ID: 979595735

View in Genome Browser
Species Human (GRCh38)
Location 4:122532215-122532237
Sequence AGTTCTCTGAAGATGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979595731_979595735 17 Left 979595731 4:122532175-122532197 CCAGTAGTAAGCCAAAAATCATT No data
Right 979595735 4:122532215-122532237 AGTTCTCTGAAGATGATAGCAGG No data
979595732_979595735 6 Left 979595732 4:122532186-122532208 CCAAAAATCATTTCTCAAAAAAA No data
Right 979595735 4:122532215-122532237 AGTTCTCTGAAGATGATAGCAGG No data
979595730_979595735 18 Left 979595730 4:122532174-122532196 CCCAGTAGTAAGCCAAAAATCAT No data
Right 979595735 4:122532215-122532237 AGTTCTCTGAAGATGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979595735 Original CRISPR AGTTCTCTGAAGATGATAGC AGG Intergenic
No off target data available for this crispr