ID: 979607145

View in Genome Browser
Species Human (GRCh38)
Location 4:122650741-122650763
Sequence CTTTGTGAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979607139_979607145 -8 Left 979607139 4:122650726-122650748 CCTGTAATCCCAGCACTTTGTGA 0: 1786
1: 298626
2: 265319
3: 148850
4: 129231
Right 979607145 4:122650741-122650763 CTTTGTGAGGCCAAGGTGGATGG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979607145 Original CRISPR CTTTGTGAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr