ID: 979607139

View in Genome Browser
Species Human (GRCh38)
Location 4:122650726-122650748
Sequence TCACAAAGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 843812
Summary {0: 1786, 1: 298626, 2: 265319, 3: 148850, 4: 129231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979607139_979607148 8 Left 979607139 4:122650726-122650748 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 979607148 4:122650757-122650779 TGGATGGATCACTTGAGGCCAGG 0: 119
1: 2521
2: 16879
3: 63310
4: 124965
979607139_979607150 26 Left 979607139 4:122650726-122650748 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 979607150 4:122650775-122650797 CCAGGAATTCAAGACAAGCCTGG 0: 36
1: 2128
2: 26393
3: 102481
4: 168758
979607139_979607147 3 Left 979607139 4:122650726-122650748 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 979607147 4:122650752-122650774 CAAGGTGGATGGATCACTTGAGG 0: 156
1: 3372
2: 16520
3: 43563
4: 77233
979607139_979607145 -8 Left 979607139 4:122650726-122650748 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 979607145 4:122650741-122650763 CTTTGTGAGGCCAAGGTGGATGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979607139 Original CRISPR TCACAAAGTGCTGGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr