ID: 979603349

View in Genome Browser
Species Human (GRCh38)
Location 4:122609743-122609765
Sequence CTGAACATGGAGGAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979603340_979603349 28 Left 979603340 4:122609692-122609714 CCAGATGATGGCAGACGTTGGAT No data
Right 979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG No data
979603339_979603349 29 Left 979603339 4:122609691-122609713 CCCAGATGATGGCAGACGTTGGA No data
Right 979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979603349 Original CRISPR CTGAACATGGAGGAGTGGCC AGG Intergenic
No off target data available for this crispr