ID: 979610519

View in Genome Browser
Species Human (GRCh38)
Location 4:122684226-122684248
Sequence AAAGCCAAACCCTGGTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979610519_979610529 9 Left 979610519 4:122684226-122684248 CCCCCCTACCAGGGTTTGGCTTT No data
Right 979610529 4:122684258-122684280 AGTTGGCCTCTCTTTGCCTCGGG No data
979610519_979610532 27 Left 979610519 4:122684226-122684248 CCCCCCTACCAGGGTTTGGCTTT No data
Right 979610532 4:122684276-122684298 TCGGGTTTCTCATGCCTTAAAGG No data
979610519_979610533 30 Left 979610519 4:122684226-122684248 CCCCCCTACCAGGGTTTGGCTTT No data
Right 979610533 4:122684279-122684301 GGTTTCTCATGCCTTAAAGGAGG No data
979610519_979610528 8 Left 979610519 4:122684226-122684248 CCCCCCTACCAGGGTTTGGCTTT No data
Right 979610528 4:122684257-122684279 TAGTTGGCCTCTCTTTGCCTCGG No data
979610519_979610527 -8 Left 979610519 4:122684226-122684248 CCCCCCTACCAGGGTTTGGCTTT No data
Right 979610527 4:122684241-122684263 TTGGCTTTGGGCAAGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979610519 Original CRISPR AAAGCCAAACCCTGGTAGGG GGG (reversed) Intergenic
No off target data available for this crispr