ID: 979602626

View in Genome Browser
Species Human (GRCh38)
Location 4:122603293-122603315
Sequence TGGAACATAGGGCAGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979602626_979602633 25 Left 979602626 4:122603293-122603315 CCTGACAACTGCCCTATGTTCCA No data
Right 979602633 4:122603341-122603363 TTGCTTTAGGCAGACAGTAAGGG 0: 22
1: 22
2: 12
3: 34
4: 267
979602626_979602630 12 Left 979602626 4:122603293-122603315 CCTGACAACTGCCCTATGTTCCA No data
Right 979602630 4:122603328-122603350 GAAGTTAGCCAGCTTGCTTTAGG No data
979602626_979602632 24 Left 979602626 4:122603293-122603315 CCTGACAACTGCCCTATGTTCCA No data
Right 979602632 4:122603340-122603362 CTTGCTTTAGGCAGACAGTAAGG 0: 24
1: 24
2: 16
3: 29
4: 164
979602626_979602635 30 Left 979602626 4:122603293-122603315 CCTGACAACTGCCCTATGTTCCA No data
Right 979602635 4:122603346-122603368 TTAGGCAGACAGTAAGGGAAGGG 0: 16
1: 31
2: 75
3: 253
4: 544
979602626_979602634 29 Left 979602626 4:122603293-122603315 CCTGACAACTGCCCTATGTTCCA No data
Right 979602634 4:122603345-122603367 TTTAGGCAGACAGTAAGGGAAGG 0: 14
1: 26
2: 21
3: 52
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979602626 Original CRISPR TGGAACATAGGGCAGTTGTC AGG (reversed) Intergenic
No off target data available for this crispr