ID: 979589127

View in Genome Browser
Species Human (GRCh38)
Location 4:122458189-122458211
Sequence ATGAAGAAAAGGTCAGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979589123_979589127 -4 Left 979589123 4:122458170-122458192 CCCTCAAGTAGAAAAAAAAATGA 0: 1
1: 0
2: 22
3: 147
4: 1683
Right 979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG No data
979589124_979589127 -5 Left 979589124 4:122458171-122458193 CCTCAAGTAGAAAAAAAAATGAA No data
Right 979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979589127 Original CRISPR ATGAAGAAAAGGTCAGATTA GGG Intergenic
No off target data available for this crispr