ID: 979642351

View in Genome Browser
Species Human (GRCh38)
Location 4:123023899-123023921
Sequence GCCTCGGAGGGCCCCCAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979642351_979642357 -6 Left 979642351 4:123023899-123023921 CCGTTCTGGGGGCCCTCCGAGGC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 979642357 4:123023916-123023938 CGAGGCCTCTACCTGGAGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 128
979642351_979642356 -7 Left 979642351 4:123023899-123023921 CCGTTCTGGGGGCCCTCCGAGGC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 979642356 4:123023915-123023937 CCGAGGCCTCTACCTGGAGCAGG 0: 1
1: 0
2: 1
3: 24
4: 183
979642351_979642358 -5 Left 979642351 4:123023899-123023921 CCGTTCTGGGGGCCCTCCGAGGC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 979642358 4:123023917-123023939 GAGGCCTCTACCTGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979642351 Original CRISPR GCCTCGGAGGGCCCCCAGAA CGG (reversed) Intronic
900091150 1:921235-921257 GCGGCGGAGGGGCCCCAGCAGGG + Intergenic
900658606 1:3772294-3772316 GCGTCGGAGGGGCTCCAGCAGGG + Intergenic
901498927 1:9639551-9639573 GCATTTCAGGGCCCCCAGAAGGG + Intergenic
903137602 1:21319576-21319598 GGCTTGGAGGGCTCCCAGGAAGG - Intronic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
913172796 1:116247643-116247665 GCCTCGGAAGTCTCCGAGAAGGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
913702354 1:121385289-121385311 GCCTCTGAGGGCACCAAAAATGG - Intronic
914042917 1:144065785-144065807 GCCTCTGAGGGCACCAAAAATGG - Intergenic
914135169 1:144894703-144894725 GCCTCTGAGGGCACCAAAAATGG + Intronic
920489781 1:206404031-206404053 GCCTCTGAGGGCACCAAAAATGG - Intronic
920730418 1:208478320-208478342 TCCTCGGAGGTGCACCAGAAAGG - Intergenic
923506472 1:234609820-234609842 GCCGCGGCGGGCCTCCAGACCGG + Intergenic
1062825671 10:566714-566736 GCCTCTGAGGGTCCCAAGCAGGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1069624574 10:69859965-69859987 GCCACAGAGTGCCCCCAGACAGG + Intronic
1069680021 10:70277716-70277738 GCCCCTGGGGGCTCCCAGAAAGG + Intronic
1070669901 10:78370435-78370457 GCCTGGGAGTGGCCCCAGATGGG + Intergenic
1072608859 10:97003718-97003740 GTCTCAGAGGGCCCCAAGACTGG + Intronic
1072717150 10:97759739-97759761 GCCTCAGAGAGCCTGCAGAAGGG + Exonic
1074362639 10:112835383-112835405 TCCTCGAAGGCCCCCCAGATAGG - Intergenic
1075588800 10:123676814-123676836 GCCTCTCTGGGCCTCCAGAAAGG + Intronic
1077035935 11:494478-494500 GCCTCGCAAGGACCCCAGGAAGG + Intergenic
1077168325 11:1153596-1153618 CCCTCTGAGAGCCCCCAGCAAGG + Intergenic
1077210782 11:1370128-1370150 GCCAAGGAGGACCCCCAGACAGG - Intergenic
1077257838 11:1596829-1596851 GCCTCGGAAGGACCCCAGGCAGG - Intergenic
1077375382 11:2203136-2203158 GCCTCGGGGGGCCACAAGGAGGG - Intergenic
1080666337 11:34339526-34339548 GCCTGGGAGGGCCCTCAGTGAGG + Intronic
1084760141 11:71265757-71265779 GTTTCGGGGGGCCCACAGAAGGG - Intergenic
1084804144 11:71567062-71567084 GCCTCGGAAGGACCCCAGGCAGG + Intronic
1084954893 11:72685895-72685917 GCCTATGAGGGCCCCCACCAAGG + Intronic
1087122456 11:94589299-94589321 GTCTCAGAGGTCCCCCAGATTGG + Intronic
1089175697 11:116547525-116547547 GCCTGGGAGGGACCAGAGAAGGG - Intergenic
1090364368 11:126193354-126193376 GCCTCGGTGGGCTCCCTGCATGG + Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1093023066 12:14220773-14220795 GCCACCAAGGGCCCCAAGAAGGG - Intergenic
1096387452 12:51204247-51204269 GCCGCCGAGGGCTCCCAGAGCGG - Exonic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1107654013 13:42573971-42573993 TCCTTGGAGGGCCCCCATGAAGG + Intronic
1107827163 13:44338890-44338912 GTCTCCTAGGGCCTCCAGAAAGG + Intergenic
1107877490 13:44803638-44803660 CCCTGGGAGGGCCCCCACACAGG + Intergenic
1107906815 13:45068955-45068977 CTCTGGGAGGGCCACCAGAAAGG + Intergenic
1113548711 13:111175419-111175441 GACTGAGAGGGCCCCCAGAGAGG - Intronic
1113571539 13:111361642-111361664 CCCTCTGAGTGCCGCCAGAAGGG - Intergenic
1114649705 14:24276684-24276706 GCCCATGAGGGCCCACAGAAGGG + Intergenic
1119728877 14:76938594-76938616 GCCTCTGAGGCTCCCCAGCAGGG - Intergenic
1121263658 14:92584580-92584602 GCCTCTGAGGGTCCCCAGTGAGG - Intronic
1122313994 14:100815059-100815081 GCCCAGGAGGTGCCCCAGAAGGG + Intergenic
1122341230 14:101029848-101029870 GCCATGGAGGGCCCCTAGGAGGG + Intergenic
1129951149 15:79592629-79592651 GCTTCTGAGGGCCTCCAGAAGGG + Intergenic
1130540383 15:84817458-84817480 GTCGCGGAGGGCCCCCAGCCGGG + Exonic
1131248751 15:90817585-90817607 GCCATGGAGGGCCACCAGCAGGG - Intergenic
1131310710 15:91287661-91287683 GCCTCGCAGGGCTCCCAGCAGGG - Intronic
1132872882 16:2123513-2123535 GCCTTGGCGTTCCCCCAGAACGG - Intronic
1133156901 16:3881564-3881586 GCCTCGCAGGTGCCCCAGACAGG + Intergenic
1133460978 16:5985811-5985833 GCCTCTGGGGGCGCACAGAAAGG + Intergenic
1134551972 16:15142692-15142714 GCCTTGGCGTTCCCCCAGAACGG - Intergenic
1135049433 16:19180558-19180580 GCCAGCCAGGGCCCCCAGAAAGG - Intronic
1136069417 16:27778988-27779010 GCCTCAGAGGGCCCAGAGAATGG + Exonic
1136315079 16:29449627-29449649 GCCCCGCAGGGCCTCCAGCAGGG + Intronic
1136429656 16:30188966-30188988 GCCCCGCAGGGCCTCCAGCAGGG + Exonic
1139383427 16:66549131-66549153 ATCTCGGAGGGCGCCCAAAATGG - Intronic
1141649546 16:85385726-85385748 GCCTCGGAAGGGCTCCAGGATGG - Intergenic
1142427198 16:90007531-90007553 GCCGAGCAGGGCCCCCAGCACGG - Intronic
1142781172 17:2182376-2182398 ACCTAGGAGGGCCCACAGATAGG + Intronic
1143288429 17:5809908-5809930 GGCTAGGAGAGCCCCCAGCAAGG + Intronic
1145049487 17:19648510-19648532 GCCCCGGGGCGGCCCCAGAAAGG - Intronic
1145302104 17:21648023-21648045 CCCACGGTGGGCCCACAGAAGGG - Intergenic
1145348206 17:22055293-22055315 CCCACGGTGGGCCCACAGAAGGG + Intergenic
1150227565 17:63532130-63532152 GCTTCTCAGGGCCCCCAGACAGG - Intronic
1150565923 17:66339815-66339837 GCCTCTGAAGGCCACCAAAAAGG + Intronic
1152684773 17:81688567-81688589 GCCAGGGAGGGCCCCCCGAGTGG - Intronic
1152704211 17:81834434-81834456 GCCTCAGTGGGTCCCCAGGATGG - Intronic
1155621433 18:27784853-27784875 GGCTAGGAGGGGCCCCAGAAGGG + Intergenic
1157335390 18:46733866-46733888 GGCTTTGAGGGACCCCAGAAAGG - Intronic
1160756167 19:758087-758109 GTCTCGGAGGGTCCCCAGCCCGG + Exonic
1163367049 19:16881122-16881144 TCCTCTGTGGGCCCCCAGACTGG + Intergenic
1164679352 19:30123476-30123498 GTCTCCGTGAGCCCCCAGAAAGG - Intergenic
1164909246 19:31992439-31992461 GCCTGGGAGGGCCGACAGCACGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927257552 2:21053375-21053397 GCCTCGGTGGGCTCCCAGGGAGG + Intergenic
932457493 2:71858671-71858693 GCCTAGCAGGTCCCCCAGAATGG + Intergenic
938174058 2:129108049-129108071 GGCTCCTAGGGCCCTCAGAAAGG + Intergenic
938370236 2:130763823-130763845 CCCTCGGAGGGGCCACACAAGGG + Exonic
946394181 2:219435033-219435055 GCCCCGGAGTGCCCCCGAAAAGG + Exonic
947530555 2:230906426-230906448 GCTTCCGAGGGTCCCCAGAGAGG + Intergenic
947796662 2:232897344-232897366 TCCTCCCAGGTCCCCCAGAAAGG + Intronic
949044217 2:241863533-241863555 GCATGGGAGGGCCCCCAGCGAGG - Intergenic
1169242284 20:3993761-3993783 GCCTTAGAGGGCCTCCAGAAAGG + Intronic
1172099306 20:32475716-32475738 GCCTCTGTGGGCCCCCAGTGAGG + Intronic
1172778063 20:37419758-37419780 CCCTCCCAGGGCCCCCAGCAGGG - Intergenic
1174653722 20:52152402-52152424 GCCTCAGGTGGCCCCCAGGAAGG - Exonic
1174836244 20:53857998-53858020 GCCTGGGAGGGGCTCCAGAGTGG + Intergenic
1175402193 20:58707166-58707188 GGCTCTGAAGGCCCCCAGGACGG - Exonic
1175638434 20:60605421-60605443 GCACAGGACGGCCCCCAGAAAGG - Intergenic
1175923181 20:62459382-62459404 TCCTCGGAGGGCCCACAGTGGGG - Intergenic
1176389967 21:6158361-6158383 GCCTCGGGGGCTCCCCAGAAGGG + Intergenic
1176985375 21:15430380-15430402 GCCCTGGATGGCCCACAGAAAGG - Intergenic
1179195608 21:39159938-39159960 GCCTGGCAGGGGCCCCAGAATGG - Intergenic
1179733499 21:43379879-43379901 GCCTCGGGGGCTCCCCAGAAGGG - Intergenic
1181007898 22:20022777-20022799 GCTTCTCAGGGACCCCAGAAGGG + Intronic
1181768738 22:25110927-25110949 GCCTCTGAGGTCCCCCAGGAAGG - Intronic
1183729469 22:39609772-39609794 GACTCGGAGTGCCCCCATGATGG - Intronic
1184287759 22:43481622-43481644 GCCTGGGAGGAACCCCAGAAAGG - Intronic
952963746 3:38608515-38608537 GCCTTGGTGGGCCCCCTGAGTGG - Intronic
953434058 3:42864800-42864822 GCCACGGAGATGCCCCAGAAGGG - Exonic
954633354 3:52058502-52058524 GCCTGGGAGAGCACCCAGACCGG - Intergenic
954912789 3:54122695-54122717 GCGTCGGAGGGAGCCCAGCATGG + Exonic
956236435 3:67077295-67077317 GCCTGGGAGGGAAACCAGAAAGG - Intergenic
958797256 3:98718747-98718769 GCCCCCAAGGGCCTCCAGAAGGG + Intergenic
962876901 3:139542065-139542087 GCCTGGGAGGAGACCCAGAAGGG - Intergenic
965636595 3:170788327-170788349 TCCCCCGAGGGCCTCCAGAAAGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
970950796 4:21753023-21753045 GCTTCCAAGTGCCCCCAGAAAGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977407681 4:96620790-96620812 GCCTCGGAGATCCTCCAGATGGG + Intergenic
979145306 4:117239710-117239732 ACCTTTGGGGGCCCCCAGAAAGG + Intergenic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
986267237 5:6201225-6201247 CCCTCACAGGGCCCCCAGCAAGG - Intergenic
997090182 5:130847283-130847305 GCCTCAGAGGGCCCCTGGAAAGG + Intergenic
997654384 5:135544620-135544642 ACCTCGGAAGGCGCCCAGAGGGG - Intergenic
999652467 5:153780981-153781003 GTCTCGGAGGGCAGGCAGAAAGG + Intronic
1001573843 5:172748835-172748857 TCCTCGCAGGGCTCCCGGAAGGG - Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002091914 5:176810914-176810936 GCCTCGGGGGGCTCCCAGCCGGG - Intronic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003879738 6:10469131-10469153 GCCTCGTAGGGCCCTGAGCAGGG - Intergenic
1004145023 6:13058028-13058050 GCCTCGGAGGGCAGACTGAAAGG - Intronic
1004898291 6:20170145-20170167 GCCTGGGATGGCCCCTAGAAGGG - Intronic
1005738980 6:28773594-28773616 GAGTCGGATGGCCCCCAGTAGGG - Intergenic
1005932457 6:30493770-30493792 GCCACAGAGGGCCCCCACCAGGG + Exonic
1006945100 6:37779535-37779557 GCCTGGGAGGCTGCCCAGAAGGG + Intergenic
1007073970 6:39055089-39055111 GCCTCGGAGGCCCCATGGAAGGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1018568625 6:165184035-165184057 GTCCCGCAGAGCCCCCAGAATGG - Intergenic
1018929562 6:168231921-168231943 CCCTCTGTGGGCCCCCTGAAGGG + Intergenic
1019335278 7:479882-479904 GGCTCTGAGGACCCCCAGAGAGG + Intergenic
1022533490 7:31081413-31081435 GGATGGGAGGGCCTCCAGAATGG - Intronic
1025026923 7:55524099-55524121 ACCTGGGAGGGCCCCAGGAAGGG - Intronic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1034467010 7:151235726-151235748 GCAACGGAGGGCCCACAGAGCGG - Intronic
1035291412 7:157841604-157841626 GCCTGGAAGGGCCCCCACCACGG + Intronic
1046711743 8:117518533-117518555 CCTTCTGAGAGCCCCCAGAAGGG + Intergenic
1047208519 8:122822053-122822075 GCCTCGGAGGCCCAACAGTAAGG + Intronic
1049007246 8:139863365-139863387 GGCACGGAGGGCCCAAAGAAGGG + Intronic
1049421449 8:142518390-142518412 GCCTCGGAGGGGCCACAGCATGG - Intronic
1049454582 8:142680569-142680591 GCCTTGGCTGGCCCCCAGCAGGG + Intronic
1058005134 9:99906571-99906593 GCCCCGCAGGGCCCCCAGGCCGG - Intergenic
1060979668 9:127785253-127785275 GGCTCGGAGTGCCCCCACAGAGG - Intergenic
1203761036 EBV:13088-13110 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203761965 EBV:16160-16182 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203762894 EBV:19232-19254 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203763823 EBV:22304-22326 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203764752 EBV:25376-25398 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203765681 EBV:28448-28470 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203766610 EBV:31520-31542 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1203767539 EBV:34592-34614 GCCCAGGATGTCCCCCAGAAGGG + Intergenic
1188410811 X:29870019-29870041 GCCTCAGAAGGCAGCCAGAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189544495 X:42027515-42027537 GCCTTGGAGGGCCACCAGCTTGG + Intergenic
1190909624 X:54758915-54758937 GCCTGGGAGGGGCCCCAGTGTGG - Exonic
1192202484 X:69075513-69075535 GGCTCAAAGGGACCCCAGAAAGG - Intergenic
1192343346 X:70281614-70281636 GACACGGAGGACACCCAGAAAGG + Intronic
1193436448 X:81479449-81479471 ACCTCAAAGTGCCCCCAGAAAGG - Intergenic
1197929556 X:131680284-131680306 GTCTGGGAGGTCCTCCAGAAAGG + Intergenic
1197945907 X:131840113-131840135 GTCTGGGAGGTCCTCCAGAAAGG - Intergenic