ID: 979585809

View in Genome Browser
Species Human (GRCh38)
Location 4:122415570-122415592
Sequence GTTTCTTTGGAGATTGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979585809 Original CRISPR GTTTCTTTGGAGATTGTGGA TGG Exonic
900011633 1:116236-116258 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900027738 1:292802-292824 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900041693 1:472243-472265 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900063128 1:707221-707243 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
900714362 1:4134373-4134395 GTTTATTTAGAGATTTGGGAGGG - Intergenic
901712021 1:11123141-11123163 GATTCTTTGGAGGTTGTTAAAGG + Intronic
901984736 1:13065912-13065934 GGTTCATTGGAGATTCTAGAGGG + Intronic
901997074 1:13160858-13160880 GGTTCATTGGAGATTCTAGAGGG - Intergenic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
902922067 1:19672035-19672057 CATCCTTGGGAGATTGTGGAGGG + Intronic
903414751 1:23174537-23174559 GATTCTTTGGAAGGTGTGGAGGG - Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904761449 1:32807567-32807589 GTTCCTTTGGAGGTTGAGGTGGG - Intronic
905582198 1:39090709-39090731 GTTACTTTGGGGACTGTGGAAGG + Intronic
908212496 1:61915533-61915555 GTTTCTTTTGGGATTTTGGTTGG + Intronic
908280868 1:62533571-62533593 GTTTCTGTGTAGATTGGGGTGGG - Intronic
909866799 1:80683996-80684018 TTTTCTTTGAAAATTTTGGAAGG - Intergenic
909879033 1:80848963-80848985 GTGTCTTAGGACTTTGTGGAAGG - Intergenic
913645320 1:120849376-120849398 GTCCTTTTGGAGATTGAGGATGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914081410 1:144414163-144414185 GTCCTTTTGGAGATTGAGGATGG - Intergenic
914176319 1:145282702-145282724 GTCCTTTTGGAGATTGAGGATGG - Intergenic
914531045 1:148524188-148524210 GTCCTTTTGGAGATTGAGGATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
918500646 1:185191668-185191690 ATTACTTTGGAGTTTGTTGAAGG + Intronic
919690928 1:200527771-200527793 TTTTCCTTAGAGATTGAGGATGG - Intergenic
920044150 1:203122636-203122658 GTTTCTTTGGCATTTGTGAAGGG - Intronic
921381615 1:214530451-214530473 GCTTCTTTGGAGACTGAGGTGGG - Intronic
921920696 1:220666108-220666130 GTTTTTTTGGAGATGGAGGGGGG - Intergenic
922053516 1:222018075-222018097 GTTACTTTGGAGAATATGGGAGG - Intergenic
922260069 1:223932246-223932268 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
923057379 1:230437149-230437171 GTTTCTTTGGAGGCTGAGGCAGG + Intergenic
924341237 1:243034805-243034827 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
924734287 1:246741406-246741428 GCTACTTAGGAGGTTGTGGAGGG - Intronic
1062997498 10:1880773-1880795 GTTACTTAGAAGCTTGTGGATGG + Intergenic
1063029180 10:2214689-2214711 GATTGTTGGGAGATTGGGGAGGG - Intergenic
1063200134 10:3779801-3779823 GGTTCTTTGGAGAATCTGAACGG + Intronic
1064354016 10:14601833-14601855 TTTTCTTTGGGAATGGTGGAGGG - Intronic
1066735238 10:38470629-38470651 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1066811080 10:39336097-39336119 ATATCTTTGGAGATTCTAGAAGG + Intergenic
1067317727 10:45184126-45184148 GTTTTTTTGGAAATTGAGCATGG - Intergenic
1067453827 10:46398920-46398942 GTTGCTTTGGGGTTTATGGATGG + Intergenic
1067583371 10:47460354-47460376 GTTGCTTTGGGGTTTATGGATGG - Intronic
1067633374 10:47985710-47985732 GTTGCTTTGGGGTTTATGGATGG - Intergenic
1068385042 10:56315846-56315868 GTTTCTATGGAGACTGTCCATGG - Intergenic
1069277253 10:66608188-66608210 CTTTCTGTGGCAATTGTGGATGG - Intronic
1069514949 10:69070008-69070030 GTGTCTTTGGAGGGTTTGGAGGG + Intergenic
1070096039 10:73339273-73339295 GTTTCCTTGGAAATTGTGAAAGG - Intronic
1070312595 10:75284397-75284419 GTTGCTCTGGAGAGTGGGGAAGG + Intergenic
1070892802 10:79954582-79954604 GTTGCCTTGGAGTTTGTGGATGG + Intronic
1073767023 10:106694049-106694071 ATTTCTTTGGGCTTTGTGGATGG + Intronic
1073822123 10:107275672-107275694 GTTTCATTGGAGAAAGAGGATGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075361350 10:121838158-121838180 TGTTCTGTGGAGATTATGGAGGG - Intronic
1076101495 10:127783343-127783365 GTTTCTGTGGCAATTGTGAACGG - Intergenic
1076159365 10:128231224-128231246 ATTTCTTTGGCTTTTGTGGATGG + Intergenic
1076967966 11:108472-108494 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1076992997 11:285265-285287 GTTCCTTGGGAGGTTGTGGGTGG - Exonic
1080084461 11:28261287-28261309 GCTTCTTTGGAGATTTTAGTGGG + Intronic
1080831614 11:35898603-35898625 GTTTCTTGGGAGACTGAGGTGGG - Intergenic
1080866426 11:36199328-36199350 GTTTCTTCTGAAATTGTTGAAGG + Intronic
1082677789 11:56129696-56129718 ATTTCTGTGGCGATTGTGAATGG - Intergenic
1083134261 11:60656775-60656797 CTTTCTTTGGAGATTAAGTATGG + Intergenic
1083448352 11:62726385-62726407 GGTTCCTTGGTGATAGTGGATGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1088588864 11:111383975-111383997 GTTTCTGTTGATATTGTGAATGG + Intronic
1089209590 11:116791266-116791288 GTTTCTTTGGAGAGTGTTGTAGG - Intronic
1089310106 11:117552332-117552354 GTGTCTGTGTAGATTGGGGATGG - Intronic
1090408350 11:126490996-126491018 GTCTCTTTGGAGAATGGGGCAGG + Intronic
1090482098 11:127077933-127077955 GTTTCTCTGGAGGGTGTGGACGG + Intergenic
1093201319 12:16190241-16190263 GTTTTTCTGGAGGTTGGGGATGG - Intronic
1093654564 12:21679971-21679993 CTTACTTTGGAAATTGTGTAAGG - Intronic
1094448321 12:30557735-30557757 GCTACTTTGGAGACTGTGGTGGG - Intergenic
1094744452 12:33328791-33328813 ACTTCTTGGGACATTGTGGAAGG - Intergenic
1094747576 12:33363302-33363324 GTTTATTTGGAGATGGTAGCTGG - Intergenic
1095120741 12:38415440-38415462 GTTTCACTAGAGATTGTAGAGGG - Intergenic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1096403576 12:51326491-51326513 GTTTCTTAGGAGACAGTGGCTGG - Intergenic
1096579103 12:52573099-52573121 GCTTCTTTGGCGATTTTGCAGGG - Intronic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1098746196 12:74240286-74240308 CTTTATTTGGAGATTAAGGATGG + Intergenic
1099099210 12:78416360-78416382 TTTTCTATGGAGATTCTGGGTGG - Intergenic
1099920432 12:88950913-88950935 CTTTCTTGGGAGATTGGGGTGGG - Intergenic
1101259653 12:103015223-103015245 GTTTTGTTGGGCATTGTGGAAGG - Intergenic
1101700402 12:107168560-107168582 GTTGCTGTGGGGATTGTTGAAGG + Intergenic
1103579590 12:121904460-121904482 GTTACTTGGGAGACTGAGGAAGG + Intronic
1104205282 12:126632676-126632698 GTTTCTTTAGAGTTTCTTGAGGG + Intergenic
1104297627 12:127531769-127531791 GTTCCTTTGCTGATTGGGGAGGG + Intergenic
1104785990 12:131448293-131448315 GCTTCTTCGGAGATGCTGGAAGG + Intergenic
1104885131 12:132102902-132102924 GTTACTTAGCAGACTGTGGAAGG + Intronic
1104913775 12:132253347-132253369 GTTACTTAGCAGACTGTGGAAGG - Intronic
1106233925 13:27845512-27845534 GTTGCATTGGAGGTGGTGGAAGG - Intergenic
1106270829 13:28151722-28151744 GTTTGTTTCAAGAGTGTGGAAGG + Intronic
1106288132 13:28336019-28336041 TTTTCTTTTTAGATGGTGGAAGG - Intronic
1108439575 13:50436951-50436973 GTTTCCTTGGGGATGGTGGGGGG - Intronic
1111790799 13:92852179-92852201 TTTTCCTTGGTGCTTGTGGATGG + Intronic
1111973348 13:94940138-94940160 GTTTCTTGGGAGACTGAGGCAGG + Intergenic
1112417759 13:99217697-99217719 GTCTCTGTGGAGGTTGTGGGGGG + Intronic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113899237 13:113787496-113787518 GGGTCTTTGGAGGGTGTGGATGG + Intronic
1114259003 14:21024540-21024562 GTTTGTTTTTAAATTGTGGAGGG - Exonic
1116325684 14:43532133-43532155 GTTTCCTTGGAGAATGAGCAAGG - Intergenic
1116544138 14:46141698-46141720 GTTACTTTGGAAATTATGAATGG - Intergenic
1116727350 14:48577071-48577093 GTTTCTTTGGAGATTTTGTGTGG - Intergenic
1116745118 14:48808349-48808371 GGTACTTTGAAGAGTGTGGATGG + Intergenic
1117645452 14:57846854-57846876 GTCTGTTTGGAGATTGAGGAGGG - Intronic
1118766370 14:68912230-68912252 GTTTCTGTAGAAATCGTGGATGG - Exonic
1118818848 14:69331669-69331691 TTCTCTTTGGAGGTGGTGGAAGG - Intronic
1119470993 14:74899034-74899056 GTTCCTTGGGAGATTGGAGAGGG + Intronic
1119775618 14:77246514-77246536 CTTTCTTTGGAGATTGGGCAAGG + Intronic
1120369136 14:83609608-83609630 GTTTCTAAGGAGATTCTGGTAGG + Intergenic
1121130644 14:91443160-91443182 GTTTCTTTGTTGATTGTGTCTGG - Intergenic
1121379679 14:93452498-93452520 GTTACTCTGGAGGTTGAGGAAGG - Intronic
1124261553 15:28197216-28197238 GTTTGTTTGAACCTTGTGGAAGG - Intronic
1125215583 15:37269726-37269748 ATGTCTTTGAAGATTGTGCATGG - Intergenic
1125634067 15:41172505-41172527 GTTACTTGGGAGATTGAGGCAGG + Intergenic
1126739166 15:51760382-51760404 TTTGCTTTGAAGATGGTGGAAGG - Intronic
1128976852 15:72160680-72160702 GTGGCTTTGGAGGTTCTGGAAGG - Exonic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1130784493 15:87081197-87081219 ATTTCTTTGGTGTTTCTGGATGG + Intergenic
1131986053 15:98043807-98043829 GTTTCCATGGTGATTGTGTAAGG - Intergenic
1132114041 15:99122993-99123015 TTTTCTTTGGAGGATGTAGAAGG + Intronic
1133109204 16:3535733-3535755 GGCTTTTTGTAGATTGTGGATGG - Intronic
1133507137 16:6423237-6423259 GTTTCTCTGCAGCTTGCGGAAGG - Intronic
1134195201 16:12154409-12154431 TTTTTTTTGGAGATTCTGGCAGG + Intronic
1134276122 16:12778019-12778041 GCTACTTGGGAGATTGAGGAAGG - Intronic
1134764419 16:16744257-16744279 GTTGCTTTGAAGATGGAGGAAGG + Intergenic
1134981639 16:18614957-18614979 GTTGCTTTGAAGATGGAGGAAGG - Intergenic
1135801872 16:25504815-25504837 GGTTCTTTGGTGATCTTGGAAGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137019233 16:35407101-35407123 TTTTATTTTGAGATTGGGGATGG - Intergenic
1139646962 16:68338505-68338527 GTCACTGTGGAGAGTGTGGAGGG + Intronic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1141688757 16:85584911-85584933 GCCTCCTTGGAGGTTGTGGATGG - Intergenic
1142452712 16:90190667-90190689 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1142805039 17:2367090-2367112 TTTTCCTGGGAGAGTGTGGAAGG - Intronic
1143664958 17:8352204-8352226 GTGTTTTTGGAGATGGTGGGGGG + Intergenic
1146368655 17:32249979-32250001 GTTACTTGGGAGATTGAGGTGGG - Intronic
1147377202 17:40029607-40029629 GTTGCTTTGGAGGTAGTGAAAGG - Intronic
1147876628 17:43626309-43626331 GCTTCTTTGGAGGTTGAGGTGGG - Intergenic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1151113302 17:71704550-71704572 GTTTCCTTGGAGATTTTGGAAGG - Intergenic
1151631006 17:75310808-75310830 GTTCCTTGGGAGATTGAGGTGGG + Intergenic
1152695872 17:81794822-81794844 CTTTCTCTGGAGATTGTGCGAGG - Intergenic
1153317938 18:3742498-3742520 TGTTCATTGGAGATTCTGGAAGG + Exonic
1153457437 18:5295932-5295954 TTTTTTTTGGAGTTTGGGGAGGG + Exonic
1154388385 18:13916091-13916113 GTTTCTGTGAAGTTTTTGGACGG - Intergenic
1155563255 18:27103451-27103473 GAGTCTTAGGAGTTTGTGGAGGG - Intronic
1156495481 18:37522876-37522898 GTTTCATGGGAGAGGGTGGATGG - Intronic
1157455642 18:47826494-47826516 GTTTTTGTGGAGGTTGTAGAAGG - Exonic
1157981327 18:52384838-52384860 TTTTCCTTGGGGATTGTGAAAGG - Intronic
1158604427 18:58882734-58882756 TTCTCTTTGGAGACTGGGGATGG - Intronic
1158611827 18:58947312-58947334 GTTTCAGTAGAGAGTGTGGATGG + Intronic
1159109375 18:64039207-64039229 GTTACTTGGGAGATTGAGGCAGG - Intergenic
1159507336 18:69354425-69354447 GTTTCTTTTGAGGTTGTAGCTGG - Intergenic
1160644773 19:178095-178117 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1161137871 19:2630965-2630987 GTTGCTTGGCTGATTGTGGAGGG - Intronic
1161213988 19:3084049-3084071 GTTTCTTGGGAGACTGAGGTGGG - Intergenic
1161387044 19:4000602-4000624 GTTTGTTTGTAGATTTGGGAGGG - Intergenic
1164925555 19:32127472-32127494 GCTTCTTTGGAGACTGAGGCAGG + Intergenic
1165235702 19:34419892-34419914 GCTACTTTGGAGAGTGTGGCAGG - Intronic
1165690827 19:37861971-37861993 GTTTCTTGGGAGACTGAGGCAGG + Intergenic
1167860588 19:52280246-52280268 GTTTCTTGGGAGGCTGAGGAGGG + Intronic
925120154 2:1411985-1412007 TCTTCTTGGGAGAATGTGGATGG - Intronic
925756827 2:7141309-7141331 GCTTGTTTGGAGATTCTAGAAGG + Intergenic
925780814 2:7380138-7380160 GGTTCTGTGGAGACTGGGGAAGG + Intergenic
925958256 2:8990925-8990947 GTATCTTTGGAGATAGTTAAGGG - Intronic
928066001 2:28165213-28165235 GTTTCTTTGAGGAATGTGAAGGG + Intronic
930238723 2:48913353-48913375 GTTGCTTTGAAGAATTTGGAGGG - Intergenic
930240151 2:48927826-48927848 GCTTCTTGGGAGACTGAGGAAGG + Intergenic
930765989 2:55085692-55085714 TTTTCTATGTAGATTGGGGAAGG - Intronic
930932319 2:56901861-56901883 GTTTCTTTGCAAATAGTAGAGGG + Intergenic
930973682 2:57428076-57428098 GATGCTTGGGAGATTGTGGTGGG + Intergenic
931611647 2:64107787-64107809 GTTACTTGGGAGATTGAGGCAGG - Intronic
931663480 2:64592000-64592022 TTTTCTTGAGAGCTTGTGGAAGG - Exonic
932375505 2:71232098-71232120 ATTACTTGGGAGACTGTGGAGGG - Intergenic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
935107781 2:100061820-100061842 ATCTCTTTGGTGATGGTGGAGGG - Intronic
935323885 2:101917378-101917400 GTCTTTTTTGAGATTGTAGATGG - Intergenic
936457928 2:112689433-112689455 GTTACTCTGGAGATTGAGGCAGG + Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938290735 2:130148699-130148721 GTTTATTTGGAGAGTGCGTATGG - Intergenic
939301516 2:140347449-140347471 TTTTTTTTGGAAATTGTGAAGGG - Intronic
939645201 2:144689137-144689159 TTTTCTTTTAAGATTGTGCATGG + Intergenic
940034662 2:149301451-149301473 GTTCCATTGGAGGTGGTGGAGGG + Intergenic
941333689 2:164212188-164212210 GTTTCTGTGGAGACTGAGGCAGG + Intergenic
941839918 2:170070581-170070603 GTTTCTTTGGAGATTCCTTATGG - Intronic
942139115 2:172959547-172959569 ATTTCTTATGAGATTGTGGTAGG - Intronic
942483180 2:176411425-176411447 TTTTCTTTGGAGATCTTGGGTGG - Intergenic
942706062 2:178774011-178774033 GTCTCCTTGGAAAGTGTGGAAGG - Exonic
944883695 2:204041516-204041538 GGGGCTCTGGAGATTGTGGATGG + Intergenic
946661161 2:222001302-222001324 TTTTCTCTTGAGATTTTGGATGG + Intergenic
948954530 2:241277637-241277659 GTTTCTTTGAAGATTGGGGAAGG - Intronic
1169369863 20:5020364-5020386 GCTACTTGGGAGACTGTGGAAGG + Intergenic
1170580796 20:17698094-17698116 GTTACTTTGGAGGTTGAGGCAGG + Intronic
1172818021 20:37705030-37705052 ACTTCATTGGAGAATGTGGATGG + Intronic
1174892090 20:54406346-54406368 TTTTTTGTAGAGATTGTGGAGGG - Intergenic
1175650370 20:60716364-60716386 ATTTCTTTAGAGCTTGGGGAAGG - Intergenic
1176280737 20:64307816-64307838 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1177282642 21:19003688-19003710 GCTTCTTAGGAGATTGAGGCAGG - Intergenic
1177646901 21:23910270-23910292 GTTTCATTGAAGATTCTGGCAGG - Intergenic
1177815923 21:25976643-25976665 GTTTTCTTGGAGTTTTTGGAAGG - Intronic
1178258782 21:31079710-31079732 GTGACTTGGGAGATAGTGGAGGG - Intergenic
1180589410 22:16923657-16923679 GCTTCTTGGGAGGATGTGGAGGG + Intergenic
1181512457 22:23394998-23395020 GTCTCTGTGGAAATTGGGGAAGG + Intergenic
1181516858 22:23419279-23419301 GTTTCTTTGCAGTGTTTGGATGG - Intergenic
1182568071 22:31214174-31214196 GTTTCTTAGAAAATTGTGAAAGG + Intronic
1183560298 22:38567741-38567763 GCTTCTCTAGAGATTGAGGAAGG + Intronic
949270932 3:2215769-2215791 GTTACTTGGGAGATTGAGGCAGG + Intronic
949615022 3:5744203-5744225 CTTTATTTGGAGATTATGTATGG + Intergenic
950420039 3:12892982-12893004 GTCTCTGTGGAGGTTGTGGGTGG - Intergenic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
951472429 3:23070804-23070826 GTTTCTTGGGAGGCTGTGGTGGG - Intergenic
951492446 3:23286675-23286697 GTTTCTGTGGAGAATGTCGTTGG + Intronic
951923168 3:27877842-27877864 GCTTCTGTGGTCATTGTGGAAGG + Intergenic
951982287 3:28578495-28578517 GTTTCTTTGGAGTCTGAGGATGG + Intergenic
951986577 3:28628100-28628122 CTTTCTTTGGAGATTAAGTATGG + Intergenic
951986804 3:28629991-28630013 CTTTCTTTGGAGATTAAGTATGG + Intergenic
952859548 3:37801667-37801689 GTTTTTTTTGAGGTTGTGCATGG - Intronic
954188277 3:48937112-48937134 GTTTGTTTGGAGATTTTAAAAGG + Intronic
955014356 3:55054760-55054782 TGTACTTTGGATATTGTGGATGG + Intronic
956115764 3:65916817-65916839 GTTTCTCTGGAGGTAGTGGCAGG - Intronic
956315001 3:67925289-67925311 GCTTCTTTGGAGGCTGAGGAGGG + Intergenic
957465880 3:80589934-80589956 GTTTGTTGGGAGTTTGTTGATGG + Intergenic
958383255 3:93339202-93339224 GTCTCTTTGTAGAATGTGCAAGG + Intergenic
958567389 3:95831572-95831594 GTTTCCCTGCAAATTGTGGAAGG - Intergenic
958745390 3:98127895-98127917 GTGTCTTAGGACTTTGTGGAAGG - Intergenic
959261229 3:104083402-104083424 GTTACTTGGGAGATTGAGGCAGG + Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959536170 3:107487549-107487571 GTTTCTTCCAACATTGTGGAGGG + Intergenic
960097281 3:113700408-113700430 GTTTCTTTGGGAAATATGGAAGG - Intergenic
960923174 3:122769043-122769065 GTTTCTCTGGAGGTTGAGGCAGG + Intronic
961080923 3:124027145-124027167 GTTGGTTTGGAGATGGAGGAAGG + Intergenic
962533582 3:136305901-136305923 GTACCTTTGGAAATTGTGAAGGG + Intronic
962853216 3:139323340-139323362 GTTTCTTGGGTGATTGTTGCGGG + Intronic
963207461 3:142651348-142651370 GCTTCTTTGGAGACTGAGGCAGG + Intronic
964884741 3:161468948-161468970 GTTGCTTGGGAGATTGAGGTGGG - Intergenic
965767141 3:172142870-172142892 GCTTCTTTGGTGTTTGAGGAAGG + Intronic
966245711 3:177805386-177805408 GTTACTTTGGAGACTGAGGCAGG + Intergenic
966657016 3:182370637-182370659 GCTACTTTGGAGGTTGTGGCGGG - Intergenic
968356336 3:198110463-198110485 TTTTGTTTTGAGATTGGGGATGG + Intergenic
970244611 4:14046855-14046877 GTTACAATGGAGACTGTGGAAGG + Intergenic
971793260 4:31196113-31196135 GCTTCTTGGGAGACTGAGGAAGG + Intergenic
975384600 4:73741438-73741460 GATTATTTGGAGACTATGGAAGG - Intronic
976470242 4:85419813-85419835 GTTTCTGTGGAATTGGTGGAGGG - Intergenic
976650011 4:87424106-87424128 TTTTGCTTGGAGATTGGGGAGGG + Intronic
977222456 4:94354208-94354230 GGTTCTTTGGAGATTGTCCATGG - Intergenic
978740693 4:112134802-112134824 GTTTCTCTGGAGGCTGTGGCGGG + Intergenic
978781448 4:112559308-112559330 GCTACTTTGGAGGTTGTGGTGGG - Intronic
979018957 4:115470020-115470042 TTTTCTTTAGATATTGTAGAAGG + Intergenic
979261590 4:118653569-118653591 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
979533372 4:121792818-121792840 GTTACTTGGGAGATTGAGGTGGG - Intergenic
979585809 4:122415570-122415592 GTTTCTTTGGAGATTGTGGATGG + Exonic
979595423 4:122529261-122529283 CTTTATTTGGAGATTAAGGATGG - Intergenic
982011706 4:151112027-151112049 GTTTCTTGGGACTGTGTGGATGG + Intronic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982306661 4:153939343-153939365 CTTTCTTTGGTGATTGTAGAAGG - Intergenic
983691096 4:170469861-170469883 GTTAATTTGGAGAATCTGGATGG - Intergenic
983800042 4:171916860-171916882 GTTCTTTTGGAGATTCTGAAAGG - Intronic
984007711 4:174333477-174333499 GCATCGTTTGAGATTGTGGAAGG + Intergenic
984440013 4:179756591-179756613 GTTACTTGGGAGATTGAGGCAGG - Intergenic
984790999 4:183614973-183614995 GATGCTTTGAAGATTGAGGAAGG + Intergenic
986198463 5:5559560-5559582 GTTTATTTGGAAATAGTGGAGGG - Intergenic
986614309 5:9601078-9601100 GTCTCTTTGGAGATGGAGGACGG - Intergenic
986768240 5:10947726-10947748 GTTTCATGGAAGATTCTGGAAGG - Intergenic
987002817 5:13677819-13677841 GTTTCTGTGTAAAATGTGGAAGG + Intergenic
988139395 5:27216919-27216941 GTTGCTTTTGTGATTGTTGATGG + Intergenic
988842772 5:35098939-35098961 GAATCTTTGGAGCTTGAGGATGG + Intronic
988959366 5:36354141-36354163 GGATCTTTGGAGAATGTGTATGG + Intergenic
989088662 5:37704791-37704813 GTGTCTTTGGAGAGTGAGGCAGG + Intronic
989369218 5:40688152-40688174 GTTTCCTTTGAGGTTGTGGTAGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989813989 5:45712944-45712966 GTTTGTTTGGAGATGTTGGCAGG - Intergenic
993300985 5:86209674-86209696 GTTACTTGGGAGACTGAGGAAGG + Intergenic
993653193 5:90547120-90547142 GTGTGTCTGGAGATTGTGCAAGG - Intronic
995006223 5:107199053-107199075 GTTTTTGTGGAGAATGTGGTAGG + Intergenic
995689909 5:114814008-114814030 AGTTCTTTGTAGATTCTGGATGG + Intergenic
996119151 5:119651527-119651549 CTTTCTCTGAAGGTTGTGGATGG + Intergenic
996288355 5:121822479-121822501 GATTTTCTGGAGATTGAGGAGGG + Intergenic
998314088 5:141164441-141164463 GTTTCTTTGTAGGATGTGCATGG + Intergenic
998650105 5:144109280-144109302 GATACTTTGGAAAATGTGGATGG - Intergenic
999107147 5:149083829-149083851 GTTGCTGTGGAGATTGTGTTTGG - Intergenic
999618072 5:153446283-153446305 GTTTCATGAGAGACTGTGGATGG + Intergenic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000243087 5:159426611-159426633 GGTTCTTTGGAGAATGTCGTAGG - Intergenic
1000422546 5:161055111-161055133 CTTTATTTGGAGATTATGAAAGG - Intergenic
1000649815 5:163803475-163803497 GTTACTATGGAGACTGTGTAAGG + Intergenic
1002732151 5:181346686-181346708 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1002752380 6:127419-127441 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1003501591 6:6707721-6707743 TTTTCTTTGGTGATGGAGGATGG - Intergenic
1004534707 6:16489391-16489413 ATTTTTTTTGAGTTTGTGGAGGG - Intronic
1004736918 6:18416069-18416091 GTTTCTTTGGAGAAAGTAGAAGG + Intronic
1004798772 6:19120767-19120789 GTTTCTTTTCAGATTTTTGAAGG + Intergenic
1005053448 6:21707423-21707445 GTTACTTGGGAGATTGAGGCAGG + Intergenic
1005800232 6:29414081-29414103 CTTTCTTTGGCAATTGTGAATGG - Intronic
1005855191 6:29855634-29855656 ATTTCTCTACAGATTGTGGAAGG - Intergenic
1005872922 6:29989348-29989370 ATTTCTCTAAAGATTGTGGAAGG - Intergenic
1006237120 6:32643219-32643241 GCTTCCTTGGAGATTTTAGATGG - Exonic
1006973027 6:38066593-38066615 TTTTGTTTGGGGCTTGTGGAAGG + Intronic
1007051276 6:38832867-38832889 ACAACTTTGGAGATTGTGGAAGG + Intronic
1007921330 6:45612193-45612215 GTATTTATGGAGATTGTGGGAGG - Intronic
1007956138 6:45919414-45919436 GTATCCTTCCAGATTGTGGAGGG - Intronic
1008668544 6:53742792-53742814 GTGTTTTTTAAGATTGTGGATGG - Intergenic
1008959628 6:57253157-57253179 TTTTCTTAGGAAATTGAGGAGGG - Intergenic
1011757575 6:90518531-90518553 GATTCTTTGGAGTTTGGGCACGG + Exonic
1012817449 6:104041889-104041911 GTTTCTGTGGCTATTGTAGATGG - Intergenic
1012865380 6:104612226-104612248 GTTCCTTTAGAGATTGGAGATGG - Intergenic
1014550331 6:122782783-122782805 GTTTCTGTGGAGATGGAGGTGGG + Intronic
1015465688 6:133545998-133546020 GGGACTTTGGAGACTGTGGAGGG + Intergenic
1016313081 6:142755898-142755920 GTTTCTTTGGAGGATGAAGAAGG - Intronic
1017081933 6:150677763-150677785 GCTACTTGGGAGATTGAGGAGGG + Intronic
1017229521 6:152057660-152057682 GTTCCTTTAGGGAATGTGGAGGG - Intronic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018425538 6:163677152-163677174 CTTTCTTTGAAGATTATGTATGG + Intergenic
1019236403 6:170618999-170619021 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1020420343 7:7996771-7996793 GTTTCTTTCCAGATTCTGCAGGG + Intronic
1021304250 7:19011878-19011900 GTTTCTTTGGAGACTGTTTCTGG - Intergenic
1021578108 7:22123438-22123460 GTTGCTTTGTAGATTATGCATGG + Intronic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1021907145 7:25345760-25345782 GTTTGTTTGCTGATTCTGGATGG + Intergenic
1022801148 7:33778672-33778694 GTTACTTAGGAGACTGAGGATGG + Intergenic
1023682562 7:42702587-42702609 GTTTCTTTAAACATTGTTGAAGG + Intergenic
1024311844 7:47976762-47976784 GATTCCTAGGAAATTGTGGAAGG - Exonic
1025007434 7:55365602-55365624 TTTTCTTTGGAAATCGCGGAGGG + Exonic
1025578518 7:62679673-62679695 GTTTCTGTCGAGTTTGTGAATGG + Intergenic
1025899965 7:65736184-65736206 GTTACTTGGGAGATTGAGGCAGG - Intergenic
1026148808 7:67771149-67771171 GCTCCTTTGGAGGTTGAGGAGGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027679242 7:81198581-81198603 TTTTCTTTTGAGATTGGAGATGG + Intronic
1028896154 7:96044359-96044381 GTGTCTTTGGAGTTTGTTGAGGG + Intronic
1029586274 7:101473739-101473761 GCTACTTGGGAGATTGTGGTGGG + Intronic
1029684624 7:102138070-102138092 GCTACTTTGGAGACTGAGGAGGG + Intronic
1033501187 7:141951258-141951280 GTTTCTTTGGAGGTTACTGAAGG - Intronic
1033876746 7:145829396-145829418 TTTTTTGTTGAGATTGTGGAGGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034055760 7:148033299-148033321 GTGTCTCTGGAGATTGGGGGTGG - Intronic
1034352890 7:150428745-150428767 GTGTCTGTGGAGAGTGTGGTTGG - Intergenic
1035511368 8:187608-187630 TTTTCTTTTGTGATTGGGGAGGG + Intergenic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1036530399 8:9580147-9580169 GTTTCTTTTTAGGTTTTGGAAGG + Exonic
1036607134 8:10317505-10317527 TCTTCTTTGGAGAAAGTGGATGG + Intronic
1037660913 8:20926122-20926144 GTTTCTTTGGTGGGGGTGGAGGG + Intergenic
1038000422 8:23386841-23386863 ATTTATTTGGAGCGTGTGGAGGG - Intronic
1038711282 8:29948921-29948943 GTTTCTTAGAAGATTAAGGAAGG + Intergenic
1038827263 8:31018046-31018068 GTTTCTTTGAAGATTATAAAAGG + Intronic
1039627774 8:39072493-39072515 TTTTTTTTGGTGATTGTGTAGGG + Intronic
1040568215 8:48585706-48585728 GTTTCTGGGGAGATGTTGGAGGG + Intergenic
1040794927 8:51279158-51279180 ATTTGTTTGCACATTGTGGATGG + Intergenic
1041302511 8:56428009-56428031 GTTTTTGTGGATATTGTGCATGG + Intergenic
1041421620 8:57673038-57673060 GTTTGTTTGCACTTTGTGGATGG + Intergenic
1043245260 8:77991382-77991404 GTTTTTTCGGAGATGGTGGCAGG + Intergenic
1044290953 8:90469178-90469200 GTTTCTTGGGAGATTGAGGCGGG - Intergenic
1046018917 8:108640062-108640084 GTTACTTTTGAGAGTATGGAGGG - Intronic
1046623140 8:116549236-116549258 GTTTCAATGGAAATTTTGGAGGG - Intergenic
1048658947 8:136574455-136574477 CTTTTCTTGGAGATTGAGGAAGG - Intergenic
1049548130 8:143244097-143244119 GTCTCTTTTGAGATAGGGGAAGG + Intergenic
1049965301 9:774021-774043 GTTACTTTGGAGAATGAGGCAGG + Intergenic
1050663867 9:7913252-7913274 TTTTCTATGGACATTGTGGGTGG + Intergenic
1052572889 9:30251044-30251066 CTTTCTTTGGTGCATGTGGATGG - Intergenic
1052663091 9:31460928-31460950 GTTACTTTGGAGACTGAGGCAGG + Intergenic
1052684210 9:31733715-31733737 GCTTTTGTGGAGGTTGTGGAGGG + Intergenic
1053077855 9:35150262-35150284 GTAACTTTGGAGATTGTGATCGG + Intergenic
1053581252 9:39406858-39406880 GTTGCTTTGGAGACTGAGGCAGG - Intergenic
1053845738 9:42234912-42234934 GTTGCTTTGGAGACTGAGGCAGG - Intergenic
1054102839 9:60965657-60965679 GTTGCTTTGGAGACTGAGGCAGG - Intergenic
1054583521 9:66941203-66941225 GTTGCTTTGGAGACTGAGGCAGG + Intergenic
1054918615 9:70519593-70519615 GCTACTTTGGAGGTTGAGGAGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056563518 9:87754050-87754072 CTTTCTTTGAAGATTGAGTATGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058342067 9:103910068-103910090 GTTTCTTTGGGTCTTGTGGGTGG - Intergenic
1059130184 9:111739846-111739868 GTTTCTTTCAACTTTGTGGAAGG + Intronic
1061616527 9:131783843-131783865 CTTTCTGTGGCGATTGTGAATGG + Intergenic
1062756553 9:138299011-138299033 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1188375703 X:29425412-29425434 GTTTTTTTTGAGAATGAGGATGG + Intronic
1190328988 X:49224262-49224284 TTCTCTTTGGGGATTGAGGATGG + Intronic
1190476068 X:50828733-50828755 GTTTCTTTGGTCATTGTGGTTGG - Intergenic
1190958245 X:55218808-55218830 GTTTCTGTGGCAATTGTGAATGG + Intronic
1192146694 X:68687443-68687465 GCTACTTTGGAGACTGAGGAGGG - Intronic
1193247579 X:79247344-79247366 TTTTCTTTGTTGATTTTGGAAGG - Intergenic
1193960655 X:87921288-87921310 GATTCTTTGAAGATTTTTGAGGG + Intergenic
1194569257 X:95533004-95533026 GTTTCTTTGTACATTGAGGAGGG + Intergenic
1194685616 X:96910370-96910392 GCTTCTATGTATATTGTGGATGG + Intronic
1197801103 X:130349923-130349945 CTTTTTTTGGGGATTGTGAAGGG + Intronic
1198340009 X:135704565-135704587 GGTTCTTTGAAAATTGTGCAGGG - Intergenic
1198559005 X:137828047-137828069 GTTTCTATGGTGATTATGTATGG + Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic
1201934072 Y:19386909-19386931 GTTGCTTTGGATATTTTTGATGG + Intergenic
1202383675 Y:24302028-24302050 TTTTCTTTTGTGATTGGGGAGGG - Intergenic
1202487108 Y:25368092-25368114 TTTTCTTTTGTGATTGGGGAGGG + Intergenic