ID: 979629823

View in Genome Browser
Species Human (GRCh38)
Location 4:122887755-122887777
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979629823 Original CRISPR ACACCTCAAGGTTCCCCTGG AGG (reversed) Intronic