ID: 979647944

View in Genome Browser
Species Human (GRCh38)
Location 4:123093752-123093774
Sequence GATCTAAGGAGCCCAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979647940_979647944 12 Left 979647940 4:123093717-123093739 CCTAGCATGGGAGGAGTAAAAAT 0: 1
1: 4
2: 17
3: 38
4: 165
Right 979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979647944 Original CRISPR GATCTAAGGAGCCCAACAGC AGG Intronic
No off target data available for this crispr