ID: 979601191

View in Genome Browser
Species Human (GRCh38)
Location 4:122587979-122588001
Sequence CACTGATGGGAGGAATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979601176_979601191 28 Left 979601176 4:122587928-122587950 CCAACCACACATAGTGAACCATT No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data
979601185_979601191 1 Left 979601185 4:122587955-122587977 CCTGTGTGGTGATGGCAGGTGGG No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data
979601183_979601191 2 Left 979601183 4:122587954-122587976 CCCTGTGTGGTGATGGCAGGTGG No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data
979601182_979601191 3 Left 979601182 4:122587953-122587975 CCCCTGTGTGGTGATGGCAGGTG No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data
979601179_979601191 10 Left 979601179 4:122587946-122587968 CCATTCACCCCTGTGTGGTGATG No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data
979601177_979601191 24 Left 979601177 4:122587932-122587954 CCACACATAGTGAACCATTCACC No data
Right 979601191 4:122587979-122588001 CACTGATGGGAGGAATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979601191 Original CRISPR CACTGATGGGAGGAATAAGG TGG Intergenic
No off target data available for this crispr