ID: 979620346

View in Genome Browser
Species Human (GRCh38)
Location 4:122791467-122791489
Sequence TGTCACCCAGGATGGCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979620346_979620351 7 Left 979620346 4:122791467-122791489 CCTCATAGCCATCCTGGGTGACA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620346_979620352 8 Left 979620346 4:122791467-122791489 CCTCATAGCCATCCTGGGTGACA No data
Right 979620352 4:122791498-122791520 CTTGAGATCTAGGATGACTAGGG No data
979620346_979620350 -2 Left 979620346 4:122791467-122791489 CCTCATAGCCATCCTGGGTGACA No data
Right 979620350 4:122791488-122791510 CACATGGCTACTTGAGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979620346 Original CRISPR TGTCACCCAGGATGGCTATG AGG (reversed) Intergenic
No off target data available for this crispr