ID: 979649463

View in Genome Browser
Species Human (GRCh38)
Location 4:123113993-123114015
Sequence CAGGATGACCAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 964
Summary {0: 2, 1: 40, 2: 88, 3: 227, 4: 607}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979649463_979649467 16 Left 979649463 4:123113993-123114015 CCTCTCTGCTGCTGGTCATCCTG 0: 2
1: 40
2: 88
3: 227
4: 607
Right 979649467 4:123114032-123114054 GCAGAGAGGAGGCCCTGAAGAGG 0: 8
1: 136
2: 252
3: 288
4: 657
979649463_979649465 2 Left 979649463 4:123113993-123114015 CCTCTCTGCTGCTGGTCATCCTG 0: 2
1: 40
2: 88
3: 227
4: 607
Right 979649465 4:123114018-123114040 GTCTGCAGCTCTTAGCAGAGAGG 0: 1
1: 25
2: 155
3: 472
4: 782
979649463_979649468 17 Left 979649463 4:123113993-123114015 CCTCTCTGCTGCTGGTCATCCTG 0: 2
1: 40
2: 88
3: 227
4: 607
Right 979649468 4:123114033-123114055 CAGAGAGGAGGCCCTGAAGAGGG 0: 5
1: 74
2: 156
3: 272
4: 730
979649463_979649466 5 Left 979649463 4:123113993-123114015 CCTCTCTGCTGCTGGTCATCCTG 0: 2
1: 40
2: 88
3: 227
4: 607
Right 979649466 4:123114021-123114043 TGCAGCTCTTAGCAGAGAGGAGG 0: 3
1: 84
2: 160
3: 234
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979649463 Original CRISPR CAGGATGACCAGCAGCAGAG AGG (reversed) Intronic
900191573 1:1354397-1354419 CAGGATGAAGAGCAGCAGCGTGG + Exonic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900792535 1:4689840-4689862 GCGGATGCCCAGCAGCAGAGGGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901604721 1:10450175-10450197 AAGGAAGAGCAGCAGCAGGGTGG + Exonic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901957714 1:12798323-12798345 CAGGAAGACCAGTGGCAGAGAGG + Intergenic
901965707 1:12864075-12864097 TAGGAAGACCAGTGGCAGAGAGG + Intronic
901981106 1:13034453-13034475 TAGGAAGACCAGTGGCAGAGAGG + Intronic
902000981 1:13194477-13194499 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
902020211 1:13340181-13340203 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
902933173 1:19745501-19745523 CAGGAGGACCAGAAGTGGAGGGG - Intronic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903101795 1:21036108-21036130 CAGGACGACCAAAGGCAGAGAGG + Intronic
903102904 1:21048632-21048654 CAGGAAGACACGCAGCACAGTGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903305074 1:22407660-22407682 GAGGGTTGCCAGCAGCAGAGGGG + Intergenic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903672100 1:25042603-25042625 CAGGACAACTAGCTGCAGAGAGG - Intergenic
903672122 1:25042784-25042806 TAGGATGACCAGCTGTAGAGAGG - Intergenic
904042916 1:27594465-27594487 CAGGATGACCAGGTGCCAAGGGG + Intronic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904422939 1:30405723-30405745 CAGGGTGTTCAGCATCAGAGAGG + Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
905001326 1:34672007-34672029 CAGGATGACTGGCTGCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
905339224 1:37266843-37266865 AAGGGTGCCCAGGAGCAGAGTGG - Intergenic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
906854811 1:49292690-49292712 CAGGATTACCTGCTGCAGAGAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907783349 1:57587648-57587670 TAAGCTGACCTGCAGCAGAGTGG - Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908795970 1:67832329-67832351 CAGGATGACCACCAGATGACCGG + Intronic
909238269 1:73180585-73180607 CAGAACGACCAGCAGTAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
910648214 1:89536187-89536209 CCTGATGACCTGCAGTAGAGGGG + Intronic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911127575 1:94354555-94354577 CAGGAAGCCCAGAGGCAGAGTGG - Intergenic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
911941973 1:104057949-104057971 CCAGCTGACCTGCAGCAGAGGGG + Intergenic
912235443 1:107845183-107845205 CAGCCAGACCTGCAGCAGAGAGG + Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913158430 1:116123197-116123219 CAGGCAGACCGGCAGCCGAGAGG - Intronic
913345879 1:117810713-117810735 CAGGAGGGAGAGCAGCAGAGAGG - Intergenic
914392717 1:147236741-147236763 TGGGATAACCAGCCGCAGAGAGG - Intronic
915138962 1:153754397-153754419 CTGGAAGACCAGCAGAAGACAGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915216367 1:154343242-154343264 CAGGATGGCCAGCAGCTGGTAGG - Exonic
915281113 1:154822761-154822783 CAGGAAGCACAGGAGCAGAGAGG + Intronic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
916648802 1:166816385-166816407 TGGAATGACCAGCATCAGAGAGG - Intergenic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
917612279 1:176700612-176700634 AAGGGTTTCCAGCAGCAGAGAGG + Intronic
917817632 1:178725943-178725965 CAGGGTGACCTGTTGCAGAGCGG + Intronic
917977936 1:180252068-180252090 CAGGCTGTCCAGCATCTGAGTGG + Intronic
918159948 1:181889229-181889251 GAGGGTGAGCAACAGCAGAGTGG + Intergenic
918963193 1:191306580-191306602 TAGGACGACCAACTGCAGAGAGG - Intergenic
919073671 1:192788399-192788421 CAGGATGAGCAGCAGCTCTGGGG - Intergenic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919313954 1:195948184-195948206 CAGGACGACGAGTTGCAGAGAGG - Intergenic
919523571 1:198619807-198619829 CAGGAGTACCAGAAACAGAGAGG + Intergenic
919834183 1:201562491-201562513 CAGGAGGCCCAGCTGCTGAGGGG - Intergenic
920118308 1:203636875-203636897 CAGGATGACCAGGGGAAAAGAGG + Intronic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
924412086 1:243817065-243817087 CAGGATGACCTGCTAGAGAGAGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1063095139 10:2902586-2902608 CAGAATGACCAGCTCTAGAGTGG + Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1064102136 10:12472988-12473010 CAGGATGAGCAGAAACACAGAGG + Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065114326 10:22469815-22469837 CAGGGTGACCTCCAGCAGACTGG - Intergenic
1066753917 10:38690279-38690301 CAGGATGACAATAATCAGAGGGG - Intergenic
1066930001 10:41746309-41746331 CAAAATGACCATCCGCAGAGTGG - Intergenic
1067018079 10:42772315-42772337 CATGATGACCAGCTGCAGGGAGG + Intergenic
1067288107 10:44922084-44922106 CCGGATAACTAGGAGCAGAGTGG - Intronic
1067553559 10:47252471-47252493 GGGGATGAACAGCAGGAGAGAGG + Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068279866 10:54854667-54854689 CCTGATGATCAGCTGCAGAGAGG - Intronic
1068283652 10:54908931-54908953 CAGGATGACCAGCTGCAACAAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1068956241 10:62820363-62820385 CAGGATCACCATCAGCCAAGAGG + Intronic
1069156293 10:65034808-65034830 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1069249093 10:66245810-66245832 CAGTATGACCAGAACCTGAGAGG - Intronic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1072622607 10:97090051-97090073 CTGGATGAACAGCAGCGGCGAGG - Intronic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1072872402 10:99133625-99133647 CCAGCAGACCAGCAGCAGAGGGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073161045 10:101395352-101395374 GAGGAAGAACAGCAGCACAGAGG - Intronic
1073260681 10:102188201-102188223 CAAGATGACCAGTAGCAGACAGG - Intergenic
1073323465 10:102629409-102629431 CAGGGTTACCAGCCTCAGAGTGG - Intronic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073601867 10:104853718-104853740 TGGGATGATCAGCAGCAGGGCGG + Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074028820 10:109664098-109664120 TAGGATGACCAACTGCAGGGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074879727 10:117646541-117646563 GATGATGACAAGAAGCAGAGGGG - Intergenic
1074985062 10:118651527-118651549 CCGGCAGACCTGCAGCAGAGGGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075002472 10:118808710-118808732 GAGGAGGAGGAGCAGCAGAGGGG - Intergenic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075222470 10:120597128-120597150 CAGGATAACCAGCTGAAGATTGG - Intergenic
1076165451 10:128278718-128278740 CGGGATGAGCAGCAGCATCGTGG - Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076750471 10:132539591-132539613 CAGGAGTACCAACAGCAGGGTGG - Intronic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077474995 11:2782165-2782187 GAGGATGAACAGCAGCACGGCGG - Intronic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1078797841 11:14611088-14611110 CAGCAAGGCCAGTAGCAGAGTGG - Exonic
1079244543 11:18743022-18743044 CAGAAAGACCAGCAGCAGACTGG + Exonic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081756908 11:45551287-45551309 CAGGAGGACCTGCAGGAGATGGG - Intergenic
1081806120 11:45891545-45891567 CAGGCAGCCCAGCAGCAGACGGG + Intronic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083079822 11:60079648-60079670 CAGGGTGAGGAGGAGCAGAGGGG - Intergenic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084469457 11:69348590-69348612 CAGGATGACCAGCTGCAGCTGGG - Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1084996774 11:72987696-72987718 CAGGATGAACATGAGCACAGTGG - Intronic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085704323 11:78772413-78772435 AAGACTGAGCAGCAGCAGAGAGG - Intronic
1085882351 11:80482873-80482895 CAGGAAGTCCAGAGGCAGAGTGG - Intergenic
1086085059 11:82945432-82945454 CAGGACAACCAGCAGTAGAAAGG - Intronic
1086085068 11:82945502-82945524 CAGGATGACTAGTCGTAGAGAGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087466617 11:98515706-98515728 AAGGGAGACCAGCAGGAGAGTGG + Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1089344404 11:117781590-117781612 AATGAGGACCAGCAGAAGAGTGG + Intronic
1089398009 11:118148424-118148446 CAGGATGACCAAGTCCAGAGAGG + Intronic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1089925978 11:122258181-122258203 CATGATTAGCAGCATCAGAGGGG - Intergenic
1090124859 11:124075276-124075298 TGGGAGGACCCGCAGCAGAGAGG - Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1090446114 11:126766199-126766221 CAGGAAGACAAGGAGAAGAGAGG - Intronic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091228879 11:133974952-133974974 CAGGGTGACCTGCAGCCGTGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1093483494 12:19628738-19628760 TGTGAGGACCAGCAGCAGAGGGG - Intronic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094144506 12:27214421-27214443 CAGGAGGACTAGCTGCAGAGAGG + Intergenic
1095145420 12:38721161-38721183 GGGGTTGACCAGCAGCAGAAAGG + Intronic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096443014 12:51662006-51662028 CAGGCAGAGCAGCAGCAGAAGGG - Intronic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1096983710 12:55743330-55743352 CAGGAAGCCCAGCAGCAGCGGGG - Exonic
1097055632 12:56247586-56247608 CATGATGGCCAGCATCAGTGGGG + Exonic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298971 12:57998031-57998053 CAGGAGGACCAGCTTCAGAGTGG - Intergenic
1097418615 12:59346239-59346261 CAAGATGACCAGTAGCAGGCAGG - Intergenic
1097491967 12:60282325-60282347 CAGGATGATCAGCTGCGGAGAGG - Intergenic
1097581959 12:61468954-61468976 CAGGATGTCCAACATCAGAATGG - Intergenic
1098465606 12:70783433-70783455 CAGAATGATCAGCTACAGAGAGG - Intronic
1099071261 12:78048471-78048493 CCAGAAGACCTGCAGCAGAGGGG - Intronic
1099344451 12:81480665-81480687 CAAGCAGACCTGCAGCAGAGGGG - Intronic
1099892328 12:88605214-88605236 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1102442220 12:112972051-112972073 CAAGTTGTCCAGCAGCAGAGTGG + Exonic
1102442587 12:112974989-112975011 CAGCATGACCAGCAGAAGTCGGG + Intergenic
1102499380 12:113340906-113340928 CAGCATGATGGGCAGCAGAGGGG + Intronic
1103001985 12:117391842-117391864 CAAGATGACCATCACAAGAGTGG - Intronic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1104709401 12:130974859-130974881 CAGGCAGACAAGCAGCAGAGAGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107551372 13:41479559-41479581 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1107853482 13:44592297-44592319 CAGGAGGACCAGCTGCAAAGAGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108407100 13:50115468-50115490 CAGGAGTACCAGCAGCAGATGGG + Intronic
1108509723 13:51145765-51145787 CAGGAAGACTGGAAGCAGAGAGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1111168268 13:84491528-84491550 CAGGCTCACCAGCAGAGGAGAGG + Intergenic
1111237814 13:85431537-85431559 CAGAATGACCAGCTGAGGAGAGG + Intergenic
1111337226 13:86840056-86840078 CATGATGACCAGCTGTAGAGAGG - Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1111512658 13:89287226-89287248 CAGGACTACTAGCTGCAGAGAGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112397716 13:99048344-99048366 GAAGATGAGCAGTAGCAGAGGGG - Intronic
1113357975 13:109601348-109601370 CAGGATGGGCAGGAGCTGAGTGG + Intergenic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116541487 14:46107429-46107451 CAGAATGACCAGCTGTGGAGAGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117490750 14:56244592-56244614 GAGGATGAGCATTAGCAGAGTGG - Intronic
1118117483 14:62796852-62796874 CAGGAAGACTGGAAGCAGAGAGG + Intronic
1118200077 14:63663507-63663529 CAGGATGACCAGCTATGGAGAGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1118498553 14:66333631-66333653 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119036212 14:71231977-71231999 CACGCCGACCAGCTGCAGAGAGG + Intergenic
1119342730 14:73894243-73894265 TTGGATGAACATCAGCAGAGTGG + Intronic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120590063 14:86364270-86364292 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1120829322 14:88984143-88984165 CAGGATCACCAGCTGCTCAGTGG - Intergenic
1121397957 14:93643661-93643683 CATGATATCCAGCAGCAGCGGGG - Exonic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1122072375 14:99213039-99213061 CAGGATGCCCACCAGGGGAGAGG + Intronic
1122592887 14:102868077-102868099 CAGGATGCCCAGGAGCTCAGGGG + Intronic
1123019893 14:105392766-105392788 CAGGCTGCCCAGCAGCGGCGAGG + Exonic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216608 14:106813901-106813923 CAGGACGACCGGCTGCAGGGAGG + Intergenic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124820913 15:33044773-33044795 CAGGATGACCAGCTGTACAGAGG + Intronic
1124875912 15:33593018-33593040 CAGGAAGACCGGAAGCTGAGAGG + Intronic
1124962716 15:34410364-34410386 CAGCATCACCAGCACCAGTGAGG + Intronic
1124979342 15:34556586-34556608 CAGCATCACCAGCACCAGTGAGG + Intronic
1125104800 15:35957921-35957943 CAGGATGCCCAGTAGCAGCCAGG - Intergenic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1126156856 15:45574042-45574064 CAGGATGGCCAGCTGCATAGAGG - Intergenic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127844328 15:62856524-62856546 CAGGGTGGGCTGCAGCAGAGTGG + Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129507853 15:76098334-76098356 CTAGCAGACCAGCAGCAGAGGGG - Intronic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1130183193 15:81651906-81651928 CAGGATGACCTGCTGCAGAAAGG + Intergenic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130724121 15:86420352-86420374 CAAGCAGACCTGCAGCAGAGGGG + Intronic
1132882100 16:2167045-2167067 GGGGATCACCAGCAGCAAAGAGG - Intronic
1136728826 16:32386906-32386928 CAGGATGACAATAATCAGAGGGG + Intergenic
1136872797 16:33824122-33824144 CAGGACGACTAGCTGCAGGGAGG - Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872821 16:33824290-33824312 CAGGAAGACCAGCTGCAGGGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1138346988 16:56326175-56326197 CAGGGTGTGCACCAGCAGAGTGG - Intronic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1139295357 16:65895714-65895736 CAGGATGTGCAACAGCAGTGTGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139625805 16:68187679-68187701 CAGGATGACCAGCTGTGGAGAGG - Intronic
1140457135 16:75112080-75112102 CAGGATGCGTAGGAGCAGAGAGG + Exonic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1141675069 16:85513526-85513548 GAGGTTGAGGAGCAGCAGAGGGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142202235 16:88766770-88766792 CAGGATCACCAGCCCCAGAACGG + Intronic
1142298447 16:89242351-89242373 CAGGCTGAGCATCAGCACAGAGG + Intergenic
1202997609 16_KI270728v1_random:130833-130855 CAGGATGACAATAATCAGAGGGG - Intergenic
1203024296 16_KI270728v1_random:443175-443197 CAGGATGACAATAATCAGAGGGG - Intergenic
1203099350 16_KI270728v1_random:1291764-1291786 CAGGAAGACCAGCTGCAGGGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1143409550 17:6700606-6700628 CGGGGTGCCCAGCATCAGAGTGG + Intronic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1143864037 17:9911181-9911203 CAGCATCACCTGCAGCAGACGGG - Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1144722905 17:17484648-17484670 CAGGATGAGCAGCCACAGATAGG + Intronic
1144859247 17:18289893-18289915 CAGGAATACCTGCAGCACAGTGG - Intronic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1147507499 17:41034334-41034356 CAGGAGTAGCAGCAGCAGACTGG + Exonic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1149026953 17:52037776-52037798 CAGGATGACCAAAGGCACAGAGG - Intronic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150634859 17:66905750-66905772 CAGGATAGCAAGCAGGAGAGTGG + Intergenic
1150676085 17:67246237-67246259 GAGGATGCCCGGCAGCAGTGTGG - Intergenic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010010 17:70483661-70483683 CAGGATGGCCAGCTGTGGAGAGG - Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151084905 17:71368984-71369006 CAGGATGACAAGAAGAAGACAGG + Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151541493 17:74767193-74767215 CAGGATGGCGGGCTGCAGAGGGG - Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152271828 17:79329376-79329398 CAGGATCACCGGCAGGAGTGTGG - Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1153681941 18:7509205-7509227 CAGCATGAACACCAGGAGAGAGG - Intergenic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155168079 18:23247280-23247302 CAGAAGGACCTGCAGCTGAGAGG + Intronic
1155830861 18:30513666-30513688 CAGGACAACCAGTAGTAGAGAGG - Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157327553 18:46679986-46680008 CAGGAGGGACAGCAGGAGAGGGG + Exonic
1157392220 18:47312395-47312417 CAGAATGACAAGCAGCAGCCTGG + Intergenic
1157524630 18:48371569-48371591 CAGGATAACCAGGAAGAGAGTGG + Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159569542 18:70096551-70096573 CCAGCAGACCAGCAGCAGAGGGG - Intronic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1160123795 18:76152677-76152699 CATGAAGACCAGCCTCAGAGGGG + Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160591211 18:79945607-79945629 GAGGACGGCCAGCAGCAAAGAGG + Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1163250623 19:16124526-16124548 CAGGATGCCCGGCAACAAAGGGG + Intronic
1163715150 19:18868996-18869018 GAGGGTCACCAGCAGCAGCGAGG + Exonic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1165022663 19:32936696-32936718 TCAGAGGACCAGCAGCAGAGAGG + Intronic
1166381021 19:42355473-42355495 CAGGATGACCAGTAGGGGATGGG + Intronic
1166748309 19:45152395-45152417 CTGGAGGACCGGCAGCAGACCGG - Exonic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167293560 19:48636941-48636963 CGGGCCGCCCAGCAGCAGAGGGG + Exonic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
1167510077 19:49891165-49891187 CAGGAGGCCCAGCTGCGGAGGGG - Intronic
1168426380 19:56242480-56242502 CAGGGAGACAATCAGCAGAGGGG - Intronic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
925515334 2:4674917-4674939 CAGGATGACCCGCTGTGGAGAGG + Intergenic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
926156708 2:10459032-10459054 CAGGAAGGCCAGAAGCAGTGCGG - Intergenic
926625469 2:15086207-15086229 CAGGAAGACCAGTTGCAGAGAGG + Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
926958817 2:18332198-18332220 TGGGATGACCAGCCGTAGAGAGG - Intronic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927533827 2:23836785-23836807 CAGGAGGACCAACTTCAGAGAGG - Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
927613560 2:24566438-24566460 TAGGATGACCAGCTGTGGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929453639 2:42051785-42051807 CAGGATGACGGGGAGCTGAGGGG + Intronic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929838119 2:45426737-45426759 CCAGAAGACCTGCAGCAGAGGGG + Intronic
929873006 2:45774059-45774081 CAAGATGAACAGCAGCAGCGGGG - Intronic
929997989 2:46841020-46841042 CAGGATGTCTAGCAGCATGGAGG - Intronic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930957289 2:57217698-57217720 CAGGATGACCAGCTGTGGAGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
931471664 2:62544807-62544829 CAGAATGTCCAGCACAAGAGAGG - Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932585052 2:73022485-73022507 CAGGCTGACCAGAACCAGAAGGG + Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
932732969 2:74233462-74233484 CAGGATGGTCACCAGCAGGGCGG + Exonic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933158951 2:79003078-79003100 CATGGTGACCAGCAGCCCAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934185104 2:89664802-89664824 CAGGATGACAATAATCAGAGGGG + Intergenic
934317203 2:91934510-91934532 CAGGATGACAATAATCAGAGGGG - Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934790994 2:97059955-97059977 CAGGAAGGCCAGGAGCTGAGCGG - Intergenic
934815455 2:97322575-97322597 CAGGAAGGCCAGGAGCTGAGCGG + Intergenic
934822240 2:97385908-97385930 CAGGAAGGCCAGGAGCTGAGCGG - Intergenic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936289947 2:111215732-111215754 GATGATGACCAATAGCAGAGAGG - Intergenic
936290050 2:111216415-111216437 GATGATGACCAATAGCAGAGAGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937755632 2:125534740-125534762 CAGGGAGACCAGCAGAATAGAGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
938342877 2:130547133-130547155 CAGGATGAGAAGCCTCAGAGTGG + Intronic
938346956 2:130573589-130573611 CAGGATGAGAAGCCTCAGAGTGG - Intronic
939350037 2:141024758-141024780 CAGGATGGTCATCAGCAGATTGG + Intronic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940964611 2:159822854-159822876 CCAGCAGACCAGCAGCAGAGGGG + Intronic
941649462 2:168078389-168078411 TAGGATGAGCAGCCACAGAGAGG + Intronic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426968 2:187749729-187749751 CAGGATGACCAGATGTGGAGAGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943526307 2:189021053-189021075 CAGGACAACCAACTGCAGAGAGG + Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944335463 2:198528533-198528555 CTGAATGACCTGCAGCAGACTGG + Intronic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945168328 2:206969390-206969412 CAGCAGGCCCAGCAGCATAGTGG - Exonic
945330099 2:208529701-208529723 CAGGATGACTAGCTTCAAAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947875026 2:233462150-233462172 CAGGATGACCCACAGCAAATGGG - Intronic
948379099 2:237540761-237540783 GAGGCTGACCAGCAGCAGGAGGG - Intronic
948449623 2:238061027-238061049 CTGGATGCCCGGCAGCAGTGGGG + Exonic
948541393 2:238693657-238693679 CAGGATGCCCAGGAGCACAGAGG - Intergenic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1169165858 20:3423464-3423486 TAGGAAAACGAGCAGCAGAGTGG - Intergenic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1170495062 20:16915866-16915888 GGGGAAGACCAGTAGCAGAGAGG + Intergenic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1172466984 20:35162450-35162472 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173525775 20:43731485-43731507 CAGGATGAAGATCAGCAGGGAGG - Intergenic
1173750517 20:45471623-45471645 GAGGAGGACCAGAAGGAGAGAGG + Intronic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177092084 21:16781800-16781822 CCGGTAGACCTGCAGCAGAGAGG + Intergenic
1177396048 21:20537852-20537874 CGGGACGACCAGCAGCACAAAGG - Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1178244423 21:30936896-30936918 CGGGATGACCAATGGCAGAGAGG + Intergenic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1179720277 21:43312545-43312567 CAGGAAGCCCAGCTCCAGAGTGG - Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1180786378 22:18549981-18550003 CAGGATGGCCAGGAGCCGACAGG + Intergenic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1181131659 22:20735707-20735729 CAGGATGGCCAGGAGCCGACGGG + Intronic
1181243299 22:21489534-21489556 CAGGATGGCCAGGAGCCGACGGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182667625 22:31971011-31971033 CAGGATGACCAGCTGCACTGGGG - Intergenic
1183533857 22:38383261-38383283 CAGGCTGACCACCTGCACAGTGG - Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184152810 22:42648496-42648518 CAGGAGTGACAGCAGCAGAGTGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184433380 22:44454744-44454766 CGAGATGTCCAGCAGGAGAGAGG - Intergenic
1184613632 22:45622671-45622693 CAGGATGACCAGTTACAGAGAGG + Intergenic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949640335 3:6029558-6029580 CCAGAAGACCTGCAGCAGAGGGG - Intergenic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
951044337 3:18021602-18021624 CAGGTAGACCAGCAGCTGAAGGG + Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951136205 3:19107182-19107204 CAGGATGACCACCTGTAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951771128 3:26258822-26258844 AAGGAGGACCAGTAGCAGAATGG + Intergenic
952016154 3:28959286-28959308 CAGGATGTCCAACTGCAGAGAGG + Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
953854543 3:46491087-46491109 CAGAAGGACCAGGAGCAGCGAGG + Intergenic
954035687 3:47849798-47849820 CCGGAGGAGCAGCTGCAGAGCGG - Intronic
954082812 3:48222357-48222379 CAGGAGGGACAGCAGGAGAGTGG + Intergenic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
954752521 3:52821647-52821669 CACGGTGGCCAGCCGCAGAGGGG - Intronic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956689347 3:71861462-71861484 CAGGATGTGCAACAGGAGAGTGG - Intergenic
956720984 3:72117248-72117270 CAGGATGCACAGCAGAGGAGTGG - Intergenic
956860377 3:73317443-73317465 GAGGATGACGAGGAGCAGAGTGG + Intergenic
956989958 3:74751663-74751685 CAGGACAACCAGCCGTAGAGAGG - Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957845142 3:85722068-85722090 CAGGAAGACGAGCTGCAGAAAGG - Intronic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958636283 3:96750778-96750800 TGGAATGATCAGCAGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
958999939 3:100951838-100951860 CAAGATGACCTGCACCAAAGTGG - Intronic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
961444963 3:126976057-126976079 CAGGATGACAAGCAGCATTCTGG + Intergenic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961775263 3:129279436-129279458 CAGGAAGAGCCGCAGCGGAGGGG - Intronic
961942942 3:130656443-130656465 CCAGTTGACCAGCTGCAGAGAGG - Intronic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963483378 3:145904447-145904469 CAGAATGACCGACTGCAGAGAGG + Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964590666 3:158360034-158360056 TGGGATGACCAATAGCAGAGAGG - Intronic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966255245 3:177909355-177909377 CCAGAAGACCTGCAGCAGAGAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966450472 3:180053792-180053814 CAGGATGAGAAGCAGTGGAGTGG - Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967444805 3:189554704-189554726 GAGGATGGCCAGCTGTAGAGAGG - Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
967814974 3:193790783-193790805 AAGGGTGAGCAGCAGCAGCGTGG + Intergenic
968044447 3:195616197-195616219 CTGGATGCCCAGAAGCACAGTGG - Intergenic
968060237 3:195722248-195722270 CTGGATGCCCAGAAGCACAGTGG - Intronic
968311687 3:197688852-197688874 CAGAAAGACGAGCAGCTGAGTGG + Intronic
968439111 4:612657-612679 CAGGAAGACCAGCAGGAGCCTGG + Intergenic
968509680 4:990039-990061 CACGATGACCAGCAGCTCCGTGG + Exonic
968584941 4:1411944-1411966 CAGAGTAACCACCAGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969387370 4:6863374-6863396 CAGAATGATCAGCCGAAGAGTGG + Exonic
969591246 4:8123029-8123051 CAGGAAGAGCAGCAGCAGATAGG - Intronic
969892181 4:10270061-10270083 CAGCATGGCCAGCAGCAGCATGG + Intergenic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
971876810 4:32318717-32318739 CAGGAATACCAGCTGCAGAAAGG - Intergenic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972358244 4:38303029-38303051 CAGGACAACCCGCTGCAGAGAGG - Intergenic
972369657 4:38410677-38410699 GCGGAGGAGCAGCAGCAGAGGGG + Intergenic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
973041175 4:45472018-45472040 TAGGATGACCAGCAGCTGACAGG + Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975630920 4:76401369-76401391 CATGATGACAGGAAGCAGAGTGG + Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976445876 4:85129377-85129399 CAAGCAGACCTGCAGCAGAGAGG - Intergenic
976636620 4:87292678-87292700 CAGGGGGACAAGCGGCAGAGGGG + Intergenic
976679887 4:87745248-87745270 CCAGACGACCAGTAGCAGAGAGG - Intergenic
976734487 4:88296333-88296355 TAGGACGACCAGCTGCAGACAGG - Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976768061 4:88619105-88619127 CAGGATGACCAGCCACAGGAAGG - Intronic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977439048 4:97038387-97038409 GAGGGTGACCAGAAGCAGTGGGG - Intergenic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977586867 4:98783808-98783830 CAGGACACACAGCAGCAGAGAGG + Intergenic
977589801 4:98813666-98813688 AAGGATGGCCTGCAGCAGGGTGG - Intergenic
977671320 4:99698894-99698916 GAGGACGACCAGAAGCAGGGTGG + Intergenic
977949198 4:102950640-102950662 CAGGATGACAATAATCAGAGGGG - Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
978663402 4:111154468-111154490 CAAGACTACCAGCTGCAGAGAGG - Intergenic
978759715 4:112343645-112343667 CAGGCTGGCCTGCAGCAGCGAGG - Intronic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979417557 4:120461545-120461567 CTGGCAGACCTGCAGCAGAGGGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979649471 4:123114062-123114084 CAGGATGATCAACATCAGAGAGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980701967 4:136442761-136442783 TCAGATGACCAGCAGCAGAGAGG + Intergenic
980750050 4:137076888-137076910 TAGGCTGACCAGCTGAAGAGAGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982174931 4:152696904-152696926 GAGGGTGACCACCATCAGAGAGG - Intronic
983491929 4:168398795-168398817 CAGGATTACCAGCTACGGAGGGG + Intronic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
984325235 4:178242244-178242266 CAAGATGACCATTTGCAGAGAGG + Intergenic
985204580 4:187521363-187521385 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
985709803 5:1421921-1421943 CACGATGACCAGCACCAGGCAGG + Exonic
986005910 5:3669179-3669201 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
986322973 5:6648977-6648999 CAGGCAGACCTGCAGCAGAGGGG - Intronic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989135800 5:38153479-38153501 GAGGATGTCCAACAGAAGAGAGG + Intergenic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
989730426 5:44641610-44641632 CAGGAAGACCTGCTGCAGAAAGG - Intergenic
990023769 5:51160188-51160210 CAGGAGGACCAGCTAGAGAGAGG + Intergenic
990092531 5:52071311-52071333 CAGGTTGATCACCAGCAGAAAGG + Intronic
990167564 5:53011453-53011475 AAGGATGACCAGCAACATAGCGG - Intronic
990633862 5:57700669-57700691 AAGGATGATGAGAAGCAGAGAGG + Intergenic
990923441 5:60993634-60993656 TGGGATGACCACCCGCAGAGAGG - Intronic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991198409 5:63961582-63961604 GAGCGTGCCCAGCAGCAGAGAGG + Exonic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992748479 5:79841134-79841156 CAGGAAGACCAGTTGCATAGTGG + Intergenic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995695846 5:114877110-114877132 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995790549 5:115882453-115882475 CCAGAAGACCTGCAGCAGAGGGG - Intronic
996170706 5:120287091-120287113 AAGGATGAGCAGCAGCACAGAGG - Intergenic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
998792307 5:145778243-145778265 TAGGATTATCAGCTGCAGAGGGG + Intronic
999150234 5:149421743-149421765 GAGGATGACAAGAAGCAGAATGG + Intergenic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
1000426229 5:161093897-161093919 TGGGATGGCCAGCAGCAGAGAGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001658278 5:173370903-173370925 CAAGATGACCACAAGCAGAGAGG - Intergenic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1001965967 5:175910186-175910208 CAGGGATACCAGGAGCAGAGGGG - Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002250979 5:177929014-177929036 CAGGGATACCAGGAGCAGAGGGG + Intergenic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004304541 6:14487972-14487994 CAGGAAGACCAGCTACAGGGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1005775871 6:29130209-29130231 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1005840961 6:29744395-29744417 CAGGATGCCCAGCAGTCTAGGGG - Intergenic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1006313488 6:33277454-33277476 GACGATCACCAGCAGCAAAGCGG - Exonic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1007197527 6:40075513-40075535 CAGGAAGACCAACTGCAGATGGG + Intergenic
1007649978 6:43413228-43413250 CCAGGTGACCAGCAGCAGAGAGG + Intergenic
1007705389 6:43787631-43787653 AGGGATGAGCAGCAGCCGAGGGG + Intergenic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1008568912 6:52796075-52796097 CATCATGACCAGCAGCAGGCTGG - Intronic
1008573375 6:52836129-52836151 CATCATGACCAGCAGCAGGCTGG - Intronic
1008575706 6:52858173-52858195 CATCATGACCAGCAGCAGGCTGG - Intronic
1009196751 6:60695573-60695595 CCTGATGACCAGCTGCAGAAAGG + Intergenic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011199750 6:84822806-84822828 CCAGCAGACCAGCAGCAGAGGGG - Intergenic
1011368695 6:86609220-86609242 CAGGATGACCAGCAGGTTGGGGG - Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012141847 6:95635336-95635358 CGGGTCAACCAGCAGCAGAGAGG + Intergenic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012644314 6:101660729-101660751 CCAGAAGACCTGCAGCAGAGGGG - Intronic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013086340 6:106861148-106861170 CAGGTTGACCAGCTGCAGAAAGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1013599604 6:111692029-111692051 CATGCTGTCCTGCAGCAGAGGGG - Intronic
1013693099 6:112668209-112668231 TAGGATGACCAGTTGCAGATAGG + Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1015549095 6:134393437-134393459 CAGGAGGGCCAGCTGCAAAGGGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1015718468 6:136216061-136216083 CAGCATGAGCTGCAGGAGAGAGG + Intergenic
1015880293 6:137865382-137865404 AAGGAGCACCAGCAGGAGAGTGG + Intergenic
1016339647 6:143049371-143049393 TGGGAGGACCAGCAGCATAGAGG - Intergenic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1016719456 6:147278086-147278108 CATGATGCCAAGCAACAGAGTGG - Exonic
1017571520 6:155749474-155749496 CCGGCAGACCTGCAGCAGAGGGG + Intergenic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1018497073 6:164359527-164359549 CAGGAATACAAGCAGCTGAGTGG - Intergenic
1018616622 6:165692558-165692580 CACGAAGACCAGCAGGAGAGAGG - Intronic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1018688031 6:166318746-166318768 GAGGGTGACAAGGAGCAGAGGGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019559759 7:1650187-1650209 CAGGAAGACCAGCATCATGGAGG + Intergenic
1019897904 7:3997595-3997617 CAGGAGGACCAGCTGTAAAGAGG - Intronic
1020055994 7:5117801-5117823 CAGGATGACCACCAGCACCCGGG - Intergenic
1020143508 7:5625127-5625149 GAGGCTCACAAGCAGCAGAGTGG + Intronic
1020649299 7:10855189-10855211 AGGGATGACCAGGGGCAGAGAGG + Intergenic
1020761284 7:12270219-12270241 CAGGACGACCAGCGGTAGGGAGG + Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021540358 7:21750711-21750733 CAGGATGACCAGCTCCAGTGAGG - Intronic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022704479 7:32789693-32789715 CAGGGCGACCTGCAGCACAGGGG - Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1022908651 7:34879437-34879459 CAGGGCGACCTGCAGCACAGGGG - Intergenic
1023348204 7:39293175-39293197 CCAGCTGACCCGCAGCAGAGAGG - Intronic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024360887 7:48466941-48466963 CACAATGAACAGCAGCAGTGGGG + Exonic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1027128382 7:75573259-75573281 TAGGATAATCAGCTGCAGAGAGG + Intronic
1027224405 7:76234947-76234969 CAGGATTAACTCCAGCAGAGAGG + Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1027911242 7:84253807-84253829 CATGATGACCAGCAGCAACCAGG - Intronic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028265583 7:88719870-88719892 CAGTATTACCAGCAGTAAAGTGG - Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029782112 7:102744771-102744793 CAGGACAACCAGTAGTAGAGAGG + Intergenic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1031243316 7:119273006-119273028 CAAATTGACCAGCTGCAGAGTGG - Intergenic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1031786618 7:126041139-126041161 CAGGATGACCAGCTGTGGAGAGG + Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1032701538 7:134384108-134384130 CACGGTGACCAGGAACAGAGAGG - Intergenic
1032800921 7:135316813-135316835 AAGGCTGACCAGCAGCAGGCAGG + Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034410006 7:150935622-150935644 ACGAAGGACCAGCAGCAGAGTGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1034935410 7:155196941-155196963 CACCAGGACCAGCAGCATAGTGG + Exonic
1035016151 7:155768044-155768066 CAGGAGGACCAGCAGGACACTGG - Intronic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035694385 8:1583930-1583952 AAGGATGACCGGCAGCAAGGAGG - Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036761951 8:11515367-11515389 GAGGATGACCAGGAGCTGAGAGG + Intronic
1037777857 8:21847595-21847617 CAGAATGACCAACAGTAGGGAGG - Intergenic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1040355099 8:46609311-46609333 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041357246 8:57014039-57014061 CAGGATGAGCTGGGGCAGAGAGG - Intergenic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042196806 8:66238118-66238140 CCAGATGACCAGTAGCAGAGGGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043459196 8:80442270-80442292 GAGCATGACCTGCAGTAGAGAGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044962379 8:97543151-97543173 CAGGTGGACCAGCTGCAGAGAGG + Intergenic
1045490864 8:102668103-102668125 AAGAATGACCAGGAGCAGAAAGG + Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1047215609 8:122873497-122873519 CTGGTTGAGCAGCATCAGAGCGG + Intronic
1047604216 8:126458145-126458167 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1048072693 8:131039416-131039438 GAGGATGACCTGCAGCAGCGAGG + Exonic
1048229151 8:132620207-132620229 CAGGAGGACCAGCCCAAGAGTGG + Intronic
1048421680 8:134283954-134283976 CAGAATGATCAACTGCAGAGAGG - Intergenic
1048422686 8:134292868-134292890 CAGGAGGACATGCAGCTGAGAGG + Intergenic
1049294569 8:141824887-141824909 CAGGATGGCCGGCCGCAGAGCGG - Intergenic
1049360757 8:142211595-142211617 CTGGGTGGCAAGCAGCAGAGAGG + Intergenic
1049362209 8:142217443-142217465 CACCATGGACAGCAGCAGAGGGG - Intronic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050483998 9:6114773-6114795 CAGGATGACTGGTTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051508996 9:17856857-17856879 GATGCTGACCAGCAGGAGAGGGG + Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052652358 9:31321212-31321234 CAGGATGACCAGTTGTAGAGAGG - Intergenic
1052654215 9:31334889-31334911 CAGGATGACTGGCTGCAGAAAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1055887126 9:81076639-81076661 CAGGCTGAACAGCTGCAGAAGGG - Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056879716 9:90379665-90379687 CAGGATGACATGCTGCAGGGGGG - Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1057531222 9:95847928-95847950 CCGGAAGACCAGTTGCAGAGAGG + Intergenic
1057858877 9:98624249-98624271 CAGGAAGGCAAGCAGCAGACAGG + Intronic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058091970 9:100814700-100814722 CAGGCTGATCAGCTACAGAGAGG + Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1058883843 9:109307940-109307962 CACGGTGAGCAGCAGCAGACTGG + Intronic
1058899603 9:109430802-109430824 CATGAGGAGCAGCAGGAGAGGGG - Intronic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1060822999 9:126672146-126672168 CAGGATGGCCTCCAGCAGACAGG - Intronic
1060875639 9:127081738-127081760 CAGGATGTGCTGCAGCAGTGGGG + Intronic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062586241 9:137251204-137251226 CAGGAGTCCCAGCAACAGAGGGG + Intergenic
1185643586 X:1601324-1601346 CAGGCGGGCCAGCAGCAGGGAGG + Exonic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1187213110 X:17249066-17249088 CAGGATGATCAGCAGCTTAATGG - Intergenic
1187833657 X:23408778-23408800 CAGGAATACCAGCAGGGGAGAGG + Intergenic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189243446 X:39543051-39543073 CCAGAAGACCTGCAGCAGAGGGG + Intergenic
1189360220 X:40344123-40344145 CAGGAGGATCAGCTGCAGAGAGG + Intergenic
1189851601 X:45182872-45182894 CAGGTTGTCCTGCAGCTGAGAGG + Intronic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191206807 X:57842965-57842987 CAAGCAGACCTGCAGCAGAGGGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193075282 X:77348375-77348397 CCAGCAGACCAGCAGCAGAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1193646878 X:84080259-84080281 CAGGCAGACCTGCAGCAGAGGGG + Intronic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196706487 X:118721732-118721754 AAGGATGACCAGAATGAGAGAGG - Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197501217 X:127244325-127244347 CAGGATGATGAGCTGCAGAAAGG - Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197906359 X:131429152-131429174 CCAGCAGACCAGCAGCAGAGGGG + Intergenic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1199103826 X:143838132-143838154 CAGGACAACCACCTGCAGAGAGG + Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1200827226 Y:7657990-7658012 CAGGGAGACCAGGAGAAGAGGGG + Intergenic
1200954520 Y:8930398-8930420 CAGGGAGACCAGGAGAAGAGGGG - Intergenic
1201498139 Y:14612547-14612569 CCAGCTGACCTGCAGCAGAGCGG - Intronic
1201935381 Y:19406314-19406336 CCACATGACCAGCTGCAGAGAGG - Intergenic
1201939760 Y:19447284-19447306 CAGGAAGAATAGCTGCAGAGTGG - Intergenic
1202124604 Y:21557021-21557043 CAGGAAGACCAGGAGAAGAGGGG - Intergenic
1202129656 Y:21598191-21598213 CAGGATGAAAGGCAGCAGTGAGG - Intergenic
1202154404 Y:21872359-21872381 CAGGAAGACCAGGAGAAGAGGGG + Intergenic
1202195377 Y:22295060-22295082 CAGGGAGACCAGGAGAAGAGGGG + Intergenic
1202593588 Y:26512746-26512768 CAGGCTGACCACCTGCACAGTGG + Intergenic