ID: 979620351

View in Genome Browser
Species Human (GRCh38)
Location 4:122791497-122791519
Sequence ACTTGAGATCTAGGATGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979620346_979620351 7 Left 979620346 4:122791467-122791489 CCTCATAGCCATCCTGGGTGACA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620344_979620351 9 Left 979620344 4:122791465-122791487 CCCCTCATAGCCATCCTGGGTGA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620345_979620351 8 Left 979620345 4:122791466-122791488 CCCTCATAGCCATCCTGGGTGAC No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620349_979620351 -5 Left 979620349 4:122791479-122791501 CCTGGGTGACACATGGCTACTTG No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620339_979620351 24 Left 979620339 4:122791450-122791472 CCCAGACAGGGCCTGCCCCTCAT No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620340_979620351 23 Left 979620340 4:122791451-122791473 CCAGACAGGGCCTGCCCCTCATA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620348_979620351 -1 Left 979620348 4:122791475-122791497 CCATCCTGGGTGACACATGGCTA No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data
979620341_979620351 13 Left 979620341 4:122791461-122791483 CCTGCCCCTCATAGCCATCCTGG No data
Right 979620351 4:122791497-122791519 ACTTGAGATCTAGGATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979620351 Original CRISPR ACTTGAGATCTAGGATGACT AGG Intergenic
No off target data available for this crispr