ID: 979603349 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:122609743-122609765 |
Sequence | CTGAACATGGAGGAGTGGCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
979603340_979603349 | 28 | Left | 979603340 | 4:122609692-122609714 | CCAGATGATGGCAGACGTTGGAT | No data | ||
Right | 979603349 | 4:122609743-122609765 | CTGAACATGGAGGAGTGGCCAGG | No data | ||||
979603339_979603349 | 29 | Left | 979603339 | 4:122609691-122609713 | CCCAGATGATGGCAGACGTTGGA | No data | ||
Right | 979603349 | 4:122609743-122609765 | CTGAACATGGAGGAGTGGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
979603349 | Original CRISPR | CTGAACATGGAGGAGTGGCC AGG | Intergenic | ||
No off target data available for this crispr |