ID: 979629542

View in Genome Browser
Species Human (GRCh38)
Location 4:122884758-122884780
Sequence AGGAGTGGACTAGTATTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979629536_979629542 27 Left 979629536 4:122884708-122884730 CCCAGTAAACAGAGCATGGGGAA 0: 1
1: 0
2: 1
3: 14
4: 189
Right 979629542 4:122884758-122884780 AGGAGTGGACTAGTATTGTGAGG No data
979629537_979629542 26 Left 979629537 4:122884709-122884731 CCAGTAAACAGAGCATGGGGAAA 0: 1
1: 0
2: 2
3: 14
4: 179
Right 979629542 4:122884758-122884780 AGGAGTGGACTAGTATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979629542 Original CRISPR AGGAGTGGACTAGTATTGTG AGG Intronic
No off target data available for this crispr