ID: 979591764

View in Genome Browser
Species Human (GRCh38)
Location 4:122489224-122489246
Sequence GTTCCCAGACAAGCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979591764_979591765 2 Left 979591764 4:122489224-122489246 CCAGCTTGTGCTTGTCTGGGAAC No data
Right 979591765 4:122489249-122489271 TATTTCCCTTTCTTTTCTGAAGG No data
979591764_979591769 30 Left 979591764 4:122489224-122489246 CCAGCTTGTGCTTGTCTGGGAAC No data
Right 979591769 4:122489277-122489299 TTTGTTGGACATAGTATTCTTGG No data
979591764_979591768 15 Left 979591764 4:122489224-122489246 CCAGCTTGTGCTTGTCTGGGAAC No data
Right 979591768 4:122489262-122489284 TTTCTGAAGGATAGCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979591764 Original CRISPR GTTCCCAGACAAGCACAAGC TGG (reversed) Intergenic
No off target data available for this crispr