ID: 979654998

View in Genome Browser
Species Human (GRCh38)
Location 4:123181688-123181710
Sequence TTGGCCCACTGGCTGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979654992_979654998 6 Left 979654992 4:123181659-123181681 CCAAGCTAAAGTGCTCTATGAAA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979654998 Original CRISPR TTGGCCCACTGGCTGTTTTG GGG Intronic
No off target data available for this crispr