155212995 18:23619182-23619204 GCTGGTGCTGCGCCTCCTGCAGG - Intronic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1155564695 18:27121112-27121134 GCTGCTGGAGAGCCTGAGGCGGG - Intronic
1156294027 18:35773877-35773899 GCTGCTGGGGCCCCTGAGGCTGG - Intergenic
1158980861 18:62760240-62760262 GCTGCTGCTTCACTTCATGCAGG - Intronic
1160796784 19:949300-949322 GCGGCTGCTGCTCCCCAGGTGGG - Intronic
1161062092 19:2220261-2220283 GCTGCTGCTGCTCTTCAGGCAGG + Intronic
1161235652 19:3196792-3196814 GCTGCTGCTGCAGCACTGGCAGG + Intronic
1161394280 19:4037171-4037193 GCAGGTGCTGAGCCCCAGGCAGG - Intronic
1161412446 19:4123965-4123987 GCTGCGGCCGCGGCCCAGGCCGG + Exonic
1161551743 19:4916784-4916806 GCTGTGGCTGCCCCTCAGGAAGG + Intronic
1161685068 19:5698505-5698527 CCTGCTTCTGGGCCTGAGGCTGG + Intronic
1161686831 19:5707062-5707084 GCTGCAGCAGCGCCTGGGGCGGG - Exonic
1162472047 19:10878089-10878111 GCTACTTCTGAGGCTCAGGCAGG - Intronic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1162588278 19:11574898-11574920 CCTGCTGCAGCGCCACAGGTTGG + Exonic
1162740229 19:12769883-12769905 GCCGCCGCTGCGCCTCCAGCTGG + Exonic
1162923681 19:13918934-13918956 GCTGCTCCAGCGCCTCCAGCAGG - Exonic
1163006137 19:14397733-14397755 GCTGCCGCTGCCGCCCAGGCTGG + Exonic
1163061608 19:14765707-14765729 GCTGCCGCTGCCGCCCAGGCTGG - Exonic
1163220044 19:15912086-15912108 GCTGCTGCTGCTCCTCGGCTGGG - Intergenic
1163563902 19:18038311-18038333 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
1164061328 19:21678018-21678040 GCGGCTCCTGCACCTCTGGCGGG + Intergenic
1164130207 19:22354937-22354959 GCTGCTCCTGCACCTCTGACTGG - Intergenic
1164169117 19:22709065-22709087 GCTGCTCCTGCGCCTCTGACCGG + Intergenic
1165762091 19:38327337-38327359 GTTGCTGGTGCGACTCCGGCTGG - Exonic
1165847573 19:38828341-38828363 GCTGCTGGAGAGCCTGAGGCAGG - Intronic
1166732594 19:45067480-45067502 GCTGCGGCTGCGGCTCTGGCTGG - Exonic
1167441931 19:49513615-49513637 TCTCCTGCTGGGCCTGAGGCTGG + Intronic
1167564699 19:50249043-50249065 GCTGGTTCTGCGCCTCAACCGGG + Exonic
1167671868 19:50858271-50858293 CCACCTGCTACGCCTCAGGCTGG + Exonic
1167674622 19:50876714-50876736 CCACCTGCTACGCCTCAGGCTGG + Exonic
1168337102 19:55602959-55602981 GCTGGTGCTGGGCCTGAGCCAGG + Exonic
926149347 2:10415979-10416001 GGTGCTGCAGGGCCTCAGGCTGG + Intronic
926975682 2:18514694-18514716 TCTGGTGCTGAGCCCCAGGCTGG - Intergenic
927957950 2:27221304-27221326 GCTGCTGCAGCCACTCATGCAGG - Exonic
928180431 2:29064886-29064908 GCTGGGGCTGCGCCTCTGGCTGG + Exonic
929492290 2:42407628-42407650 GCTGCAGCTGCCCCCCAAGCGGG - Intronic
929771913 2:44899403-44899425 GCTGCTTCTGCACATCAGGAGGG - Intergenic
931087483 2:58849097-58849119 GCTACTGGTGCGGCTGAGGCAGG + Intergenic
933714486 2:85350094-85350116 GCTGCTGCAGGACCTCAGCCAGG + Exonic
934572189 2:95379740-95379762 TCTGCAGCAGCGCCTGAGGCAGG - Intronic
935004067 2:99053030-99053052 TCTGCTTCTGTCCCTCAGGCTGG - Intronic
935854037 2:107255929-107255951 GCTGCCTCTGCGCCTCCTGCTGG - Intergenic
936058643 2:109280222-109280244 GCTGCTGCTTCTCCACAGCCAGG - Intronic
937203702 2:120222880-120222902 GGTGCTGCTGCCCCTCCGCCTGG - Exonic
941788293 2:169522832-169522854 GCTGCTCCAGAGCCTGAGGCAGG - Intronic
942115659 2:172726645-172726667 GTGGCTGGTGAGCCTCAGGCGGG + Intergenic
942780594 2:179637293-179637315 GCTGCTGCTGGTCCTAGGGCAGG - Intronic
943046476 2:182867100-182867122 GCTGCGGCTGCGACCCTGGCTGG + Exonic
943101811 2:183496063-183496085 GCAGCGACTGCACCTCAGGCAGG - Intergenic
944172977 2:196799737-196799759 GCTGCAGCTGCGGCGCAGACCGG - Intergenic
944700237 2:202239512-202239534 GCTGCTGCAGCTCTGCAGGCCGG - Intergenic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
946306629 2:218860073-218860095 GCTGCTGCTGCTCCTGTGCCCGG + Exonic
946389165 2:219405159-219405181 GCCGGTGCTGCCACTCAGGCTGG - Intergenic
947028878 2:225770189-225770211 GCTGCTGCTGCACTGCAGCCAGG + Intergenic
947579783 2:231307928-231307950 GCTCCTGCTGCTCCTCAGCTGGG - Intronic
947809809 2:232997251-232997273 GCTGCTGCTGGGGCTGAGACTGG + Intronic
948213854 2:236214610-236214632 GCTGCTGCTGCGGCGCGGGGCGG - Exonic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
1169083964 20:2815679-2815701 GCTGCTGCTGCTCATGGGGCTGG + Exonic
1169217506 20:3802067-3802089 CCTCCTGCTGCTCCTCAGGAGGG - Exonic
1169234800 20:3922418-3922440 GCTGCTTCTGTGTCTCAGGAGGG + Intronic
1170424296 20:16223337-16223359 GCTGCTGGGGAGGCTCAGGCAGG - Intergenic
1170639328 20:18137900-18137922 GCGGCCTCTGCGCCTCGGGCGGG + Exonic
1170779265 20:19409236-19409258 GCTCCTGCTGCGCCTCTTCCTGG - Intronic
1171399097 20:24860122-24860144 GCTGTTGCTGTGGCCCAGGCAGG - Intergenic
1172246336 20:33447496-33447518 TGTGCTGCTGCACCTCAGCCTGG + Intergenic
1172287805 20:33753346-33753368 AGTGCTGCTGCGCCCCTGGCTGG + Exonic
1173483626 20:43423606-43423628 GCTGCTCCACCTCCTCAGGCAGG + Intergenic
1174565479 20:51461596-51461618 GCTGCTGCTGTGCTGCAGGTGGG - Intronic
1175491126 20:59381791-59381813 AAAGCTGCTGCGCCCCAGGCAGG + Intergenic
1176016938 20:62938512-62938534 GCTACCGCCGCCCCTCAGGCTGG - Intronic
1176113956 20:63422998-63423020 CCTGCTGCTGGCCCTGAGGCTGG - Intronic
1176201418 20:63862482-63862504 GCTGCTGCTCCGACGCACGCAGG + Exonic
1176231345 20:64034561-64034583 CCTGCAGCTGCTCCTCAGGACGG - Intronic
1176243542 20:64086008-64086030 GCTGGTGCTGCAGCCCAGGCAGG - Intronic
1176412189 21:6455065-6455087 TCTGCTGCTCCGCCGCAGGGTGG - Intergenic
1179405320 21:41121144-41121166 GCTGAAGCTGAGCCTCAGGAAGG - Intergenic
1179422407 21:41247333-41247355 GCTGCAGCTGCGCCAGTGGCTGG - Intronic
1179687683 21:43063387-43063409 TCTGCTGCTCCGCCGCAGGGTGG - Intronic
1179810653 21:43866961-43866983 GGTGCTGCCCCGCCCCAGGCTGG + Intronic
1180028648 21:45185258-45185280 CCTGCTGCTGCCCCTCACGGGGG - Intronic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1180918390 22:19505495-19505517 GCTGCCTGTGCCCCTCAGGCTGG - Intronic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1181107385 22:20583150-20583172 GGTACTGCTGCTCCTCAGCCTGG - Exonic
1181130545 22:20729085-20729107 GCTGCTGCAGCACCCCAGGCAGG + Intronic
1181182134 22:21075769-21075791 GCTGCGGCTGCTTCTCAAGCAGG - Intergenic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181639279 22:24188298-24188320 TGTGCTGCTGCGCCGCAGGAAGG + Exonic
1181839828 22:25647203-25647225 GCTGCTGCTGCAGCTCCGGGTGG - Intronic
1183075885 22:35426447-35426469 GCTGGTGCTGCCACTCAGGGTGG + Intergenic
1183174188 22:36210688-36210710 TCTGCTGCTGCACCCCAGCCTGG - Intergenic
1183220665 22:36510581-36510603 GGGGCTGCTGCGCCTGAGGGAGG - Intergenic
1184075537 22:42174921-42174943 GCTGCTGGGGCGGCTGAGGCAGG + Intronic
1184293602 22:43510547-43510569 GCTGCTGCTGCATCTCAGCTGGG - Intergenic
1184397260 22:44249658-44249680 GCTTTTGCTGTGCCTCAGGATGG - Exonic
1185028610 22:48429825-48429847 CCTGATTCTGCGCCTCAGGAAGG - Intergenic
1185151540 22:49166838-49166860 GCTGCTGGTGACCCTCAGGATGG + Intergenic
1185157537 22:49203232-49203254 GCAGCTTCAGGGCCTCAGGCTGG - Intergenic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
949335476 3:2970133-2970155 GCTGCTGCTGCACTCCAGCCTGG - Intronic
949918835 3:8985729-8985751 GCTGCTGCTGCGGCGCATGGCGG + Exonic
950304602 3:11908235-11908257 GCTGCTGCTGGTGCTCAGGGTGG - Intergenic
950495996 3:13334964-13334986 CCTGCTGATGCCCCTGAGGCGGG - Intronic
951350870 3:21605325-21605347 GCTGCTGCTGTGCCTAACTCAGG - Intronic
951543604 3:23806029-23806051 GCTGCTGCTGCGGCTGCGGCTGG - Exonic
953383940 3:42494037-42494059 TCAGCTGCTGTGCCTTAGGCAGG - Intronic
953980238 3:47409970-47409992 GCCGCTGCTGCCCCGCAGGGAGG + Exonic
954293854 3:49663480-49663502 GCTGCTGCTGTGTCTGTGGCTGG - Exonic
954326719 3:49868078-49868100 GCTGCTGCAGCCCCCCAGTCAGG + Intronic
954853369 3:53622160-53622182 GCTACTGCTGAGGCTGAGGCAGG - Intronic
957322501 3:78650397-78650419 ATTGCTGCTGAGCCACAGGCAGG + Intronic
957939816 3:86990852-86990874 GCTGCTACTGCGGCGAAGGCGGG + Exonic
959895774 3:111604209-111604231 GCTGCTGCTGCCCATGAGGGTGG + Intronic
959930692 3:111978975-111978997 GCTGCGCATGCGCTTCAGGCTGG - Intergenic
960874673 3:122284771-122284793 GCTGCTGCTGCTGCTCTTGCTGG - Exonic
961354762 3:126330182-126330204 GATTCTGCTGTGACTCAGGCTGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
961431898 3:126889523-126889545 GCTCCTGCTGAGCCACTGGCTGG + Intronic
961733838 3:128987907-128987929 GCTGCTGCTGAGGGCCAGGCTGG - Intronic
962210396 3:133472452-133472474 GCTGCTGCTCCGCCTCCGCTCGG - Exonic
962688255 3:137868214-137868236 GCTGCTGCTGGGGGTCAGGGAGG - Intergenic
963074235 3:141331696-141331718 GCTGAGGCTGAGCCTGAGGCTGG + Intronic
964210566 3:154222413-154222435 GCTTCTACTGCAACTCAGGCAGG - Intronic
965949421 3:174287879-174287901 GCTTCCTCTGCTCCTCAGGCAGG + Intergenic
966790059 3:183659423-183659445 GCTGCTGCAGAGACTGAGGCAGG + Intronic
966807537 3:183818814-183818836 GCTGTTGCTGAGCCTGTGGCGGG + Intronic
968166206 3:196467268-196467290 GCTGCTGGGGAGGCTCAGGCCGG - Intergenic
968342379 3:197967387-197967409 GCTGCTTTTGCGGCTCAGGCGGG - Intronic
968486274 4:864500-864522 GCTGCAGCTGCGTCTTGGGCCGG - Intronic
968698103 4:2042405-2042427 GCTGCTGCTGCTGCTGAGTCTGG + Exonic
969068166 4:4507177-4507199 GCTGCTGCTGAGCATCAAGAGGG - Intronic
969452604 4:7283464-7283486 ACTGCTGCAGAGCCTCAGGGCGG + Intronic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
970271069 4:14348253-14348275 GCTGCTTCTGCCCTGCAGGCAGG + Intergenic
970586982 4:17523658-17523680 GCTGGTGCTGCAGCTAAGGCTGG + Intronic
972448229 4:39167812-39167834 GCTGCTGCTGCACTTCAGTTTGG + Intergenic
974539792 4:63219269-63219291 GCTGCTGCTGTGCTGCTGGCTGG + Intergenic
974788697 4:66657044-66657066 GCTACTCCTGCGGCTGAGGCAGG + Intergenic
974932661 4:68376492-68376514 GCAGCTGCTGTGCCTGATGCTGG + Intergenic
974967472 4:68779550-68779572 GCTGCTGCTGCACTGCAGCCTGG - Intergenic
974968299 4:68792446-68792468 GCTGCTGCTGCGCTCCAGCCTGG + Intergenic
977877877 4:102169926-102169948 GCTACAGCTGTGCCTGAGGCTGG + Intergenic
977920380 4:102636727-102636749 GCTGGTGATCCTCCTCAGGCAGG + Intronic
978701767 4:111655370-111655392 GCTGCTGGGGCGGCTGAGGCAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
979899821 4:126201968-126201990 GCTGCTGCTTCCCCTCATGTGGG + Intergenic
981773463 4:148336901-148336923 GCTACTCCTGAGGCTCAGGCAGG - Intronic
982765772 4:159346877-159346899 GCTGCTGCTGGGGCTGTGGCAGG - Exonic
984395938 4:179200095-179200117 GCTACTCCTGAGCCTGAGGCAGG + Intergenic
984786076 4:183568282-183568304 CCTGCTACTGCACTTCAGGCTGG + Intergenic
984870028 4:184317500-184317522 GCTACTGCTGCCGCTCAGTCAGG + Intergenic
984883753 4:184431737-184431759 GCTGCAGCTGAGCCTGAGCCTGG + Intronic
985570164 5:640526-640548 GCTGCTGCTGCTGCTCAGCAAGG - Exonic
985668863 5:1196220-1196242 CCTGCTGCAGAGCCTGAGGCCGG - Intergenic
985947854 5:3200686-3200708 GCTGCTGCTGAACCTGTGGCTGG + Intergenic
986165499 5:5268825-5268847 GCAGCTGCAGCCCCTCAGGCAGG + Intronic
986506944 5:8461874-8461896 ACTGCTACTGCGGCTCTGGCAGG + Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
986910413 5:12548904-12548926 TCTGCTGCTGACCCTGAGGCTGG + Intergenic
989495548 5:42107641-42107663 GCTGCTTCTGAGCTTCAGCCTGG + Intergenic
990518433 5:56553028-56553050 GCTGCTGCTGTGACTGTGGCAGG + Intronic
990528237 5:56649827-56649849 TCTGCAGCTGCTCCTCATGCTGG - Intergenic
991688276 5:69201745-69201767 GCTGCTTCTGAGGCTGAGGCAGG + Intronic
992957998 5:81930169-81930191 ACTCCTGCTGCTCCTCAGGAAGG - Intergenic
993959708 5:94281807-94281829 GCTGCTGCTGAGACTCAGTAGGG - Intronic
994487954 5:100402678-100402700 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
995048084 5:107672009-107672031 GTTGCTGCTGTGCCTAAGGAGGG - Intergenic
995650438 5:114362480-114362502 GCTGCTGCTGCTCGTCGCGCCGG + Exonic
997194004 5:131965608-131965630 GCTGCTGGGGAGCCTGAGGCAGG + Intronic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
999141431 5:149364959-149364981 GCAGCCCCTGCGCCTTAGGCTGG - Intronic
1000318996 5:160119060-160119082 GCGGCAGCCGCGCCTCAGGGAGG - Exonic
1001940880 5:175738642-175738664 GATGATGCTGCGTCTCAGGTGGG - Intergenic
1002600658 5:180352684-180352706 GCTGCGTCAGTGCCTCAGGCAGG - Intronic
1002762921 6:215720-215742 GCTTCTGCTGTGGCACAGGCTGG + Intergenic
1003721726 6:8710712-8710734 GCTCCTCCTGGGTCTCAGGCTGG - Intergenic
1004354765 6:14921386-14921408 ACAGCTGCTGCGCCTCACCCTGG - Intergenic
1004728528 6:18334626-18334648 GCTGCTGCTGCACTCCAGTCTGG + Intergenic
1005040436 6:21595544-21595566 GCTGCTGCGGCCGCTCAGGCTGG - Exonic
1005959522 6:30685724-30685746 GCTGCTGCTGCCGCTCCTGCCGG + Exonic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1007312544 6:40958072-40958094 GCAGTGGCTGCGGCTCAGGCAGG + Intergenic
1009447404 6:63758898-63758920 GTTGCTACTTCCCCTCAGGCAGG - Intronic
1011652358 6:89518288-89518310 GCTGCTGCGGAGGCTGAGGCAGG + Intronic
1012570024 6:100712867-100712889 GCTGCTGCAGAGCCTGAGGCAGG - Intronic
1012964406 6:105657699-105657721 GCTCCTGCTGTGGCTCAAGCAGG + Intergenic
1013308518 6:108872156-108872178 GCTGATGCTACCCCACAGGCAGG + Intronic
1014137685 6:117907732-117907754 GCTGCTGCGGCTGCTCAGGGGGG - Exonic
1014224102 6:118828495-118828517 GCTGCTGCAGAGGCTGAGGCAGG - Intronic
1014237849 6:118980002-118980024 TGTGCTGCTGCACCTCAGCCTGG + Intronic
1016422831 6:143902565-143902587 GCTGCTGCTGCTCTGCAGGGAGG + Intronic
1016830577 6:148429629-148429651 GCTGCTTGGGAGCCTCAGGCGGG + Intronic
1017787470 6:157768370-157768392 GGTGCTGCTGAGCCCCAGGGTGG - Intronic
1019281797 7:204274-204296 GCTGCTGGCCCGCCTGAGGCTGG + Intronic
1019561951 7:1663901-1663923 GCTGCTGTCCCCCCTCAGGCTGG - Intergenic
1019614123 7:1951212-1951234 GCTCTGGCTGAGCCTCAGGCAGG - Intronic
1019778960 7:2928672-2928694 GATGCTGCTGCGGCTCCGGGGGG + Exonic
1021263976 7:18496109-18496131 TCTGCTGCTTCTCCTCAGGGAGG + Intronic
1022090762 7:27106685-27106707 GCTCCCGCTGCGCCTTGGGCCGG + Exonic
1022385617 7:29896195-29896217 GCTGCTGGGGAGGCTCAGGCAGG + Intronic
1023694453 7:42830348-42830370 GCTGGTGCTGCTCCCCAGCCTGG - Intergenic
1024325220 7:48104104-48104126 GCTGCTGGTGAGGCTGAGGCAGG + Intronic
1024490521 7:49976988-49977010 GCTGCTCGGGCGCCTGAGGCAGG + Intronic
1024726881 7:52207929-52207951 GCTGCTGGGGAGGCTCAGGCAGG + Intergenic
1025000090 7:55308739-55308761 GCAGCTGCTGCCCCTGAGGGAGG + Intergenic
1025974078 7:66355791-66355813 GCTGCTCCTGAGGCTGAGGCAGG + Intronic
1026163069 7:67887981-67888003 GCTGCTCCTGAGGCTGAGGCAGG - Intergenic
1026479053 7:70763159-70763181 GCTGGAGCTGGGCCTCAGGAGGG - Exonic
1027241278 7:76331159-76331181 CCTGCTGCTGCACTCCAGGCTGG - Intronic
1027269680 7:76512718-76512740 GCTACTGCTGCCCCTCTGGGAGG + Intronic
1027320391 7:77006613-77006635 GCTACTGCTGCCCCTCCGGGAGG + Intergenic
1028748054 7:94349822-94349844 GCTACTGCGGCGGCTGAGGCAGG + Intergenic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1029519539 7:101051470-101051492 GCTGATGCTGCCCCTCTGCCGGG + Intronic
1030133350 7:106221685-106221707 GCTACTCCTGAGCCTGAGGCAGG + Intergenic
1031141825 7:117950779-117950801 GCTGCAGATGAGCTTCAGGCTGG + Intergenic
1031785478 7:126026044-126026066 GCTGCTCCGGAGCCTGAGGCAGG + Intergenic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1033720249 7:144051196-144051218 CCTTCTGCTGCTCCTCAGGGTGG - Exonic
1033738672 7:144250790-144250812 CCTTCTGCTGCTCCTCAGGATGG + Intergenic
1033744375 7:144300164-144300186 CCTTCTGCTGCTCCTCAGGATGG - Intergenic
1033801435 7:144906920-144906942 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
1034438535 7:151075218-151075240 GGTGCTGCTGAGGCCCAGGCTGG - Intronic
1034881392 7:154765303-154765325 GCTGAGGCTGCACTTCAGGCAGG - Intronic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1036157686 8:6357817-6357839 TGTGCTGCTGCACCTCAGCCTGG - Intergenic
1037501524 8:19490256-19490278 GCTGCTTCTGCGACTCACACTGG + Intronic
1040296475 8:46151621-46151643 GCGGCAGCTGAGCCACAGGCAGG - Intergenic
1040393809 8:46975606-46975628 GCTACTGCAGAGCCTGAGGCAGG - Intergenic
1044320096 8:90791790-90791812 GCTGCTGCTTCGCCGCCGCCGGG - Exonic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1046494604 8:114997257-114997279 GCTGCTTTTGAGGCTCAGGCAGG + Intergenic
1048072978 8:131040741-131040763 GCTTCTGCTGCGCGTCGGGCGGG + Exonic
1049095734 8:140547136-140547158 GCTGCTGCTGCTGCTGAGCCAGG + Intronic
1049265730 8:141666960-141666982 GCAGCTGCTCTGCCTCAGGAGGG + Intergenic
1049494209 8:142922186-142922208 GGGGCTGCTCGGCCTCAGGCTGG - Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049565258 8:143334828-143334850 GCGGCTGCTGCGGCTCCGGGCGG - Exonic
1049647119 8:143740439-143740461 GGCGCTGCTGAGCCTCAGGGCGG - Intergenic
1049689220 8:143951443-143951465 GCTGCTGCTGTCCATCAGGCGGG + Intronic
1049803241 8:144527738-144527760 GCTGCGGTTGGGTCTCAGGCGGG + Exonic
1050335107 9:4583066-4583088 GCTGCTGGCGTGCCCCAGGCTGG + Exonic
1051357913 9:16256255-16256277 ATTGCTGCTCTGCCTCAGGCTGG + Intronic
1052844561 9:33323639-33323661 GCTGCTCCGGCGGCTGAGGCAGG + Intronic
1053600646 9:39605257-39605279 CCTGCTGCTGCGCTTCTGTCTGG + Intergenic
1054252883 9:62737172-62737194 CCTGCTGCTGCGCTTCTGTCTGG - Intergenic
1054567000 9:66771671-66771693 CCTGCTGCTGCGCTTCTGTCTGG - Intergenic
1055109165 9:72542506-72542528 GCTGCTCCTGAGCCTGAGGTGGG + Intronic
1057426056 9:94950709-94950731 GCTGCTGCCACGCCTGAGCCAGG - Intronic
1058051820 9:100413805-100413827 GCTGCTCCGGCGGCTGAGGCAGG + Intergenic
1058885780 9:109320500-109320522 GCTGCCGCTGCGCCGCCGCCCGG + Exonic
1060875753 9:127082437-127082459 GCTGCTGCTGCTGCATAGGCAGG + Intronic
1061128034 9:128689166-128689188 GCGGATGCTCCGCCTCCGGCCGG - Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1062028581 9:134351853-134351875 GCAGCAGCTGCGGCTCTGGCGGG + Intronic
1062035850 9:134382213-134382235 CCTGCTGCTGCCCCTGTGGCCGG + Intronic
1062397445 9:136358178-136358200 ACTGCTGCTGGGGCTCGGGCGGG - Exonic
1185635132 X:1546753-1546775 GCAGCTGCAGACCCTCAGGCTGG + Intergenic
1185915794 X:4034003-4034025 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1186623535 X:11266916-11266938 GCTGCTGCTGCTGCTAAGGAAGG + Intronic
1187275900 X:17816507-17816529 CCTGCATCTGCACCTCAGGCAGG + Intronic
1187695308 X:21913386-21913408 GCTACTGGTGCGGCTGAGGCAGG + Intergenic
1187746819 X:22418243-22418265 GCTGCTCCAGAGCCTGAGGCAGG + Intergenic
1187861967 X:23691526-23691548 GCTGTTCCTGAGCCTAAGGCAGG + Intergenic
1190774938 X:53545060-53545082 TCTGTGGCTGCTCCTCAGGCAGG + Exonic
1192435434 X:71140731-71140753 GCTGCTGCTGCTGCTCAGGTAGG - Exonic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1196920402 X:120579424-120579446 GCTGCTCCGGAGGCTCAGGCAGG + Intergenic
1196950907 X:120875145-120875167 GCTGCTGCTGTCCCAGAGGCTGG - Exonic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1199811991 X:151359392-151359414 GCTGTTGCTGCCCTCCAGGCAGG - Intergenic
1200093842 X:153648145-153648167 GCTGCAGCGGCGGCCCAGGCAGG - Exonic
1200161880 X:154013789-154013811 GCTGCTGCCGCGCCCCCTGCTGG - Intronic
1200732883 Y:6761409-6761431 GCTCCTGCAGCTCCCCAGGCTGG + Intergenic
1202596135 Y:26542247-26542269 GCTGCTACTGCACATCAGGGAGG - Intergenic