ID: 979620339

View in Genome Browser
Species Human (GRCh38)
Location 4:122791450-122791472
Sequence ATGAGGGGCAGGCCCTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979620339_979620350 15 Left 979620339 4:122791450-122791472 CCCAGACAGGGCCTGCCCCTCAT No data
Right 979620350 4:122791488-122791510 CACATGGCTACTTGAGATCTAGG No data
979620339_979620347 -1 Left 979620339 4:122791450-122791472 CCCAGACAGGGCCTGCCCCTCAT No data
Right 979620347 4:122791472-122791494 TAGCCATCCTGGGTGACACATGG No data
979620339_979620351 24 Left 979620339 4:122791450-122791472 CCCAGACAGGGCCTGCCCCTCAT No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620339_979620352 25 Left 979620339 4:122791450-122791472 CCCAGACAGGGCCTGCCCCTCAT No data
Right 979620352 4:122791498-122791520 CTTGAGATCTAGGATGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979620339 Original CRISPR ATGAGGGGCAGGCCCTGTCT GGG (reversed) Intergenic
No off target data available for this crispr