ID: 979633057

View in Genome Browser
Species Human (GRCh38)
Location 4:122924681-122924703
Sequence GACACTGAAGAGACTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979633057_979633058 20 Left 979633057 4:122924681-122924703 CCATCTATAGTCTCTTCAGTGTC 0: 1
1: 0
2: 0
3: 21
4: 177
Right 979633058 4:122924724-122924746 TTTGTTTTTGCGCCTTGATGTGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979633057 Original CRISPR GACACTGAAGAGACTATAGA TGG (reversed) Intronic
901211379 1:7527985-7528007 GACTCTGAAGCCACTAGAGACGG + Intronic
905210389 1:36369976-36369998 GACCCTGAAGAAAGTACAGATGG + Intronic
907191965 1:52657069-52657091 TTCACTGAAGAGACTCCAGAAGG - Intronic
907643623 1:56218285-56218307 GACCTTGAGGAGATTATAGAGGG - Intergenic
908766718 1:67560910-67560932 GAGGCTGAAGAAACTAGAGATGG - Intergenic
909101454 1:71354436-71354458 GACAGTGTTGAGACTATTGAGGG - Intergenic
909193709 1:72588559-72588581 GACACTGAAGATACTAAGGCAGG - Intergenic
912343245 1:108938605-108938627 AACACTGAATAGACCATGGAGGG + Intronic
913045631 1:115071428-115071450 GACACTGAAGACAGCAGAGAGGG + Intronic
915627768 1:157126162-157126184 GACAGTGAAGAGCCTAGAGAAGG - Intronic
917148323 1:171916819-171916841 GACAGAGAAGAGTCTACAGAAGG - Intronic
918615192 1:186536393-186536415 GCCACTGAAGAGACTAAAACAGG - Intergenic
918703557 1:187635318-187635340 GAGACTGGAGAGAGTGTAGAAGG + Intergenic
919012251 1:191980451-191980473 GAAACTGAAGAGGATATAAATGG - Intergenic
920712109 1:208305028-208305050 GACACTTAAGGGACTAAATACGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923446998 1:234081109-234081131 AAGACTGAAGAGACTGAAGAAGG - Intronic
1063886949 10:10589306-10589328 CCCACTTAAGAGACAATAGATGG + Intergenic
1065416445 10:25492373-25492395 GCCACTGAAGAAGCTAGAGATGG - Intronic
1066086539 10:31977308-31977330 GACAGTGGAGAACCTATAGAGGG + Intergenic
1068245894 10:54367382-54367404 GACACTGAAAAGATTAGAGAGGG + Intronic
1071254069 10:83851829-83851851 AAAACTGAAGAGACTTTAAATGG - Intergenic
1078971969 11:16424660-16424682 GAAACAGAAAAGACTATGGATGG + Intronic
1082281827 11:50278825-50278847 GACACTCAAGAAACGACAGACGG + Intergenic
1083347244 11:62002137-62002159 GGCACTGAAGAGAAAACAGAAGG + Intergenic
1087122554 11:94589920-94589942 GATACTCAAGAAACTATTGATGG + Intronic
1088770498 11:113031389-113031411 GACACTAAATAGACCGTAGAAGG + Intronic
1089926717 11:122266293-122266315 TACACTGACGAGATTATTGAAGG - Intergenic
1090424029 11:126594749-126594771 GACACTGAATAGAACATAGAAGG + Intronic
1092580380 12:9834984-9835006 GACACTAGAGAGGCTATGGAAGG + Intronic
1092592301 12:9963464-9963486 GACACTAGAGAGGCTATGGAAGG + Intronic
1093274275 12:17104614-17104636 GACAAAGAATAGCCTATAGATGG + Intergenic
1093843568 12:23937737-23937759 GACATAGAAGAGATTATGGAGGG + Intronic
1094776388 12:33733186-33733208 GACACTTAATAGGATATAGAAGG - Intergenic
1095961469 12:47837395-47837417 GACACTGAAGAGATCATGGTGGG + Intergenic
1096407652 12:51355422-51355444 GAAAATGAAGAAAATATAGAGGG + Intronic
1097223356 12:57462847-57462869 GACACTGCAGAGATTGTACACGG + Intronic
1100096450 12:91044085-91044107 TGCACTGAAGAGATTTTAGATGG - Intergenic
1103221025 12:119245661-119245683 GGCATTGAATAGACTACAGACGG - Intergenic
1104016221 12:124964284-124964306 GACACGGAACATACTACAGATGG + Intronic
1108092961 13:46868983-46869005 GAATCTGAAGAGACTAAAAAGGG + Intronic
1109118626 13:58424997-58425019 GAAAATGAAGAAACTAGAGAGGG - Intergenic
1109636505 13:65124722-65124744 GGCACTGGTGTGACTATAGAAGG + Intergenic
1109890386 13:68603938-68603960 GACAGGGAAGATACTAGAGAGGG - Intergenic
1110686065 13:78375708-78375730 GACTCTGATGAAAGTATAGAAGG + Intergenic
1110686756 13:78384588-78384610 GCTACTGAAGAGACCATATAGGG - Intergenic
1111689208 13:91540217-91540239 GACCCTGAAGAGAGTCTGGAAGG - Intronic
1114310066 14:21458299-21458321 GACATTGGTAAGACTATAGATGG + Intergenic
1114918374 14:27295498-27295520 GACACTTAATAGACTATCCAGGG + Intergenic
1115261821 14:31462124-31462146 GACACAGAATAGGATATAGAAGG + Intergenic
1116925872 14:50636469-50636491 GAGAATGAGTAGACTATAGAAGG + Intronic
1119948359 14:78718354-78718376 TACACTGAAGAAAGCATAGATGG + Intronic
1120926878 14:89806054-89806076 TGCACTGAAGAGGCTATTGAGGG + Intronic
1125506549 15:40270929-40270951 GACACTGAAAAGACTCTGGTGGG + Intronic
1129545782 15:76393484-76393506 GAGACTGCAGAGAGAATAGAAGG + Intronic
1131321538 15:91397834-91397856 GACACAGAAGTGATTATAAAGGG - Intergenic
1131792225 15:95977707-95977729 GAGACTAAAGATAATATAGATGG + Intergenic
1132354766 15:101163082-101163104 GACACTGCAGCGTCTATAGAAGG + Intergenic
1135672074 16:24384006-24384028 AGCACTGAACAGACTTTAGAGGG - Intergenic
1135868976 16:26131388-26131410 GACAGGGAATAGACTATGGAGGG - Intronic
1140633241 16:76880413-76880435 GAAACAGAAGAAATTATAGAAGG + Intergenic
1142020741 16:87780574-87780596 GACACTGAAGAGACACCAGGTGG - Intergenic
1143059177 17:4185632-4185654 GACACTGAAGAAACTAAGGGTGG - Intronic
1144053366 17:11516788-11516810 GTCACTGCAGAGACTATCCATGG - Intronic
1144075336 17:11714552-11714574 AAAAGGGAAGAGACTATAGAAGG - Intronic
1145804810 17:27719020-27719042 GACACTGAAAAGCCCATACATGG + Intergenic
1147696860 17:42361707-42361729 TACACTGTAGAGACTGTACAAGG + Intronic
1148333386 17:46825339-46825361 GAGACAGAAGAGACCAAAGATGG - Intronic
1148972549 17:51497048-51497070 AACACTGAAGTGTCTTTAGAGGG - Intergenic
1149756538 17:59191067-59191089 GACACTGATGAGAGACTAGAGGG + Intronic
1149823761 17:59807508-59807530 GACAATAAAGAGAATATAGAAGG - Intronic
1153366816 18:4265696-4265718 GACACTGAAGAGAGGAGGGAAGG - Intronic
1153469168 18:5424025-5424047 CACACTAAAGATACTAAAGAAGG + Intronic
1156068571 18:33175815-33175837 GACAGTAAAGAGAGAATAGAGGG - Intronic
1158713442 18:59857677-59857699 GACACTGAGGAGTCTACAGAGGG - Intergenic
1162885711 19:13695452-13695474 GACAAAAAAGAGACAATAGAAGG - Intergenic
1163841510 19:19613739-19613761 GACACTGAGGAGATTCTAGAGGG - Intronic
1164214349 19:23130712-23130734 GACAGGGAAGTGACTATAAAAGG + Intronic
1164292030 19:23877694-23877716 GAGACTGGAAAGACCATAGAAGG + Intergenic
1164408421 19:27975805-27975827 GACACTTAAGAAAATATAAAGGG + Intergenic
1164625028 19:29721759-29721781 GGCCCTGACGAGACTTTAGAAGG + Intergenic
925192518 2:1896673-1896695 GACACTGTGGACACTAGAGAGGG + Intronic
926367662 2:12147851-12147873 GACATTGAAGATACTATGAATGG - Intergenic
926556931 2:14369033-14369055 GAAACTGTAGAGTTTATAGAAGG - Intergenic
927025812 2:19068007-19068029 AACACTGAGGAGACTGTAGAGGG - Intergenic
930278726 2:49343801-49343823 GACTCTTAAGAGACCATAGTGGG - Intergenic
930921859 2:56765587-56765609 CACACTGAAGAGAACTTAGATGG + Intergenic
932189169 2:69724560-69724582 GACACTGAAGAGAATTGAGGGGG - Intronic
932537433 2:72614396-72614418 GACACTGAACAGCCTGTATATGG + Intronic
935284452 2:101551626-101551648 AACACTGAGAAGACTATTGAAGG + Intergenic
935938969 2:108218547-108218569 GACACTAAATAGTCTAAAGACGG + Intergenic
936751388 2:115646387-115646409 GAAATTGAAGAGATTATATATGG + Intronic
936907218 2:117550983-117551005 GAAACAAAAGAGACAATAGATGG + Intergenic
938760387 2:134420413-134420435 GAAACTGAAGAGACTGATGACGG + Intronic
939791193 2:146579140-146579162 GACACTGGTGTGATTATAGATGG + Intergenic
942587231 2:177494725-177494747 GACACAGTAAAGACTAGAGAAGG - Intronic
942697903 2:178666637-178666659 GTCACTCAAGAGACAACAGAGGG - Intronic
943301904 2:186213239-186213261 GGCACTAGAGAGACTAGAGAAGG + Intergenic
947121303 2:226818120-226818142 ACCACTTAAAAGACTATAGATGG - Intergenic
1171286903 20:23947385-23947407 GACACTGAGAAGACAACAGAAGG - Intergenic
1171749043 20:29029411-29029433 AAGACTGAAGAGACTTTAGAGGG + Intergenic
1174107756 20:48174943-48174965 GACAGTGAAGCCAATATAGAGGG + Intergenic
1174395381 20:50243817-50243839 GACACTGAACATTCTATAGCTGG - Intergenic
1175538940 20:59736312-59736334 CACACTGGAGAGACTCTGGAAGG - Intronic
1176316141 21:5246293-5246315 AAGACCGAAGAGACTTTAGAGGG - Intergenic
1180013062 21:45064166-45064188 GACACTGGGGTGACTATGGAAGG - Intergenic
1180393944 22:12312219-12312241 AAGACTGAAGAGACTTTAGAGGG - Intergenic
1180405803 22:12552531-12552553 AAGACTGAAGAGACTTTAGAGGG + Intergenic
1182450624 22:30418466-30418488 GATACTAAAGAGAAGATAGAGGG - Intronic
1182800361 22:33027128-33027150 GACATTGGAAACACTATAGAGGG - Intronic
950658940 3:14454488-14454510 GACACGGAAGGGACTGTGGAGGG + Intronic
951202162 3:19887438-19887460 AACACTGAACATACTATATAAGG - Intronic
952580450 3:34826852-34826874 GACAATGAAGATCCTATAGTAGG + Intergenic
957814261 3:85272601-85272623 GGCACTGAAGAGACAAAATATGG - Intronic
959116740 3:102187425-102187447 GGCACTAAATAGACCATAGAAGG + Intronic
959583897 3:108008268-108008290 GACACTGAAGAGCCTTCAGATGG + Intergenic
960313313 3:116143927-116143949 GGCACTAAAGAGAGTCTAGAAGG - Intronic
962043649 3:131733299-131733321 CACACTGAAGAGACTTTTCAGGG - Intronic
964354099 3:155833336-155833358 GACACTGAAGAAATTATTGATGG - Intronic
972835197 4:42862153-42862175 GGCACTGTAGAGACTAAAGTAGG + Intergenic
974346353 4:60686870-60686892 AATACTGAAGAGAGTACAGAGGG - Intergenic
974492027 4:62577301-62577323 GATAGTGAAGATATTATAGAAGG - Intergenic
976486443 4:85610762-85610784 GACAATGAAGAGACAGTAAAAGG - Intronic
976505011 4:85836391-85836413 GCCTCTGAAGACACTACAGAAGG + Intronic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
979633057 4:122924681-122924703 GACACTGAAGAGACTATAGATGG - Intronic
980107064 4:128598352-128598374 GACACTGAAAAGAGAATGGAGGG + Intergenic
980707201 4:136514459-136514481 GACAATAAATAGACTATTGATGG - Intergenic
982779851 4:159479565-159479587 GACACTGAAGAAACCCTACAGGG + Intergenic
983027870 4:162759329-162759351 GGCACAGAAGAGAATAGAGATGG + Intergenic
983352770 4:166614506-166614528 GGAACTGTAGAGACTATTGAAGG + Intergenic
983846304 4:172523731-172523753 GACACTTAAGAGTTTACAGAAGG - Intronic
983905302 4:173175572-173175594 AACACTGAAGACAATATAGATGG + Intronic
983915733 4:173288738-173288760 GACACTGATGGCACTATATAAGG - Intronic
985430712 4:189877059-189877081 AAGACCGAAGAGACTTTAGAAGG + Intergenic
987507013 5:18785680-18785702 TACACTGAAGAGCCTAAAAAGGG - Intergenic
989190623 5:38666621-38666643 GACAATGGAAACACTATAGAAGG + Intergenic
989409493 5:41101768-41101790 GAGACTGAAAAGAAAATAGAGGG - Intergenic
994536489 5:101037266-101037288 GACACTCAAGAGGCTTTATATGG - Intergenic
996896075 5:128484513-128484535 GACACAGAAGAGAATACAAATGG + Intronic
998340849 5:141416344-141416366 GATCCTGAGGAGGCTATAGAGGG + Intronic
998451098 5:142235427-142235449 CACACTGAAGATACTGTTGAGGG + Intergenic
999162712 5:149517874-149517896 AACACTAAACAGACAATAGAGGG + Exonic
999919254 5:156300352-156300374 GTCAATGAAGAGATTATAGAGGG - Intronic
1000928221 5:167219610-167219632 GTCTCTAAAGAGGCTATAGAAGG - Intergenic
1002603009 5:180365274-180365296 CACACTTAATAGACTATAGTAGG + Intergenic
1005743434 6:28814197-28814219 GACACTCAAGAAACGATGGATGG + Intergenic
1010207428 6:73335485-73335507 GACAGTGAAGAAACTAGACAAGG + Intergenic
1011124196 6:83988596-83988618 GACACTCAAAAGTCTATTGAAGG - Intergenic
1011170054 6:84495486-84495508 GACAGTGAATAGACTTGAGAAGG - Intergenic
1013121108 6:107141925-107141947 GACACTGAGGCAAATATAGATGG - Intergenic
1013789698 6:113822831-113822853 GACAGTGAAGAAACTATAACAGG + Intergenic
1014677768 6:124388807-124388829 GGCACTAAATAGACTATACAAGG - Intronic
1015767747 6:136737219-136737241 GACACTGGGGATACTAGAGACGG + Intronic
1020502083 7:8936104-8936126 GAAAATGAAGAAACTGTAGATGG + Intergenic
1027761841 7:82288363-82288385 GTAACTGAAGGGACTATAGAAGG + Intronic
1029632334 7:101760799-101760821 GACACAGAAGAGATTACACAGGG + Intergenic
1030582953 7:111383157-111383179 GAGACTGAAGAGAATAAAGAGGG + Intronic
1031348239 7:120695832-120695854 GACACTGAGTAGTTTATAGATGG + Intronic
1031887389 7:127255650-127255672 AACACTGAAGAATATATAGAAGG - Intergenic
1033803752 7:144930651-144930673 GACACTGGAGATACTAGAGAAGG - Intergenic
1033954525 7:146829767-146829789 TGCTCTGAAGAGACTAAAGACGG - Intronic
1034697654 7:153068373-153068395 GACAATGGAGAGGCTATAGTTGG - Intergenic
1034875772 7:154723758-154723780 GTCATTTAAGAGACTATGGAGGG - Intronic
1036193934 8:6697740-6697762 GACACTGATGCAACTCTAGAAGG - Intergenic
1036424352 8:8629907-8629929 GCCACTGAAGACAATTTAGAAGG - Intergenic
1037230734 8:16655504-16655526 GACAGTGAAGAAACCACAGAGGG + Intergenic
1038276135 8:26122339-26122361 GTCACTGCAGAGACAATGGAGGG + Intergenic
1038740615 8:30213491-30213513 GACAGTGAAGAGACCAGAGTGGG - Intergenic
1038829893 8:31045306-31045328 AAGACTGCAGAGACTATGGAAGG - Intronic
1040588594 8:48767400-48767422 GATACTGCAGAGTCTATAGTAGG - Intergenic
1042605058 8:70537076-70537098 GACATTGAAAAGACAAGAGAAGG - Intergenic
1043354219 8:79393470-79393492 GACACTTCTGAGACAATAGAGGG + Intergenic
1043860262 8:85308170-85308192 AACAGGGAAGAAACTATAGATGG + Intergenic
1044847477 8:96396357-96396379 GACACTTAAGAAACTCAAGATGG + Intergenic
1046895812 8:119471661-119471683 TTCACTGAAGAGAATATAGATGG + Intergenic
1048239649 8:132728630-132728652 GACACTGAAGTTTGTATAGATGG + Intronic
1048341617 8:133544171-133544193 AACAGAGAAGAGACTCTAGATGG - Intronic
1049916951 9:327090-327112 GACTCTGCATAGACTATGGATGG - Intronic
1050980788 9:12012065-12012087 GATACTGAAAAGACAATATATGG - Intergenic
1051521927 9:17999051-17999073 GACAATAAAGAGGCTATATAGGG - Intergenic
1052011538 9:23415887-23415909 GAAAATGAAGAGACTGTACATGG - Intergenic
1053720012 9:40935958-40935980 AAGACTGAAGAGACTTTAGAGGG + Intergenic
1055216867 9:73874372-73874394 GACAAGAAAGAGATTATAGAGGG - Intergenic
1056456751 9:86767773-86767795 GACAGTGAAGAGAGTTTTGAAGG - Intergenic
1058295339 9:103299572-103299594 GGCACTGAAGACACAACAGAGGG + Intergenic
1059799327 9:117734129-117734151 GGCATGGAAGAGACTTTAGAAGG - Intergenic
1060742744 9:126110395-126110417 CACTCTGAAGAGAGTACAGATGG - Intergenic
1203454994 Un_GL000219v1:158613-158635 AAGACTGAAGAGACCTTAGAGGG - Intergenic
1186907089 X:14122672-14122694 GAAACTGAGGAGACTTGAGAAGG - Intergenic
1188085065 X:25894023-25894045 TACACAGAAGAGCCTATAAAGGG + Intergenic
1189143096 X:38627220-38627242 GAAATTGAAGAGACTATGGCTGG + Intronic
1193095613 X:77545299-77545321 AACTCTGCAGAAACTATAGAAGG + Intronic
1194709767 X:97221223-97221245 GACACTGTAGACACTAGAAATGG - Intronic
1195479554 X:105327826-105327848 GCCACTGAAGTGCCTATATAGGG - Intronic
1200424497 Y:3006394-3006416 GACACTGGAGAGACCAGTGAGGG - Intergenic
1202258489 Y:22944557-22944579 TACACAGAACAGACTATAAAGGG + Intergenic
1202411478 Y:24578315-24578337 TACACAGAACAGACTATAAAGGG + Intergenic
1202459304 Y:25091757-25091779 TACACAGAACAGACTATAAAGGG - Intergenic