ID: 979620341

View in Genome Browser
Species Human (GRCh38)
Location 4:122791461-122791483
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979620341_979620352 14 Left 979620341 4:122791461-122791483 CCTGCCCCTCATAGCCATCCTGG No data
Right 979620352 4:122791498-122791520 CTTGAGATCTAGGATGACTAGGG No data
979620341_979620350 4 Left 979620341 4:122791461-122791483 CCTGCCCCTCATAGCCATCCTGG No data
Right 979620350 4:122791488-122791510 CACATGGCTACTTGAGATCTAGG No data
979620341_979620351 13 Left 979620341 4:122791461-122791483 CCTGCCCCTCATAGCCATCCTGG No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979620341 Original CRISPR CCAGGATGGCTATGAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr