ID: 979648626

View in Genome Browser
Species Human (GRCh38)
Location 4:123104289-123104311
Sequence TCTTACATGGGTGTGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 2, 1: 8, 2: 70, 3: 193, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979648626_979648631 12 Left 979648626 4:123104289-123104311 CCATAAACCACACCCATGTAAGA 0: 2
1: 8
2: 70
3: 193
4: 456
Right 979648631 4:123104324-123104346 TAAATAAACGTTTTGTGTTCTGG 0: 1
1: 0
2: 0
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979648626 Original CRISPR TCTTACATGGGTGTGGTTTA TGG (reversed) Intronic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
902165433 1:14567314-14567336 TCTTATATTGTTGTGGTTCATGG + Intergenic
903598033 1:24511568-24511590 TCTTATATGGGTGCAGTTCATGG + Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
904202495 1:28830177-28830199 TCTTACAGGCGTGTGGTTTGTGG + Intronic
904580898 1:31543580-31543602 TCTTGTATGGGTGTGGTTTATGG + Intergenic
904745158 1:32706174-32706196 TCTTGGATGGGTGTGGATTAGGG - Intergenic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905784070 1:40738514-40738536 TCTTATATGGGTGTGGGGTGAGG - Intronic
906269846 1:44468030-44468052 TCTTATATGAGTGTGGTTCATGG + Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907965861 1:59328894-59328916 TCTTATATGGGTGCAGTTTGTGG + Intronic
908340786 1:63176714-63176736 TCTTATATGGGTGCTGTTCATGG + Intergenic
908849652 1:68362960-68362982 TCTTAAATGGGTGTGATTTGTGG + Intergenic
908864879 1:68536410-68536432 TCTTAACTGGGTTTGTTTTAGGG - Intergenic
908893199 1:68869028-68869050 TCTTTTATGGGTGTTGTTTGGGG + Intergenic
908921946 1:69205496-69205518 CCTTATATGGGTGCAGTTTATGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909824165 1:80105130-80105152 TCTTACATGGGTGCAGTTTATGG + Intergenic
909916118 1:81321668-81321690 TCTTACATGGATGTGGCTCATGG + Intronic
910577099 1:88777041-88777063 GCCTACATTGGTGTGCTTTATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
912731483 1:112110441-112110463 TCTTCTATGGGTGTGGTTCATGG + Intergenic
912902520 1:113667940-113667962 TTTTATATGGGTGTGATTTGTGG + Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913350917 1:117858176-117858198 TCTTATATGGGTGCAGTTTGTGG - Intergenic
914436161 1:147661411-147661433 TCTTATATGGGGGCGGTTTGTGG - Intronic
914974414 1:152347041-152347063 TTTCAAATGGGTGTGGTTAAGGG + Intergenic
914977143 1:152377098-152377120 TCTTGTATGGGTGTGGTTTGTGG - Intergenic
915600005 1:156916387-156916409 TGTTATATGGGTGCGGTTCATGG - Exonic
916778813 1:168000211-168000233 TCTTATATGGATGCGGTTTGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917362388 1:174191019-174191041 TCTTAGATAGGTGCGGTTTGTGG + Intronic
917671392 1:177276641-177276663 ATTTACATAGGTGTGTTTTAAGG + Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918632537 1:186735195-186735217 TCTTATATGGGAGTGGCTCATGG + Intergenic
918978901 1:191528949-191528971 TCCTACATGAGTGTGGCTTTTGG - Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919217251 1:194574643-194574665 TTTTATATGGGTGTGATTCATGG - Intergenic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
920447081 1:206025901-206025923 TCTTACACGGGTGCAGTTTGTGG - Intergenic
921307968 1:213816093-213816115 TCTTACATGGGTGCAGTTCATGG + Intergenic
921311979 1:213853557-213853579 CCTTACATGGGTTTGATTTTGGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
923371969 1:233323648-233323670 TCTGATATAGGTGTGGTTTGTGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
923717821 1:236440769-236440791 TCTTATATGGGTGCAGTTCATGG - Intronic
923763147 1:236866341-236866363 TCTTCTATGGGTGTGGTTCATGG - Intronic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1062890238 10:1054020-1054042 TCTTATATAGGGGTGGTTCATGG + Intronic
1063012774 10:2041527-2041549 ACATACAGGGGTGTGGTTTAGGG + Intergenic
1063092460 10:2879404-2879426 TCTTACAAGGATGTGTTTAAAGG + Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065046678 10:21752306-21752328 TCTTCCTCAGGTGTGGTTTAAGG - Intergenic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1065413699 10:25460975-25460997 TCTTATGTGGGTGCGGTTCATGG - Intronic
1068419885 10:56777811-56777833 TCTTACATGGGTGGAATCTAAGG + Intergenic
1068700396 10:60013764-60013786 TCTTACATAAGAGTGGTTCATGG + Intergenic
1068748701 10:60566150-60566172 TCTTATATGGATGTGGTTTGTGG - Intronic
1069012031 10:63385179-63385201 TCTTATACGGGTGTGGCTTCTGG + Intronic
1069292396 10:66796414-66796436 TCTTATATGGGTGCAGTTTGTGG + Intronic
1069398197 10:68012978-68013000 TATTATATGGATGTGGTTTGTGG - Intronic
1069666353 10:70162937-70162959 TCTTCTATGGTTGTGGTTTGTGG - Intronic
1069947207 10:71995751-71995773 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1069971930 10:72178717-72178739 TGATACATGGGTGTGGTTTTAGG + Intronic
1070218548 10:74414014-74414036 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1070306550 10:75242934-75242956 GCTTACATGTGTGTGTTTTCTGG + Intergenic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1071368997 10:84931879-84931901 TCTTATATGGGTGTGTTTTGTGG + Intergenic
1071389919 10:85163070-85163092 TCTTACAAGGATGTTGTCTATGG + Intergenic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1071663014 10:87524819-87524841 TCTTATATGGGTGGGGTTCATGG + Intronic
1071691745 10:87827617-87827639 CCTTACATGGCTGTGGTCTGTGG - Intronic
1072059593 10:91797197-91797219 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1072145011 10:92627689-92627711 TTGTACATGGGTGAGGATTATGG + Intronic
1072151083 10:92684600-92684622 TCTTATATGGGTGCAGTTTGTGG - Intergenic
1072452686 10:95551359-95551381 TTTTACCTGGGTGTGGGGTAGGG - Intronic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073220589 10:101869182-101869204 TCTAACTTGGGTGTTGTTTAAGG + Intronic
1073368697 10:102967298-102967320 GCTTACATGGGTGGGTTTTATGG - Intronic
1073605441 10:104891093-104891115 TCTTACACGTGTTTTGTTTAGGG + Intronic
1073681493 10:105708999-105709021 TCTTACATGTGTGAGGTTTGTGG - Intergenic
1073681893 10:105713890-105713912 TCTCACATGGGTGGGATTGAGGG - Intergenic
1073772284 10:106748377-106748399 TCTTATATGGTTGTTGTTTGTGG - Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074210692 10:111331458-111331480 TCTTATATGGGTGTAGTTCATGG - Intergenic
1075722666 10:124596636-124596658 TCCTCCCTGGGTGTTGTTTAGGG - Intronic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078005819 11:7531511-7531533 GCTTACCTTGATGTGGTTTAAGG + Intronic
1078951041 11:16134696-16134718 TCTTGCACTGGTGTGGTTTATGG - Intronic
1079103213 11:17554276-17554298 TCTTACAAAGGTCTGGTTTTGGG + Intronic
1079132925 11:17759731-17759753 TCTTATACGGGTGTGATTTGTGG + Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081410375 11:42750694-42750716 TCTTATATGTGAGTGGCTTATGG - Intergenic
1081948387 11:47019641-47019663 TCCTATATGGATGTGGTTTGTGG + Intronic
1082205354 11:49427097-49427119 TCTTATATGGATGTGGTTTGTGG - Intergenic
1082954628 11:58856730-58856752 TCTTATATGGGTGCAGTTTGTGG + Intronic
1084369218 11:68727878-68727900 TCTTATATGGATGTGGCTTGTGG - Intronic
1084662591 11:70555106-70555128 TCTTATTTGAGTGTGTTTTACGG - Intronic
1085616764 11:78006195-78006217 TCTTATATGGATGTTGTTTGTGG - Intergenic
1085858128 11:80198903-80198925 TCTTATATTGGTGTGGTTTGTGG - Intergenic
1086231312 11:84573575-84573597 TCATAAATGTATGTGGTTTAAGG - Intronic
1086549459 11:88039384-88039406 TCATAAATAGGTCTGGTTTATGG - Intergenic
1086649751 11:89273439-89273461 TCTTATATGGATGTGGTTTGTGG + Intronic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1087003728 11:93447271-93447293 TTTTAAATGGGTGAGTTTTATGG - Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087809357 11:102593675-102593697 TCTTAAATGGGGTTAGTTTATGG + Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088156985 11:106818395-106818417 TCTTATACGGGTGTGGTTTGTGG - Intronic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089958689 11:122596674-122596696 TCTTATATGGGTTTGTGTTAGGG - Intergenic
1090106949 11:123863669-123863691 TATTCCATGGGTCTGTTTTATGG - Intergenic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090813100 11:130265027-130265049 TCTTATATGGGTGCAGTTTGTGG - Intronic
1090818655 11:130320523-130320545 TCTTACATGGGTGCAGTTTGTGG + Intergenic
1091093918 11:132799508-132799530 TTTTATAGGGGTGTGGTTTATGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092824012 12:12380116-12380138 TTTTCTATGGGTGTGGTTTGTGG + Intronic
1092966159 12:13645348-13645370 TCTTATCTGGGTGTGGTTGGTGG + Intronic
1093397537 12:18701711-18701733 TCTTTCATGGGTTTCCTTTAAGG + Exonic
1093823244 12:23648066-23648088 TCTTATGTGGGTGCAGTTTATGG + Intronic
1093838291 12:23864180-23864202 TCTTATATGGGTGCGGTTAGTGG - Intronic
1094280122 12:28727643-28727665 TCTTACATGGGAGCTGTTCATGG + Intergenic
1095208642 12:39467440-39467462 TCTTATATTGATGTGGTTTGTGG - Intergenic
1095605995 12:44068618-44068640 TCTTAAATAGGTGTGGTTTGTGG + Intronic
1095729022 12:45485461-45485483 TCTTATATGGGTGTGCCTTGTGG - Intergenic
1096286531 12:50305430-50305452 TTGAACATGGGTGGGGTTTATGG + Intergenic
1098575803 12:72040842-72040864 TCTTATATAGGTGTGATTCATGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1099355050 12:81623654-81623676 TCTTTCAAGTGTCTGGTTTAAGG - Intronic
1099726585 12:86437816-86437838 TCTTACATGGTTGTGGTGTGTGG - Intronic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100117506 12:91325252-91325274 TTTTATATGAGTGTGGTTCATGG + Intergenic
1100618720 12:96251240-96251262 TCTTATACAGGTGTGGTTCATGG - Intronic
1101927906 12:108988596-108988618 ACTTACTTGGGTGTGGCTTAAGG - Intronic
1102697042 12:114808084-114808106 TCATAAATGTGTGTGGTTTTAGG + Intergenic
1102849571 12:116227604-116227626 TTTTATATGGGTGTGGTTTGTGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1106149325 13:27083145-27083167 TCTTAAATGGGTGCAGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1106989477 13:35399983-35400005 ACTTATATGGGTGCAGTTTATGG + Intronic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1107592124 13:41919720-41919742 TGTTGCATGGGTGTGGTGTCTGG - Intronic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1110217643 13:73041292-73041314 TCTTAAAAGGGAGAGGTTTATGG - Intergenic
1110382517 13:74870106-74870128 CGTTACATGGGTGTGGTTTATGG + Intergenic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1111065257 13:83082696-83082718 TACTACATGGGTGTGGTTTGTGG + Intergenic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112537056 13:100269542-100269564 TCTTTCATGAGTTTGGTGTATGG + Intronic
1112637314 13:101228862-101228884 TCTTACATGACTTTTGTTTATGG + Intronic
1112939501 13:104844269-104844291 TCTTATATGAGTGTGATTTGTGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113304448 13:109061609-109061631 TCTTATATCGGTGTGGTTTGTGG + Intronic
1113487040 13:110661876-110661898 TCTTCCATGGATGTGGTTCATGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1114601980 14:23964009-23964031 TCTTTTCTGGGTGTGGTTTGTGG + Intronic
1114606151 14:23999133-23999155 TCTTTTCTGGGTGTGGTTTGTGG + Intronic
1114611723 14:24046712-24046734 TCTTTTCTGGGTGTGGTTTGTGG + Intergenic
1114890867 14:26921290-26921312 TCTTACATGGATGCAGTTTGTGG - Intergenic
1115019000 14:28651973-28651995 TCTTTTATGGGTGTGGTTTATGG - Intergenic
1115154669 14:30324333-30324355 TCTTATTTGGATGTGGTTTGTGG - Intergenic
1115173616 14:30536506-30536528 TCCAACATGGGTGAGTTTTATGG - Intergenic
1115293567 14:31800366-31800388 TATTATATGGGTGTGGTTTGTGG + Intronic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115627936 14:35213752-35213774 TCTTACGTGAGTGTGGTTCATGG + Intronic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115898144 14:38113858-38113880 TATTTTATGGATGTGGTTTATGG + Intergenic
1116446790 14:45020782-45020804 TTTTACACGGGTGAGGTTTGAGG + Intronic
1116607184 14:47015157-47015179 TCTTTTATGGGTGTGGTTCATGG + Intronic
1116656303 14:47657636-47657658 TCTTACATTGATGTGTTTTATGG - Intronic
1117263433 14:54060798-54060820 TATTACATGGGTGTGGCTCATGG + Intergenic
1117689019 14:58286416-58286438 ACTTAGCTGGGTGTGGTTTCAGG - Intronic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1118037942 14:61888548-61888570 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1118693009 14:68358098-68358120 TCTTACAGAGGTGTGGTTGATGG + Intronic
1118739279 14:68727229-68727251 TTTTAAATGTGTGAGGTTTAAGG + Intronic
1119145151 14:72305598-72305620 TCTTATACAGGTGTGGTTCATGG - Intronic
1120084475 14:80254538-80254560 TCTTATGGGGGTGTAGTTTATGG - Intronic
1120323812 14:83000061-83000083 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121165568 14:91793649-91793671 TCTTATATAGGTGTGGTTCGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1123013829 14:105364000-105364022 TCTTACATGGGTGATGTTCGTGG + Intronic
1124161311 15:27272225-27272247 TCTCACAAGGGTGAGCTTTAAGG + Intronic
1124255390 15:28137590-28137612 TCTTCTATGGGTGTGGTTTGTGG - Intronic
1124568921 15:30842035-30842057 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1124637690 15:31375395-31375417 TCTTCCATTTTTGTGGTTTATGG + Exonic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1125236764 15:37523756-37523778 TCTTAGATGAGTGTGGTTCGTGG + Intergenic
1125652002 15:41325012-41325034 TCTTCAATGGGTGCGGTTTGTGG + Intronic
1125870618 15:43098228-43098250 TCTTTTATGGATGTGGTTCATGG + Intronic
1125979427 15:43987006-43987028 TCTTCTATGTGTGTGGTTCATGG - Intronic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1127948574 15:63781500-63781522 TCTTATATGGGTGTGCTTTGTGG - Intronic
1128536582 15:68495742-68495764 TCTCTCAAGGCTGTGGTTTAGGG + Intergenic
1128690170 15:69718459-69718481 TCTTACATGGGTGCAGTTCATGG + Intergenic
1128722566 15:69961509-69961531 CCTTACATAGGTGAGGTTTGTGG - Intergenic
1129289822 15:74556345-74556367 TCTTATATGGGTGTGATTCTAGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1131301127 15:91200511-91200533 TCTTACATGGTTGTGGTCAGTGG + Intronic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1137234136 16:46599473-46599495 TCTTTTATGGATGTGGTTCATGG + Intronic
1137416158 16:48282620-48282642 TCTTATATGGGTGCAGTTTGTGG - Intronic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138935881 16:61722272-61722294 TTTTAAATGAGTGTTGTTTATGG - Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1141238534 16:82243189-82243211 TCTTACATGGATGGGGCTTATGG - Intergenic
1142734457 17:1887211-1887233 TCTTATATGGGTGTAGTTGGTGG + Intronic
1142908774 17:3069205-3069227 TCTTATGTGGGTGTGGTCCATGG + Intergenic
1142919024 17:3168257-3168279 TCTTACATGGGTGCAGTTCGTGG + Intergenic
1142925792 17:3235040-3235062 TCTTATGTGGGTGTGGTCCATGG - Intergenic
1143200261 17:5108464-5108486 TCTCACATAGGAGTGCTTTATGG + Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149299404 17:55290511-55290533 TCTTATATGGGTGTGGCTCATGG - Intronic
1149725983 17:58895150-58895172 TCTTATATGGGTGCAGTTTGTGG - Intronic
1150090023 17:62315543-62315565 TCTTACATGGTTGCTGTTCATGG - Intergenic
1150164356 17:62927246-62927268 TTCTACATGTGGGTGGTTTAGGG + Intergenic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1152138553 17:78522538-78522560 TCCAACATGGGTGTGACTTAGGG - Intronic
1153270650 18:3317957-3317979 TATTATATGGGTGTGGTTTGTGG + Intergenic
1154249516 18:12731893-12731915 TCTTACATGGGTGCAATTTGCGG + Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155101584 18:22615754-22615776 TCATACATGGGTGCGGTTTGTGG - Intergenic
1155511888 18:26586326-26586348 TCTTATATGGGTGCAGTTCATGG - Intronic
1155561790 18:27086211-27086233 TGTTACATGGGTGTGTGTCATGG - Intronic
1156181784 18:34613184-34613206 TCTTATATGAGTGTAGTTCATGG - Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1158068526 18:53442421-53442443 TCTTATATGGGTGCAGTTTGTGG - Intronic
1159079339 18:63719164-63719186 TCTGTCATGGGTGTGCATTAGGG + Intronic
1159120293 18:64161234-64161256 TCTTACAGGCCAGTGGTTTATGG - Intergenic
1159175633 18:64829921-64829943 TCTTATATGGGTGATGTTTATGG + Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159779828 18:72648225-72648247 TGTTAAATGGGTGTATTTTATGG - Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1164998676 19:32743044-32743066 TCTGACCTGGCTGTGGTTGAGGG + Intronic
1165359176 19:35324174-35324196 TTTTACATGGGTGTGTTTTATGG - Intronic
1165644432 19:37422376-37422398 TCTTACATGGATGAAGTTTGTGG + Intronic
1165686532 19:37826071-37826093 TCTTACATGGGTGCAGCTCACGG - Intergenic
1166580183 19:43890268-43890290 TCTTATATGGGTGTGGCTCACGG + Intronic
1167021928 19:46883493-46883515 TCTTATATTGGTGCAGTTTATGG + Intergenic
1167626824 19:50595833-50595855 TCTGATATGGATGTGGTTCATGG - Intergenic
1168557597 19:57356124-57356146 TCTCACATGGGTGTGCTTTCTGG - Exonic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926608438 2:14921263-14921285 TCTTATATGAGTGTGGTTCATGG + Intergenic
927299057 2:21489616-21489638 TCTTTTATGGGTGAGGTTTGCGG + Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929797317 2:45070116-45070138 TGTTACCTGGGTGGGGTTTATGG - Intergenic
930315198 2:49788848-49788870 CCTTACATGGGTGCAGTTTGTGG + Intergenic
930507146 2:52297638-52297660 TCTTGTATGGATGTGGTTTGTGG - Intergenic
930583135 2:53236572-53236594 TCATATGTGGGTGTGGTTTGTGG - Intergenic
930800299 2:55436932-55436954 TGTTATATGGATGTGGTTTATGG + Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931327213 2:61239053-61239075 TCTTATATGGGTGTAGTTCGTGG - Intronic
931602281 2:64016919-64016941 CCTTAAATGGGTGTATTTTATGG + Intronic
931924857 2:67060971-67060993 TCTTATATGAGTGTGGTTCATGG + Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
932286453 2:70537173-70537195 TCTTCTACGGGTGTGGTTCATGG - Intronic
933160345 2:79016925-79016947 TCTCACATGGGGGAGGTTTGTGG - Intergenic
933182049 2:79238304-79238326 TCTTACATGGCTGTGATTCATGG + Intronic
933268702 2:80209979-80210001 TGTTAGCTTGGTGTGGTTTATGG + Intronic
933667275 2:84973572-84973594 TCTTTCAAGGGTCTAGTTTATGG + Intronic
934564730 2:95332022-95332044 TCTTCCAGTGGTTTGGTTTAAGG + Intronic
934881113 2:97980104-97980126 TGTCATATGGGTGTGGTTTGTGG + Intronic
935036664 2:99383287-99383309 TCTTATAGGGGTGTGGTTTGTGG - Intronic
935172123 2:100618404-100618426 ACTTAGATGGGTGTGGTGGAAGG - Intergenic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
937979285 2:127604825-127604847 TCTTATATGGGTGCAGTTTGTGG + Intronic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938876957 2:135541638-135541660 TCTTATATGGGTGTGATTTGTGG + Intronic
939186046 2:138861869-138861891 TTTTATATGGATGTGGTTTATGG + Intergenic
939207560 2:139127230-139127252 TCTTACATATGTATTGTTTATGG - Intergenic
939274311 2:139980471-139980493 TCATATGTGGGTGTGGTTTGAGG + Intergenic
939285462 2:140123386-140123408 TCATATATGGGTGTGGTTCATGG + Intergenic
939366040 2:141232270-141232292 TCTTAGATGGGTGTGTTATCAGG + Intronic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
940126842 2:150335631-150335653 TCTTATATAGGTGTGGGTGATGG - Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940791917 2:158037940-158037962 TCTTAGATGGTTTTGATTTATGG + Intronic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941727638 2:168880864-168880886 TCTTATATGGGTGTCATTCATGG + Intronic
942747780 2:179255023-179255045 TCTTATATGGGTTTGATTCATGG - Intronic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
943562010 2:189474992-189475014 TCTTGTATGTGTGTGTTTTAAGG + Intronic
943978021 2:194508833-194508855 TCTTATATGAGTGTGGTTTGTGG - Intergenic
944003589 2:194874225-194874247 TCTTACATGAGTGCGGTATGTGG - Intergenic
944100798 2:196023992-196024014 TTTTACATGGGTGCAGTTTGTGG + Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944622913 2:201536684-201536706 TCTTATATAGTTGTGATTTATGG - Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
944719990 2:202414258-202414280 TTTTATATGGGTGTGGTTCCTGG - Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947045291 2:225975595-225975617 TCTTATATGGGTGCTGGTTATGG + Intergenic
947050368 2:226035827-226035849 TCTTACATGAGTGCAGTTTGTGG - Intergenic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
947555423 2:231088597-231088619 TTTTACATGGGTGTGGTTCGTGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948200230 2:236124352-236124374 TCTCTCCTGTGTGTGGTTTAGGG - Exonic
1168912893 20:1464127-1464149 TTTTAACTGGGTGTGGTTTATGG - Intronic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170605319 20:17871272-17871294 ACTTACATGTGTGTGGTTCTTGG - Intergenic
1170642695 20:18169513-18169535 TCTCATATGGGTGTGGTTCATGG - Intronic
1171205490 20:23276092-23276114 TCTTATATGGGTGCAGTTTGTGG - Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1171339412 20:24415612-24415634 TCTTACATGGTTGTAGATAAGGG + Intergenic
1172236360 20:33378347-33378369 TCTTATGTGGGTGTGGCTCATGG + Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1174980820 20:55392600-55392622 TCTTACATAGTCGGGGTTTAAGG - Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177167627 21:17620404-17620426 TCTTGTATGGGTGTGGTTCATGG + Intergenic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178381436 21:32113007-32113029 TCTGAAATGGATGTGGTTGAAGG + Intergenic
1178519443 21:33275871-33275893 TCTTATATAGGTGTGGTTCATGG + Intronic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1180887760 22:19259615-19259637 TCTTATATGTGTGTGGTTCATGG - Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183044126 22:35206231-35206253 TCCTACTTGGGTGTGGTGTCTGG - Intergenic
1183083625 22:35473130-35473152 TCTGTCCTGTGTGTGGTTTATGG - Intergenic
1184083008 22:42238783-42238805 TCTTATATGGGAGTGCTTTGTGG + Intronic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1184883861 22:47330016-47330038 TCTTCATTTGGTGTGGTTTACGG + Intergenic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
1185262155 22:49873423-49873445 TCTGACATGGGTGTGGCTTGTGG + Intronic
949306565 3:2648526-2648548 TCTTATATGGGTGCGGTTCATGG - Intronic
949354490 3:3164027-3164049 TCTTAAATGGGTGCAGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949984663 3:9531106-9531128 TCTTACATGGGCGCAGTTCATGG + Intronic
950315015 3:11994356-11994378 TCTTATATGAGTGCGGTTTGTGG + Intergenic
950976364 3:17249856-17249878 TCTTATATGGGTGCAGTTCATGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951507002 3:23458315-23458337 TCTTCTATGGGTGTGGTTCATGG + Intronic
952084219 3:29798095-29798117 TCTTAAATGGGTGCTGTTCATGG + Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953211881 3:40883107-40883129 TATTCTATGGGTGTGGTTCATGG + Intergenic
953367211 3:42355323-42355345 TCTTCTATGGGTGTGGTTCATGG - Intergenic
953837903 3:46363100-46363122 TCTTACATGGGTGCACTTCATGG - Intergenic
954373220 3:50180667-50180689 TTTTATATGGGTGAGGTTCACGG + Intronic
954577251 3:51683435-51683457 CCTTACATGGCTGAGGTTTCTGG + Intronic
954944591 3:54409319-54409341 TTTTATATGGGTGTGGTTCATGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955360791 3:58273146-58273168 TCTAACATGGGTATGATGTATGG - Intronic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
957260268 3:77893030-77893052 TCTTACATGGGTGCAATTCATGG - Intergenic
957499733 3:81038954-81038976 TCTAAGATGGGTGTGGTTTGTGG + Intergenic
957645245 3:82913910-82913932 TCCTATATGGGTTTGGTTTGTGG - Intergenic
957679248 3:83410401-83410423 TCTTATATGGGTCAGGTTGATGG + Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957955752 3:87184988-87185010 TCTTATATGGGTGTAGTTTGTGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
958718312 3:97814187-97814209 CATTATATGGATGTGGTTTATGG + Intergenic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959238595 3:103757770-103757792 TCTTATGTGGGTGTTGTTTGTGG + Intergenic
959681460 3:109101268-109101290 TCTCACATGGGCCTGGTTAAGGG - Intronic
959784309 3:110275858-110275880 TCTTATATGGGTGTAATTTATGG - Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
960648091 3:119912270-119912292 TCTTATATTGTTGTGGTTTGTGG + Intronic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
960889845 3:122436124-122436146 TCTTATATGGTTGTGGATAAGGG + Intronic
961319153 3:126061008-126061030 TCTTACTGGGGTGTGTTTTTAGG + Intronic
962705905 3:138044227-138044249 CCTTACAAGTGAGTGGTTTAGGG + Intergenic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963126318 3:141820212-141820234 TTTTACATAGGTGAGGTTTGAGG - Intergenic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
964535007 3:157711186-157711208 TCTTACATGGATGTAGTTCATGG - Intergenic
964823288 3:160797287-160797309 TCTTCTATGGGTGTGATTCATGG - Intronic
965005384 3:163016213-163016235 TCTTATAAGGGTGTGGTGTTTGG - Intergenic
965352254 3:167628064-167628086 TCTTGTATGGGTGTGGTTCATGG - Intronic
965833465 3:172825192-172825214 TCTTAGATGGGTGCAGTTTGTGG - Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
966116288 3:176467230-176467252 TCTTGTATGGGTGTGGTCCATGG - Intergenic
966181465 3:177192562-177192584 TCTTAAAAAGTTGTGGTTTAAGG - Intronic
966750878 3:183321062-183321084 TCTTACATGGATGCAGTTTTCGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
970884638 4:20973862-20973884 TCTTACATGGATGTAGTTCATGG + Intronic
970895413 4:21097625-21097647 TGTTATCTGAGTGTGGTTTATGG - Intronic
971588372 4:28433932-28433954 CCTTCTATGGGTGTGGTTTGTGG + Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972571210 4:40312058-40312080 TCTTTCTTGGGTGTGGTTGGGGG - Intergenic
972630830 4:40840466-40840488 TCTTACATGTGTGTGTTTTGCGG - Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
973850033 4:54952543-54952565 TCTTCCATAGGTGTGGTTTGTGG + Intergenic
973883098 4:55293426-55293448 TCGTACATGAGTCTGGATTATGG - Intergenic
974448702 4:62021777-62021799 TCTTATATGGGTGAGGTTCATGG - Intronic
974667346 4:64981550-64981572 TCCTAAATGGGTGTGGTTCATGG - Intergenic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975604111 4:76136002-76136024 TCATACATATGTGTGGTTGAAGG - Intronic
975686556 4:76921594-76921616 TCGTATATGGGTGTGGCTTGTGG + Intergenic
975900383 4:79144738-79144760 TCTTACATGGGTGCAGTTCATGG + Intergenic
976058550 4:81098732-81098754 TCTTATATGGCTGCGGTTTGTGG + Intronic
976465460 4:85363207-85363229 TCTTGTATGGGTATGGTTTCTGG + Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977069744 4:92370224-92370246 TCTTACATGGGTGAAATTCATGG - Intronic
977314338 4:95426274-95426296 TCTTATATGAGTGTGGTTCATGG - Intronic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977715132 4:100173612-100173634 TCTCATATGGGTGTGGTTCGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979626001 4:122846178-122846200 TCTTATATGGGTGTAGTTTGTGG + Intronic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979823224 4:125200465-125200487 TCTTCTATGGGTGAGGTTTATGG - Intergenic
979846252 4:125516295-125516317 TCTTATTTGGGTGTGGTGCATGG + Intergenic
980374697 4:131929097-131929119 TCTTATATAGATGTGGTTCATGG + Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980759990 4:137220274-137220296 TCTTATATGGGTGCAGTTCATGG - Intergenic
981191403 4:141869060-141869082 TCTTATATGGATGCGGTTTATGG + Intergenic
981416475 4:144499694-144499716 TTTTATATGGGTGCGGTTTATGG - Intergenic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982148217 4:152421866-152421888 TCTTCTATGGGTGTGGTTCATGG + Intronic
982149389 4:152435945-152435967 TCTTCCATGGGTGCGGTTTGTGG - Intronic
982842050 4:160201308-160201330 TCTTATGTGGGTGTGATTTATGG + Intergenic
983061862 4:163169622-163169644 TCTTACAAGGGTAAGCTTTAAGG - Intergenic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983987415 4:174076349-174076371 TATTATAGGGGTGTGGTTTGTGG + Intergenic
984121362 4:175749127-175749149 TCTTATATGAGTATAGTTTATGG + Intronic
984479115 4:180276302-180276324 TTTTACATGGTTCTGGTTCATGG - Intergenic
984685546 4:182664336-182664358 TCTTATGTGGGTGTGGTTTCTGG - Intronic
985185613 4:187311948-187311970 TCTTACATGGGTGCAGTTCATGG + Intergenic
987328940 5:16837973-16837995 TCTTGTATGGGTGTGGTTTGTGG - Intronic
987501938 5:18722795-18722817 TTTTATATGGCTGTGGTTTGTGG + Intergenic
987629678 5:20452922-20452944 TCTATCGTTGGTGTGGTTTAAGG - Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988278702 5:29115497-29115519 TCTTATATGGGGGTGATTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990766922 5:59194460-59194482 TGTTTCATGGGTGTTGTTTTGGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
992922219 5:81537718-81537740 TCTTGTATGGGTGTGGTTCACGG - Intronic
993400469 5:87443578-87443600 TCTTCTGTGGGTGTGGTTTGTGG + Intergenic
993787309 5:92159181-92159203 TCTTATATGGGTGCTGTTTGTGG - Intergenic
994577366 5:101595323-101595345 TATTTCATGGGTGGTGTTTATGG - Intergenic
994827738 5:104736697-104736719 TCTTGTATGGATGTGGTTTGTGG + Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995670094 5:114593426-114593448 TCTTATATGGGTGTGCTTCATGG + Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
996045429 5:118867739-118867761 TCTTTCAGCAGTGTGGTTTATGG - Intronic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
996847609 5:127917677-127917699 TCTTATATGGGTGCAGTTCATGG + Intergenic
997602684 5:135151111-135151133 TCTTACCTGGGTGTCCTTTGAGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999497310 5:152112060-152112082 TCTTATATGAGTGTGGTTCTTGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000389272 5:160706089-160706111 CCTTACATGAGTGTGGTTGGCGG + Intronic
1000429912 5:161139099-161139121 ACTTTCTTGGGTGTGGTTAAGGG - Intergenic
1000643525 5:163734500-163734522 TCCTCCCTGGTTGTGGTTTAGGG + Intergenic
1000782645 5:165502271-165502293 TCTTCTATGGGTGTAGTTTGTGG + Intergenic
1001630946 5:173175037-173175059 TCTTACATGGGTGAATTGTATGG - Intergenic
1001655863 5:173349129-173349151 TCTTATATGGGTGCCGTTTGGGG - Intergenic
1001895686 5:175377990-175378012 TCTTCCAAGGCTGTGGTTTTTGG - Intergenic
1002487204 5:179547371-179547393 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1003412426 6:5877263-5877285 TCTTTCAGGGGTGTGGTATGTGG + Intergenic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004152848 6:13136853-13136875 TCTTATATGGGTGTGATTTGTGG + Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004922823 6:20392949-20392971 TCTTATATGGGTGTGTTTAGTGG + Intergenic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005402245 6:25446961-25446983 TCTTATATGGGTGTGATTCATGG + Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1006913566 6:37579791-37579813 TTTAACATGTGTGTTGTTTAAGG - Intergenic
1007142024 6:39585648-39585670 TCTTTCATGTGTGTGGATTATGG - Intronic
1007324638 6:41050598-41050620 TCTCACATGGGTGTGAATTATGG - Intronic
1007650898 6:43420939-43420961 TCTTACATAGGTGTGATTTGTGG - Intergenic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1008161157 6:48077834-48077856 TCTTGTATGGGTGCAGTTTAAGG + Intergenic
1008299105 6:49812391-49812413 TCTTATATGGGTGTGGTCCATGG + Intergenic
1008319415 6:50089688-50089710 TCTTATATGTGTGTGATTTGCGG - Intergenic
1008622500 6:53284879-53284901 TCTTATATAGGTGTGGTTCATGG - Intronic
1008721633 6:54361069-54361091 TCTTATATGGGTGCTGTTTGCGG - Intronic
1008916822 6:56797192-56797214 TCTTATATGGTTGTGGCTTGTGG - Intronic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009461061 6:63914040-63914062 TCTTATATAGGAGTGGTTTGTGG - Intronic
1009525700 6:64742280-64742302 TCTTATATGGGTGTGGCTTATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1011069829 6:83368139-83368161 TCTTATATGGGAGCGGTTCATGG + Intronic
1011201605 6:84842955-84842977 TCTCAGCTGGGTGTGGTTTCTGG - Intergenic
1011391757 6:86861565-86861587 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1011872075 6:91907923-91907945 CCTTAAATGGGTGTGGTTCATGG + Intergenic
1012287685 6:97412895-97412917 TCTTACATGGGTGCACTTCATGG + Intergenic
1012365864 6:98439260-98439282 TCTTACATAGATGTGCTTTTTGG + Intergenic
1012377605 6:98581183-98581205 TCTTACTAGGGTGTGGATTGGGG + Intergenic
1012918432 6:105196166-105196188 TCTTATGTGGGTGTGGCTTGTGG - Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013172627 6:107650603-107650625 TCTTACATGGGTGCAGTTCATGG - Intronic
1013381868 6:109581058-109581080 TCTTATATAGATGTGGTTCATGG - Intronic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013796102 6:113890882-113890904 TCTTCTATGGGTGTGGTTTTTGG - Intergenic
1013814459 6:114081143-114081165 TCTTATGTGGGTGTAGTTTATGG + Intronic
1014294211 6:119598483-119598505 TCTAATATGGGTGTGGTTCATGG + Intergenic
1014521510 6:122449033-122449055 TCTTATATGGGTGTGATTTGTGG - Intronic
1014590586 6:123262824-123262846 CCTTATATGGGTGTGGTGTGTGG - Intronic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015810357 6:137156220-137156242 TGTTACATTGGTCTGATTTATGG - Intronic
1015900943 6:138065998-138066020 TCTTACGTGGGTGCAGTTTGTGG - Intergenic
1015939723 6:138435946-138435968 TCTTATGTGGGTGTGATTTGTGG - Intronic
1016220371 6:141661784-141661806 TCTTATATGGGAGTGATTTGTGG + Intergenic
1016344188 6:143093877-143093899 TCTTCTATGGGTGAGGTTTGAGG + Intronic
1016490841 6:144600048-144600070 TCTTATATGGGTGTGGCTTGAGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016867382 6:148780892-148780914 TCTTATATGGGTGCAGTTTGTGG - Intronic
1017068820 6:150554045-150554067 TCTTATATGGGTGCAGTTCATGG - Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017385026 6:153873424-153873446 TCTTACGTGGGGGTGATTCATGG + Intergenic
1017734663 6:157350405-157350427 TCTTATATGGGTGTGATTCCTGG - Intergenic
1018271470 6:162082869-162082891 TCTCATATGGGTGTGGTTCATGG + Intronic
1018320855 6:162607093-162607115 TTTTACACGGGTGGGGTTTGAGG + Intronic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1018881414 6:167885562-167885584 TCTTATATGGGTGCAGTTCATGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021132810 7:16931589-16931611 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021282765 7:18740454-18740476 TCTTGATTGGGTGTGGTTCATGG - Intronic
1021829867 7:24594666-24594688 TCTTATATGGGGGTGATTCATGG + Intronic
1021974794 7:26001211-26001233 TCTTATATGGGTGCAGTTCATGG + Intergenic
1022061955 7:26806056-26806078 TCCTATATGGGTGTGGCTCATGG - Intronic
1022186804 7:27977387-27977409 TCTTATGTGGGTTTGGTTTTAGG + Intronic
1022197193 7:28080745-28080767 TCTTATATGGGTGCAGTTCATGG + Intronic
1022548899 7:31217730-31217752 TTTTATATGGGTGTGGTTCATGG + Intergenic
1022958842 7:35405853-35405875 TCTGAAATGGATGTGGTTTGTGG - Intergenic
1023026067 7:36050878-36050900 TCTTATATGGGTGCGGTTCATGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1025116213 7:56260683-56260705 TCTTACATGGCTGGAATTTATGG - Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1027556322 7:79669095-79669117 TCTTTCATGGCTCTGGTTCAAGG + Intergenic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028285509 7:88992182-88992204 TCTTCCAAAAGTGTGGTTTAAGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028938361 7:96490849-96490871 TCAGATATGGGGGTGGTTTATGG + Intronic
1030111760 7:106032673-106032695 ACTTTCCTGGGTGTGGTTTGGGG - Exonic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1031057316 7:117006895-117006917 TCTTATATGGATGTGGTTTGCGG - Intronic
1031183699 7:118448804-118448826 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1031307389 7:120148037-120148059 TCTTATATTAGTGTAGTTTATGG + Intergenic
1031454870 7:121966868-121966890 TTTTACATGATTGAGGTTTAGGG - Intronic
1031498729 7:122485031-122485053 TCTTATATGGGTGTAGTTTGTGG - Intronic
1031564555 7:123279141-123279163 TCTTATATGGGTGGGGTTTGTGG + Intergenic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032558630 7:132864371-132864393 TTTTATATGGGTGTGGTCTGTGG + Intronic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033112509 7:138593776-138593798 TCTTACATGAGTGTGGTTAGTGG + Intergenic
1033139804 7:138816084-138816106 TCTTATATGGGTGAGGTTGGTGG - Intronic
1033388417 7:140902289-140902311 CCTTATATGGGTGTGGTTCGTGG - Intronic
1033607762 7:142939895-142939917 CCTGACATAGGTCTGGTTTATGG + Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1034995242 7:155572757-155572779 TCTCACAAGGCTGTTGTTTATGG - Intergenic
1036469106 8:9034565-9034587 TCTTATATGGGTGTGGTCTGTGG - Intronic
1036599438 8:10246540-10246562 TCTTAAATAAGTGTGGTTTGTGG + Intronic
1037263365 8:17032955-17032977 TCTTATATGGGTGCGGTTCATGG - Intronic
1037369238 8:18156352-18156374 TCTTTCAGGGTTGTGATTTATGG - Intergenic
1037519158 8:19662890-19662912 TGTTTCATGGGAGTGGTTGAAGG - Intronic
1040636268 8:49277161-49277183 TCTTACATGGGTGCAGTTTGTGG - Intergenic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041100153 8:54388336-54388358 TCTTATGTGGGTGTGGCTTGTGG + Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042441028 8:68826853-68826875 TCTTATATGAGTGTGGTCCATGG + Intergenic
1042471766 8:69197769-69197791 GCTTACATTGGTTTGCTTTATGG - Intergenic
1042547998 8:69967980-69968002 TCTTACACGGGGGTGGTTTATGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044054044 8:87545874-87545896 CCTCACATGTGTCTGGTTTAGGG + Intronic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044803247 8:95978568-95978590 TCTTACCAGGGTCTGGTTGAGGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1047009906 8:120660974-120660996 ACTTACATGGGTGTAGTTTGTGG + Intronic
1047034520 8:120922475-120922497 TTTTATATGGGAGTGGTTCATGG + Intergenic
1047147710 8:122223427-122223449 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1047415447 8:124661277-124661299 TCTAACATTGGTGTTGTTTCTGG - Intronic
1047630756 8:126705296-126705318 TCTTATATGGGTGTGACTGATGG + Intergenic
1048062381 8:130933995-130934017 TTGTACATGGGTGTCCTTTAGGG - Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049227429 8:141463079-141463101 TCTTATATGAGTGTGGCTCATGG - Intergenic
1049629138 8:143642769-143642791 TCTTATATGGGTGCGGTTCATGG + Intronic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050574679 9:6981377-6981399 ACTTACATGAATGTGTTTTATGG + Intronic
1050792575 9:9492930-9492952 TCTTATATGGGTTGGGTTCATGG - Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051147207 9:14040081-14040103 TCTTATATAGGTGTGATTTGTGG + Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052371365 9:27668644-27668666 TTTTATATGGGTGGGGTTTGTGG + Intergenic
1053217773 9:36286941-36286963 TCTTATATGGGTGCGATTTGTGG + Intronic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1054795903 9:69301549-69301571 TCTTGTATAGGTGTGGTTCATGG + Intergenic
1054895952 9:70311390-70311412 TCTTACCTAGGTGTGGTATGTGG + Intronic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055569715 9:77604231-77604253 TCTTATTTGGCTGTGGTTTTGGG - Intronic
1055807406 9:80111957-80111979 TCTTATCTGGGTGAGGTTCATGG + Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056181730 9:84090277-84090299 TCTTATGTGGGTGTCATTTATGG + Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057287378 9:93768958-93768980 GCTCACATGGATGTGGTTCATGG + Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059089128 9:111336864-111336886 TTTTACACAGGTGAGGTTTAAGG - Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1059951815 9:119472129-119472151 TCTTACATATGTGTGGTTTAAGG - Intergenic
1060066437 9:120505308-120505330 TCTTATATGGGTGTGATTTGAGG - Intronic
1060334414 9:122707977-122707999 TCTTACATGGATGTTGTCTTTGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1186199350 X:7140960-7140982 ACTTATATGGGTGCGGTTCATGG - Intronic
1186942350 X:14523766-14523788 TCCTATACGGGTGTGGTTCATGG + Intergenic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1186994781 X:15108407-15108429 TCTTCTATAGGTGTGGCTTATGG - Intergenic
1187760115 X:22573864-22573886 TCTTATATGGGTGCAGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188456154 X:30368715-30368737 TCTTATATGGGTGAAGTTCATGG + Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189460668 X:41240178-41240200 TTGAACATGGGTGGGGTTTATGG - Intergenic
1189708665 X:43785838-43785860 TCTTATATGGGTGCTGTTTATGG + Intronic
1189942602 X:46141091-46141113 TCTTCCAAGGGTGCGGTTTGTGG - Intergenic
1190445551 X:50520367-50520389 TCCTGGGTGGGTGTGGTTTAAGG - Intergenic
1190486600 X:50932417-50932439 TCTTATATGGGTACAGTTTATGG - Intergenic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191926524 X:66316991-66317013 TTTTACATGGATGTGGCTGATGG + Intergenic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193331524 X:80240187-80240209 TCTTATAAGAGTGTGGTTCATGG - Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194141242 X:90212996-90213018 TCCTATATGAGTGTGGTTTGTGG + Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1195231184 X:102849921-102849943 TCTTAGATGGGTGTAGTTTGTGG + Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196000268 X:110776067-110776089 TCTTACATGTCTGTAGCTTATGG - Intronic
1196067330 X:111478500-111478522 TCTTATCTGGGTGTGGCTTGTGG + Intergenic
1196578043 X:117343969-117343991 TCTTATCTGGGTGTGGTTCGTGG + Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1197709681 X:129656475-129656497 TTTTACTTGAGTGTGGTTAATGG - Intergenic
1198281424 X:135146601-135146623 TCTGATATGGGTGTGGTTCTTGG + Intergenic
1198289535 X:135225915-135225937 TCTGATATGGGTGTGGTTCTTGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199281393 X:146004207-146004229 TCTTATATGGATGGGGTTTGTGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200486996 Y:3782098-3782120 TCCTATATGAGTGTGGTTTGTGG + Intergenic
1200514126 Y:4120666-4120688 TTTTATATGGGTGTGGTTCATGG + Intergenic
1200803862 Y:7411924-7411946 TTTTACATGTGTGTGGCTTGGGG + Intergenic