ID: 979602672

View in Genome Browser
Species Human (GRCh38)
Location 4:122603596-122603618
Sequence GAAGGAGGCAACCGGATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979602664_979602672 17 Left 979602664 4:122603556-122603578 CCTCCAGGAATTCATGCCTTAAG No data
Right 979602672 4:122603596-122603618 GAAGGAGGCAACCGGATTTCAGG No data
979602668_979602672 1 Left 979602668 4:122603572-122603594 CCTTAAGCTGGGATATTTAACTG No data
Right 979602672 4:122603596-122603618 GAAGGAGGCAACCGGATTTCAGG No data
979602665_979602672 14 Left 979602665 4:122603559-122603581 CCAGGAATTCATGCCTTAAGCTG No data
Right 979602672 4:122603596-122603618 GAAGGAGGCAACCGGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979602672 Original CRISPR GAAGGAGGCAACCGGATTTC AGG Intergenic
No off target data available for this crispr