ID: 979642617

View in Genome Browser
Species Human (GRCh38)
Location 4:123026857-123026879
Sequence TGATGCATAAGGTGTCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979642617 Original CRISPR TGATGCATAAGGTGTCAACT GGG (reversed) Intronic
902364606 1:15963660-15963682 TGTTTCATAAGGTGTAAATTTGG - Intronic
903726040 1:25445422-25445444 TGATACATAATTTGTCATCTAGG - Intronic
904433820 1:30481345-30481367 TGATGGTTAATGTGCCAACTTGG - Intergenic
905072315 1:35237554-35237576 AGAGGCAAAAGGTTTCAACTTGG + Intergenic
908747406 1:67388963-67388985 TAATTCAAAAGGAGTCAACTAGG + Intronic
908845524 1:68320664-68320686 TGTTGTATAGGGTGTCAGCTGGG - Intergenic
909100702 1:71344206-71344228 TGCTCCATATGGTGTCCACTGGG - Intergenic
910241913 1:85095945-85095967 TGAAGCAGAAGATGTCATCTGGG - Exonic
911370299 1:96988026-96988048 TGAACAATAAGGTGTCCACTTGG - Intergenic
912921532 1:113872059-113872081 GGAAACAGAAGGTGTCAACTTGG - Intergenic
914423604 1:147553164-147553186 TAATGCAGAAGATGTCTACTAGG - Intronic
916693176 1:167210530-167210552 TGATGGATTAGGTGCCAAATTGG + Intergenic
919923940 1:202182623-202182645 TGGTTAATATGGTGTCAACTGGG - Intergenic
921810010 1:219501971-219501993 TTTTCCATGAGGTGTCAACTGGG + Intergenic
1066221432 10:33338254-33338276 TCATGCAAGAGGTGTCATCTGGG + Intergenic
1067178297 10:43965966-43965988 AGATGAACAAGGTGTCTACTTGG - Intergenic
1068151190 10:53134448-53134470 TGATGGTTAAAGTATCAACTGGG - Intergenic
1070861407 10:79667413-79667435 TGATTCATAATTTGCCAACTTGG + Intergenic
1070875839 10:79808184-79808206 TGATTCATAATTTGCCAACTTGG - Intergenic
1071166243 10:82810787-82810809 TGATGCTGAGGGTGTGAACTAGG + Intronic
1071642769 10:87330316-87330338 TGATTCATAATTTGCCAACTTGG - Intergenic
1074952557 10:118353187-118353209 TGATGAATAATGAGTAAACTTGG + Intergenic
1076980189 11:199967-199989 TGATGCCGAAGGTGACAACTGGG - Exonic
1078893606 11:15579013-15579035 TGATGCCAAAGGTGTCATCCAGG - Intergenic
1086046829 11:82542686-82542708 TGGAGCATAAGGTGTAGACTTGG + Intergenic
1100685125 12:96979200-96979222 TGATTCATATTGTGTCAATTTGG + Intergenic
1101092330 12:101300367-101300389 TGGAGCATAAGGTGTATACTAGG - Intronic
1106013271 13:25844786-25844808 TCATCCATAAGGTATCAAGTGGG - Intronic
1108424407 13:50284370-50284392 TAATGCATCAGGTGTCAAGCAGG - Intronic
1108543061 13:51462235-51462257 TAATGCAGAAATTGTCAACTGGG - Intergenic
1110178715 13:72589496-72589518 TGATGCTTAAATTGTCATCTTGG - Intergenic
1117330943 14:54711499-54711521 TGATACGTAAGATGTCACCTTGG + Intronic
1117832966 14:59771389-59771411 TGCTTTTTAAGGTGTCAACTTGG + Intronic
1118988924 14:70780557-70780579 TGCTTCAAAAGGCGTCAACTTGG + Intronic
1121556076 14:94838625-94838647 TGATCCATATGGTGTTACCTGGG - Intergenic
1127286791 15:57539855-57539877 TGATGCATGTGGGGCCAACTGGG - Intronic
1127532423 15:59857450-59857472 TGATGCTCAAGCTGTCCACTGGG - Intergenic
1137816994 16:51407797-51407819 TGATGCAGAAGGTCATAACTGGG - Intergenic
1150442674 17:65203828-65203850 TGGTGCAGAAGGTGTGAAGTTGG + Intronic
1158479812 18:57811829-57811851 TGAGGCCTAAGGTATCACCTAGG + Intergenic
1163930289 19:20383723-20383745 AAATGCATAAGGTGCCAACCAGG + Intergenic
927822548 2:26280961-26280983 TGGAGCATAAGGTATGAACTGGG + Intronic
931393494 2:61865109-61865131 TGATGCCTAATGTGTCAACCTGG + Intergenic
933687727 2:85156804-85156826 TGATGAATAAGTTCTCAGCTTGG + Intronic
933715447 2:85356357-85356379 TGAGGCTAAAGGTGTCACCTTGG - Intronic
938904058 2:135822373-135822395 TGATGCAGTAGGTCTCAAGTAGG + Intronic
945167646 2:206962824-206962846 TGTTTCATAAAGTGTCAAGTTGG + Intronic
1170863656 20:20133260-20133282 TCATGCATTTGGTGTCAACTAGG + Intronic
1171022720 20:21601260-21601282 TGCTTCATCTGGTGTCAACTGGG - Intergenic
1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG + Intergenic
1175208901 20:57335859-57335881 TGTTGCAAAAGTTGTCATCTAGG - Exonic
1175693452 20:61083165-61083187 TGAAGCATAAGGTGGGAACCCGG + Intergenic
955712005 3:61789935-61789957 TGATGCACAAGATCTCAACCAGG - Intronic
956254418 3:67268662-67268684 TGATGGTTAATGTGTCAACTTGG + Intergenic
957622992 3:82620015-82620037 ACATGTATAAGGTGGCAACTAGG + Intergenic
962429199 3:135303823-135303845 TGAATAATTAGGTGTCAACTGGG - Intergenic
966591986 3:181694427-181694449 ATATGCATAAGGTGTACACTTGG + Intergenic
967237198 3:187396961-187396983 TGATCCACAGGGTGTCAGCTGGG - Intergenic
967761629 3:193232440-193232462 TGATGCATTACATGTGAACTTGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968497460 4:926674-926696 TGATGATCAAGCTGTCAACTTGG + Intronic
976603743 4:86963365-86963387 TGATGTCAAAAGTGTCAACTAGG + Intronic
977177615 4:93835685-93835707 TGATGAAGAAGGTGTGAGCTAGG + Intergenic
977744173 4:100525464-100525486 TGATCCATGAGCTTTCAACTGGG - Intronic
978827132 4:113038912-113038934 TGATACATGTGGTGTCAGCTGGG - Intronic
978873720 4:113611825-113611847 TGATGCAAAAGAAGTAAACTTGG - Intronic
979218756 4:118196252-118196274 TGATGCAAAAGGCCTCAACAAGG - Intronic
979642617 4:123026857-123026879 TGATGCATAAGGTGTCAACTGGG - Intronic
980323747 4:131313271-131313293 TGATGGCTAATATGTCAACTGGG + Intergenic
980992124 4:139747208-139747230 TGATGCAGAAGGTGTGGATTTGG - Intronic
982080233 4:151782688-151782710 TGGTAGATAAAGTGTCAACTTGG + Intergenic
982921707 4:161282532-161282554 TTCTGCATAAGATGTGAACTTGG - Intergenic
984554719 4:181199920-181199942 TTAAGCATAAGGAGTTAACTGGG + Intergenic
988265602 5:28945474-28945496 TGAAGAAAAAGGTGTAAACTTGG - Intergenic
990438255 5:55816732-55816754 TGATACAAATGGTGTTAACTGGG + Exonic
991786342 5:70201081-70201103 TGGTGATTATGGTGTCAACTTGG + Intergenic
992293019 5:75299727-75299749 TGAAAGAAAAGGTGTCAACTAGG + Intergenic
992552809 5:77875107-77875129 TGATGCATAATGCATCAACTGGG - Intergenic
1000605906 5:163327339-163327361 TGATGCAGAAGGTCTGAAATAGG - Intergenic
1005727958 6:28668308-28668330 TCCTGCATAAGGATTCAACTTGG - Intergenic
1011598987 6:89042547-89042569 TGATGGATTAGGTGTGAAATGGG + Intergenic
1011604387 6:89088074-89088096 TGTTGCATAAGTTTTCAAATGGG + Intergenic
1017396211 6:154002570-154002592 TGTTGCATAGGGTGACCACTGGG + Intergenic
1022202412 7:28129428-28129450 TGATTCATTTGGTGTGAACTGGG + Intronic
1022582223 7:31566726-31566748 TGATTAATAAGGTGGCAAATGGG + Intronic
1022627126 7:32048615-32048637 TGATCCACCTGGTGTCAACTGGG - Intronic
1024828511 7:53420767-53420789 TGATGCCAAAGGTGTGACCTTGG - Intergenic
1030523141 7:110622712-110622734 TGATGCTTAAAGTGACAATTAGG + Intergenic
1032357776 7:131226081-131226103 AGAAGCAAAAGGTGTCACCTAGG - Intronic
1034135914 7:148769467-148769489 TGATTCAGAAGGGGTCAATTCGG + Intronic
1034832131 7:154318605-154318627 TGTTGCAATAGGTGTGAACTGGG - Intronic
1038360753 8:26873617-26873639 TTCTTCAGAAGGTGTCAACTTGG + Intergenic
1044057330 8:87587282-87587304 TGATGATTCATGTGTCAACTTGG - Intronic
1047736175 8:127767287-127767309 TGATGCATAAGGTGTCAAGTAGG + Intergenic
1050077495 9:1880322-1880344 TGAGGGAGAAGGTGTCAACTTGG + Intergenic
1050150386 9:2614014-2614036 GGATGCATAAAGTGACGACTGGG + Intergenic
1050569691 9:6924690-6924712 CGATGCATAATGTGTCATCCTGG + Intronic
1051497575 9:17741903-17741925 TGATGGAGAAGGTGTCATCTGGG + Intronic
1058576113 9:106403460-106403482 TGCTTTATAATGTGTCAACTTGG - Intergenic
1186314974 X:8359361-8359383 TGCAGCAAAAGATGTCAACTTGG + Intergenic
1186849965 X:13570140-13570162 TGATGCAAAAGGAGCTAACTAGG - Intronic
1189139504 X:38586993-38587015 TAATGCAAAAGTTTTCAACTGGG + Intronic
1192193785 X:69015391-69015413 TGGTGCATGAGGTGCCACCTGGG + Intergenic
1197114475 X:122817086-122817108 TTATATATAAGGTGTCAAATGGG - Intergenic