ID: 979633683

View in Genome Browser
Species Human (GRCh38)
Location 4:122932530-122932552
Sequence TTCTGTCAGTGACCAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979633683_979633686 10 Left 979633683 4:122932530-122932552 CCCTCCACTGGTCACTGACAGAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 979633686 4:122932563-122932585 GTTTGTCTCCCCTCCTGATATGG 0: 1
1: 0
2: 0
3: 17
4: 158
979633683_979633687 11 Left 979633683 4:122932530-122932552 CCCTCCACTGGTCACTGACAGAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 979633687 4:122932564-122932586 TTTGTCTCCCCTCCTGATATGGG 0: 1
1: 0
2: 2
3: 25
4: 180
979633683_979633692 29 Left 979633683 4:122932530-122932552 CCCTCCACTGGTCACTGACAGAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 979633692 4:122932582-122932604 ATGGGCTGCTTATGCACAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979633683 Original CRISPR TTCTGTCAGTGACCAGTGGA GGG (reversed) Intronic
901825967 1:11861426-11861448 TTCTATCTGTCCCCAGTGGAGGG + Intergenic
903197271 1:21700221-21700243 TTCAGTCAGTCAACACTGGAGGG - Intronic
903369840 1:22828192-22828214 TTGTGTCAGTGACTAGAGCAGGG + Intronic
905503634 1:38459268-38459290 TTCTCTCCCTGACCAGTGGATGG + Intergenic
910404036 1:86867058-86867080 TTTTGTCATTCACCTGTGGAAGG - Intronic
911717062 1:101145013-101145035 TCCTGTCAGAGACCTGGGGATGG - Intergenic
915923040 1:159992425-159992447 TCCTGACAGTCACCAGTTGAAGG - Intergenic
917784678 1:178441593-178441615 TTCTGAGAGAGACAAGTGGATGG + Exonic
919393541 1:197017016-197017038 TTCTGTCTTTGACCAAAGGAAGG - Intergenic
919755291 1:201062581-201062603 CTCTGGGAGTGAACAGTGGAAGG + Intronic
919988612 1:202693113-202693135 TACTGTCTGTGAGCAGAGGAGGG + Intronic
920337699 1:205256346-205256368 TTCTGTGAGTGGCCAGCAGAGGG - Intronic
922455797 1:225772482-225772504 TTGATTCAGTGTCCAGTGGAGGG - Intergenic
923209997 1:231795262-231795284 TTCTTTAAGTGACAAGTTGAGGG - Exonic
924582832 1:245336261-245336283 TTCTTTCTGAGAACAGTGGATGG - Intronic
1063694041 10:8315879-8315901 AACTGGCAGTTACCAGTGGAGGG - Intergenic
1064248361 10:13687764-13687786 CTCTGTTATTGACCACTGGAGGG - Intronic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1070834672 10:79440758-79440780 TGCTGTCAGTACCCAGAGGAGGG - Intronic
1071320198 10:84447752-84447774 ATCTGTGGGTGATCAGTGGATGG + Intronic
1075548641 10:123375913-123375935 TTCTGTCTTGGACCAGTTGATGG + Intergenic
1077909081 11:6558581-6558603 TGCTGGCAGTGGCCAGTTGAAGG - Exonic
1078626420 11:12962739-12962761 TTCGCTGAGTGGCCAGTGGAAGG + Intergenic
1080382763 11:31791030-31791052 TTCTAGCTGTGGCCAGTGGAAGG - Intronic
1083209411 11:61173698-61173720 TTCTTTCAGTGAACACTTGAGGG - Intergenic
1085674052 11:78498573-78498595 TTCAGTTTGTGACAAGTGGAAGG - Intronic
1092258738 12:6941228-6941250 TTCTGTAAGTTGCCAGTGGTAGG - Intronic
1094401699 12:30068837-30068859 TTCTGTCTGTGGACAATGGAAGG - Intergenic
1098209057 12:68143379-68143401 TTTTGCCAGTCACCAGTGGAAGG + Intergenic
1098981929 12:76965625-76965647 TACTTTCAGTGACCCATGGATGG + Intergenic
1099227841 12:79991117-79991139 TTCTGCCTGTCACCAGTAGAGGG - Intergenic
1102579698 12:113878532-113878554 TTCTGCAAGTGACCAGGAGAAGG + Intronic
1104287910 12:127442037-127442059 TTCTGACACTGCCCAGTGGCAGG + Intergenic
1104522052 12:129485281-129485303 TCCTGTCAGTCACAGGTGGAAGG + Intronic
1105892175 13:24689638-24689660 TTCTGGAAGGGACCTGTGGAAGG + Intronic
1107619549 13:42212074-42212096 TTTTATCAGTGACCAGATGAAGG - Intronic
1107747092 13:43521801-43521823 TTCATTCAGTGCTCAGTGGACGG + Intronic
1110831558 13:80037619-80037641 TTCTGTGAGTGACTAGTCTAAGG - Intergenic
1112829068 13:103426404-103426426 TACTGTCAGTAGCCAGTGGCTGG + Intergenic
1114399172 14:22393897-22393919 TTCTGTCACTGCCCAATGGGAGG + Intergenic
1116279137 14:42879657-42879679 TTCAGTCAGTGTTCAGTCGAAGG + Intergenic
1116962672 14:50982393-50982415 TTCTGCCAGTCACCAGGTGAAGG - Intronic
1117972873 14:61269739-61269761 TTCTGTCTATGTCCAGCGGAGGG + Intronic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119614047 14:76086689-76086711 GTCTGTCAGAGACCAGAGGCTGG + Intergenic
1119872921 14:78032385-78032407 TTCTGTCACTGGCAAGTGAAAGG - Intergenic
1120921813 14:89762181-89762203 TTATGTAAGTAACCAATGGAAGG - Intergenic
1129340615 15:74883512-74883534 TTCTGCCAGTGCCCAGCTGAGGG - Intergenic
1129461072 15:75700353-75700375 TTCTGTCAGGGCCGGGTGGAGGG + Intronic
1129723749 15:77891372-77891394 TTCTGTCAGGGCCGGGTGGAGGG - Intergenic
1129741471 15:77991643-77991665 TGCCATCAGTGAACAGTGGAGGG + Intronic
1129844191 15:78760761-78760783 TGCCATCAGTGAACAGTGGAGGG - Intronic
1130296550 15:82650408-82650430 TTCTGCCAGTGACCAGCTGTGGG - Intergenic
1131746107 15:95449404-95449426 ATCTGTCAGTGGCCTGTGGGTGG + Intergenic
1133792141 16:9017240-9017262 TTCTGTCCTGGATCAGTGGAGGG + Intergenic
1136017339 16:27409636-27409658 TTCAGTAAGTCACCAGTGCAAGG - Intronic
1136108745 16:28051326-28051348 TTCTGCCGGTGACTAGGGGATGG + Intronic
1141456534 16:84145781-84145803 TTCTGTCACTGACTAGCCGAGGG - Intronic
1142282636 16:89156577-89156599 TTCTCTCAGGCACCAGGGGATGG + Intergenic
1142957874 17:3533452-3533474 TTCTGTCTGGGACAAGAGGAGGG - Intronic
1143447060 17:7015765-7015787 TTCTGACAGTGCGAAGTGGACGG + Exonic
1146399489 17:32492077-32492099 TTCTGCCAATGACCAGTGACCGG + Intergenic
1148158904 17:45438908-45438930 TTCTGTCGGTGTCCACTGGCCGG - Intronic
1160127233 18:76187106-76187128 CTCTGTCAGTTACCAATGGCAGG - Intergenic
1168371028 19:55834703-55834725 TTCTGTCAGTGATAGGTGGTTGG - Intronic
925208084 2:2024432-2024454 TTCTGTCAGCCACAAGGGGAGGG - Intronic
926317427 2:11721413-11721435 TTGTGTCACTGTCCAGTGTAAGG + Intronic
930920634 2:56749356-56749378 TTCTATCAGTTACCACTAGATGG - Intergenic
932695929 2:73956548-73956570 TTACCTCAGTGACCTGTGGATGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934564090 2:95328925-95328947 TCCTCTCAGTGACCCATGGAAGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938513821 2:131980662-131980684 TTCTGTTAGTGCAGAGTGGAAGG - Intergenic
939201221 2:139037593-139037615 TTCTGTCAGTTGTCAGTGGCAGG + Intergenic
939754054 2:146087190-146087212 TTCTGTAAGTGAGGAGTGAAAGG + Intergenic
944923294 2:204437642-204437664 TTCTGTGAGGGACAAGTGGGAGG - Intergenic
947345748 2:229187585-229187607 TTGTGGGAGGGACCAGTGGAAGG - Intronic
948223789 2:236293353-236293375 TTCTGTGAGTGGCCAGTGGTGGG - Intergenic
1169471518 20:5890016-5890038 TTATGTGTGTGGCCAGTGGAGGG - Intergenic
1171147709 20:22800325-22800347 TTCTGTGAGTGCCCACTGGCTGG - Intergenic
1171269429 20:23802054-23802076 TTCTGTCAGTGATCTCTGAAAGG - Intergenic
1178624440 21:34203302-34203324 TTCTGCTAGTGACCAGTTGAAGG + Intergenic
1178788405 21:35675600-35675622 TTCTGTCATTTACCAGCGGGGGG - Intronic
1178944652 21:36936811-36936833 TGCTCTCAGAGACCCGTGGACGG - Exonic
1179640342 21:42743760-42743782 CTCTCTCTGTCACCAGTGGAAGG + Exonic
1183173828 22:36207592-36207614 TGCTGTCAGGGCCCAGGGGAGGG + Intergenic
1184633383 22:45804213-45804235 TTAGGTCAGTGACCACAGGAAGG + Intronic
954488039 3:50873081-50873103 TTCTGCCTGAGACAAGTGGAGGG - Intronic
954514878 3:51164789-51164811 TTCTGTGAGTGATGACTGGAAGG + Intronic
956918134 3:73895919-73895941 TTCTGGCAGTGACTAGTTCATGG + Intergenic
958858583 3:99417613-99417635 TTCTGTCTGTCACCAGCTGATGG + Intergenic
960429626 3:117552947-117552969 TTATTTCAGTGACAAGTGGTGGG - Intergenic
960966081 3:123105652-123105674 CTCCGTGTGTGACCAGTGGATGG + Intronic
961318373 3:126056028-126056050 GTCTGCCACTCACCAGTGGAGGG - Intronic
964427941 3:156572913-156572935 TTGTGGGAGGGACCAGTGGAAGG - Intergenic
969163521 4:5282716-5282738 TGATGTCAATGACCAGTGGCTGG + Intronic
970890143 4:21034635-21034657 TTCTGTCAGTCACCAATGAAGGG + Intronic
972743162 4:41908660-41908682 TGATGTTAGTGACCTGTGGATGG + Intergenic
974112246 4:57538680-57538702 TTCTGTCACTTACCAGTGGTGGG - Intergenic
976478876 4:85515676-85515698 TTCTGTCAGTCTCCTATGGATGG + Intronic
979633683 4:122932530-122932552 TTCTGTCAGTGACCAGTGGAGGG - Intronic
982023745 4:151231657-151231679 CTCTGTCAGTTACCACTGCAGGG + Intronic
983564165 4:169132152-169132174 TAATGTCTGTTACCAGTGGAGGG - Intronic
985920244 5:2965940-2965962 TTCTCTCAGTGGCCAGTCTATGG - Intergenic
986176167 5:5353896-5353918 TTCTTTCAGGGGCCACTGGAGGG - Intergenic
990350246 5:54908816-54908838 TTGTGCCAGTGCCCACTGGATGG - Intergenic
992285876 5:75235517-75235539 TACTGTCTGTGCCCACTGGATGG - Intronic
992988397 5:82257427-82257449 CTCTTTGAGGGACCAGTGGAGGG + Intronic
993689710 5:90984836-90984858 TGATCTCAGTGTCCAGTGGAAGG - Intronic
994374663 5:99005550-99005572 TTCAGTCAGTGACCTTTGGTAGG - Intergenic
995996731 5:118309203-118309225 ATCTGTCAGTGACCTCTGGTTGG - Intergenic
996050273 5:118924447-118924469 TTCTGTCAGTTACCCATGAAAGG + Intronic
998348199 5:141483278-141483300 TTCTGTCAGTCATAAGTGAAGGG + Intronic
998486256 5:142505113-142505135 TTCAGTGAATGACCAGTGGGTGG - Intergenic
999208605 5:149868342-149868364 CTCTGTCAGTGATCAGAGGTTGG + Intronic
999371704 5:151059425-151059447 ACCTGTCAGTGCCCAGTGCAGGG - Intronic
1000912026 5:167034285-167034307 TTTTGTTACTGACCATTGGAAGG - Intergenic
1002343097 5:178529604-178529626 TTCTGTCACTGACCAATAGAGGG + Intronic
1003013492 6:2448935-2448957 TTCCTTTAGCGACCAGTGGAGGG - Intergenic
1004409568 6:15368203-15368225 TTCTGTCAGTGGCCTGTACAAGG + Intronic
1008046452 6:46856143-46856165 TTCCGGCAGTGACCACTAGAGGG - Intronic
1011020585 6:82808648-82808670 TGCTGTTGGTGACCTGTGGATGG + Intergenic
1014617688 6:123624190-123624212 CTCTGTCATTTACCTGTGGATGG - Intronic
1015739693 6:136440716-136440738 TTATGACAGTGAGCAGAGGATGG + Intronic
1015759736 6:136645386-136645408 TTCTGTGAGTGGCCACTGGCTGG + Intronic
1017475135 6:154782887-154782909 TTGAGTCAGTGAGCAGGGGAAGG - Intronic
1019613369 7:1947992-1948014 TGCTGTCCGTGACCAGTGCCCGG + Intronic
1019748581 7:2714523-2714545 TTCAGAAAGTGACCAATGGAAGG + Exonic
1021014173 7:15511887-15511909 TTCTCTCCTTGGCCAGTGGATGG - Intronic
1021427658 7:20520963-20520985 TTCTGTCATACAGCAGTGGATGG - Intergenic
1022876246 7:34533644-34533666 ATCTGTCAGGGACAAGAGGATGG - Intergenic
1023116382 7:36866767-36866789 GTCTGTCAGTACACAGTGGATGG - Intronic
1023904089 7:44508860-44508882 TTTTGTCAGTCACCAGAGCAAGG - Intergenic
1025922204 7:65923925-65923947 TTCTGGCAGTGACAGGTAGAAGG + Intronic
1032479869 7:132237614-132237636 TTATGTCCGTGACCTGAGGAAGG - Intronic
1032582205 7:133113761-133113783 TTGTGGGAGGGACCAGTGGAAGG - Intergenic
1036009401 8:4704644-4704666 TTCTTTAAATGACCAGTAGAAGG - Intronic
1037682771 8:21111297-21111319 CTCTGTGTGTTACCAGTGGAGGG - Intergenic
1039133959 8:34298557-34298579 TGCTGTTAGTGACCATTGGATGG - Intergenic
1041084663 8:54245674-54245696 TTCTGTCAGTGCCCAGAGGGTGG - Intergenic
1046113285 8:109752743-109752765 TTCTGTCAGTGACAAGGTTAAGG - Intergenic
1046229174 8:111331090-111331112 GTCTGTCAGGGACAGGTGGAGGG - Intergenic
1049995067 9:1026854-1026876 TGCTGTCAGAGGCCAGTGGCAGG + Intergenic
1051489558 9:17646530-17646552 TGGTGTCAGTGACCTTTGGATGG + Intronic
1051639854 9:19214573-19214595 TAATGTCAGTGACCAGAGTATGG + Intergenic
1056219436 9:84436668-84436690 TGCTGTCAGTGACCAAAGTAGGG - Intergenic
1056486831 9:87067129-87067151 TTCTGGCAGTCATCAGTGGTTGG - Intergenic
1057075727 9:92137234-92137256 TGCTGTCTGTGACCAGGGCAGGG + Intergenic
1057132513 9:92664112-92664134 GTCTGTCAGTCACCAGGGGCAGG + Intronic
1057792776 9:98135028-98135050 ATCTGGCAGTGACCAGCAGAAGG + Intronic
1058500468 9:105610295-105610317 TTCTCTCAGTGAACAGGGGTAGG + Intronic
1060991716 9:127853474-127853496 TTCTGAAACTGACCAGAGGAGGG - Intronic
1061899046 9:133663695-133663717 TCCAGTCAGTGACCACAGGATGG + Exonic
1186182179 X:6984061-6984083 TTCTAACTGTCACCAGTGGAGGG - Intergenic
1187521644 X:20019565-20019587 TTGTGTCAGTGACATGAGGAAGG - Intronic
1187666667 X:21619646-21619668 TTCAGTCATGGAGCAGTGGAGGG - Intronic
1188580098 X:31701406-31701428 TTCTGTCAGTAAGCAATGTATGG - Intronic
1189469337 X:41301816-41301838 TTCTCCCAGTGTCCTGTGGAAGG + Intergenic
1191120470 X:56898385-56898407 TTCTTTCATTGAGCAGTGGTTGG - Intergenic
1200855255 Y:7931034-7931056 TCCTGTGGATGACCAGTGGAGGG - Intergenic