ID: 979628473

View in Genome Browser
Species Human (GRCh38)
Location 4:122873182-122873204
Sequence ACTCCTGGCTTTCCACATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979628471_979628473 -6 Left 979628471 4:122873165-122873187 CCTTGCTCTTGAACTGTACTCCT 0: 1
1: 0
2: 1
3: 10
4: 184
Right 979628473 4:122873182-122873204 ACTCCTGGCTTTCCACATCTTGG No data
979628470_979628473 22 Left 979628470 4:122873137-122873159 CCAAATGTTTGGGTTGGTGGGGA 0: 1
1: 0
2: 2
3: 14
4: 113
Right 979628473 4:122873182-122873204 ACTCCTGGCTTTCCACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979628473 Original CRISPR ACTCCTGGCTTTCCACATCT TGG Intronic
No off target data available for this crispr