ID: 979620340

View in Genome Browser
Species Human (GRCh38)
Location 4:122791451-122791473
Sequence TATGAGGGGCAGGCCCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979620340_979620351 23 Left 979620340 4:122791451-122791473 CCAGACAGGGCCTGCCCCTCATA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620340_979620350 14 Left 979620340 4:122791451-122791473 CCAGACAGGGCCTGCCCCTCATA No data
Right 979620350 4:122791488-122791510 CACATGGCTACTTGAGATCTAGG No data
979620340_979620352 24 Left 979620340 4:122791451-122791473 CCAGACAGGGCCTGCCCCTCATA No data
Right 979620352 4:122791498-122791520 CTTGAGATCTAGGATGACTAGGG No data
979620340_979620347 -2 Left 979620340 4:122791451-122791473 CCAGACAGGGCCTGCCCCTCATA No data
Right 979620347 4:122791472-122791494 TAGCCATCCTGGGTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979620340 Original CRISPR TATGAGGGGCAGGCCCTGTC TGG (reversed) Intergenic
No off target data available for this crispr