ID: 979656854

View in Genome Browser
Species Human (GRCh38)
Location 4:123205309-123205331
Sequence ATTTAGTAGCTGTATGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 7, 3: 78, 4: 702}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979656850_979656854 22 Left 979656850 4:123205264-123205286 CCATACATTTCAGAATCAGATAG 0: 1
1: 0
2: 0
3: 18
4: 197
Right 979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG 0: 1
1: 0
2: 7
3: 78
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979656854 Original CRISPR ATTTAGTAGCTGTATGAACC TGG Intronic
900782602 1:4627832-4627854 AGTTACTAGCTGTGTGACCCAGG + Intergenic
901284181 1:8063501-8063523 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
901760770 1:11469751-11469773 ATTTACTAGCTGTGTGACCTTGG + Intergenic
901858096 1:12057105-12057127 ATTTACTAGCTGTGTAAATCGGG - Intergenic
901873254 1:12151024-12151046 ACTTAGCAGCTGTGTGACCCTGG - Intergenic
902041314 1:13494556-13494578 ATTTACCAGCTGTGTGAGCCTGG - Intronic
902072965 1:13756925-13756947 ATTTAGGACCTGTGTGAACTCGG - Intronic
902603007 1:17552822-17552844 ATTTACTAGCTGTGTGACCTGGG - Intronic
902881866 1:19376885-19376907 ACTTACTAGCTCTGTGAACCTGG + Intronic
902974575 1:20079768-20079790 ACTTAGTATCTGTGTGACCCTGG - Intronic
903116334 1:21181438-21181460 ATTGATTAGCTGTATGATCTTGG + Intergenic
903366092 1:22806276-22806298 ACTTATTAGCTGTATAAACTTGG - Intronic
903463430 1:23535045-23535067 CTTTATTAGCTGTGTGACCCAGG + Intergenic
903607709 1:24587068-24587090 ATTTACTAGCTGTGTGACCTTGG - Intronic
904111536 1:28130065-28130087 ACTTAGTAGCTGTGTGACCCTGG - Intergenic
904116165 1:28163557-28163579 ATTTACTTGCTGTATGACCTGGG + Intronic
904481735 1:30798124-30798146 ATTTATTAGCTGTGTGACCCTGG + Intergenic
904780625 1:32944357-32944379 ATTTACTAGCTGTATAACCTTGG + Intronic
905137392 1:35809710-35809732 ATGTAATAGTTGTATGACCCTGG + Intronic
905258149 1:36698760-36698782 ATTTACAAGCGGTGTGAACCCGG + Intergenic
905324844 1:37144265-37144287 TATTAGTAGCTGCATGAACCTGG - Intergenic
905512306 1:38531194-38531216 ATTTGTTAGCTGTGAGAACCTGG - Intergenic
905581230 1:39083829-39083851 ATTTACTAGCTGTGTGACCCTGG - Intronic
905648979 1:39644032-39644054 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
906044597 1:42818012-42818034 ACTTAGAAGCTGTGTGACCCGGG - Intronic
906311690 1:44758981-44759003 ACTTACTAGCTGTGTGAGCCTGG - Intronic
906464115 1:46060630-46060652 ATTTATTAGCTGTATAAACTTGG - Intronic
906847095 1:49204932-49204954 AATCACTAGCTGTATGACCCTGG - Intronic
906975789 1:50571377-50571399 ATTTAGCAGCTGTGTGACCATGG + Intronic
907148734 1:52261978-52262000 ATTTACTAGCTGTATGACCCTGG + Intronic
907165472 1:52406858-52406880 ACTTACTAGCTGTTTGAACTTGG - Intronic
907170946 1:52464038-52464060 AATTACTAGCTGTGTGAACTTGG + Intronic
907423830 1:54365890-54365912 ACTTACTAGCTGTATAAACTTGG + Intronic
907489187 1:54798180-54798202 ATTTACTAGCTCTGTGACCCTGG + Intronic
907669917 1:56465211-56465233 ATTAACTAGCTGTATGACCTTGG + Intergenic
907728701 1:57045039-57045061 ATTTACTAGCTGTGTGACCCTGG - Intronic
907813169 1:57892536-57892558 ATTTACCAGCTGAGTGAACCTGG - Intronic
907865971 1:58399529-58399551 ATTTACCAGCTGTGTGAACCTGG - Intronic
908008360 1:59749844-59749866 ATTTACTAGCTGTATAATCACGG - Intronic
908013303 1:59805951-59805973 ATTTATTAGTTGTATGAGCTTGG + Intergenic
908396148 1:63727530-63727552 ACTTAGTAGCTGTGTGACCTTGG + Intergenic
908440188 1:64145910-64145932 ATTTACTAGCTGGATGACCCTGG - Intronic
908597113 1:65700122-65700144 ATTTACTAGCTGTGTGATCTTGG - Intergenic
908767113 1:67564206-67564228 ATTTAGTAGCTGTGTGGTCCTGG + Intergenic
908784284 1:67719770-67719792 ATGTAATAGCTGTATGATCTTGG - Intronic
909255515 1:73415583-73415605 ACTTCCTAGCTGTATGAACCTGG - Intergenic
909380531 1:74992705-74992727 ACTTACTAGCTGTGTGAACTTGG - Intergenic
909546745 1:76856589-76856611 ACTTAGTAACTGTGTGACCCTGG + Intergenic
909686595 1:78355550-78355572 ATTGAGTAGCTGTGTGACCTTGG - Intronic
909925988 1:81438727-81438749 AATTAGTAGCTGTATGAACTTGG + Intronic
910171718 1:84385239-84385261 CTTTACTAGCCGTATGAACTAGG - Intronic
910340824 1:86184910-86184932 ATTTATTAGCTGTATAACCTTGG + Intergenic
910724631 1:90325788-90325810 ATTTAATAGCTGAATGACCTTGG - Intergenic
910767216 1:90793722-90793744 ATTTACTAGCTGTGTGATCTAGG - Intergenic
911876830 1:103176441-103176463 ATTTACTAAATGTAGGAACCCGG - Intergenic
912477286 1:109947222-109947244 ATTTATTAGCTGTGTGACCTTGG - Intergenic
912686288 1:111768900-111768922 AGGTAGTAGCAGTATCAACCAGG - Intergenic
912884375 1:113454396-113454418 ACTTAGTAGCTGTGTGACCTCGG + Intronic
912949545 1:114111371-114111393 ATTTAGTAGCTGTGTGCCCTTGG - Intronic
913057581 1:115176461-115176483 ATTTACTAGCTGTGTGACCTTGG + Intergenic
913163379 1:116165262-116165284 ACTTACTAGCTGTGTGACCCTGG - Intergenic
913539648 1:119806387-119806409 ATTTATTTGCTGTAGGATCCTGG - Intronic
913617023 1:120571085-120571107 ATTTATTAGCTGTATGACTATGG - Intergenic
914573253 1:148939830-148939852 ATTTATTAGCTGTATGACTATGG + Intronic
914860554 1:151382317-151382339 AGTTACTAGCTTTATGAATCTGG + Intergenic
914978373 1:152388783-152388805 ATTTAGATGCTGTATGAGGCAGG + Intergenic
915126033 1:153665616-153665638 ATTTAGTAGCCATAGGAACCAGG - Intronic
915205623 1:154268570-154268592 ATTTAAGAACTGTGTGAACCTGG - Intronic
915417850 1:155755903-155755925 TCTTAGTAGCTGTATGACCTTGG - Intronic
915611751 1:156999283-156999305 ATTTAATAGCTGTATGGCCTGGG - Intronic
916234526 1:162573354-162573376 ATTTACTAGCTATGTGACCCTGG + Intronic
916423469 1:164658914-164658936 ATTTAATAACTGTATCCACCAGG - Intronic
916835027 1:168535078-168535100 ATTTATTAGCTGTGTAACCCTGG + Intergenic
917783112 1:178421098-178421120 ATTTACTAGCTGTATGACCCTGG - Intronic
917783147 1:178421567-178421589 ACTTATTAGCTGTGTGACCCTGG - Intronic
917973757 1:180225574-180225596 ATTTATTAGCTGTGTGACCTTGG + Intergenic
918145640 1:181753445-181753467 ACTTAGAAGCTATATGACCCAGG + Intronic
918269658 1:182885710-182885732 AGTTATTAGCTGTATGACCTTGG - Intronic
918847750 1:189640480-189640502 ATTTATTAACTGTGTGAACTTGG + Intergenic
919094226 1:193010480-193010502 ACTTACTGGCTGTATGAACTTGG + Intergenic
919418688 1:197343834-197343856 ACTTATTAGCTGTATGACCTTGG - Intronic
919679774 1:200422817-200422839 ATTTACTAGCTGTGTGAGCTTGG + Intergenic
919798076 1:201333240-201333262 ATTTACAAGCTGTGTGACCCTGG - Intergenic
920145836 1:203860517-203860539 ACTTAGTAGCTGTGTTATCCAGG + Intergenic
920326408 1:205168306-205168328 ATTTACTAGCTGTGTGACCCTGG + Intronic
920495230 1:206449950-206449972 ACTTGGTAGCTGTGTGATCCTGG - Intronic
920768645 1:208858496-208858518 ATTTAATAGCTGTGTGATCTTGG - Intergenic
921160555 1:212469309-212469331 CTTTAGTAGCTGTCTGACCTTGG + Intergenic
921172228 1:212559863-212559885 ATTCATTAGCTGTGTGACCCAGG - Intergenic
921358294 1:214306858-214306880 ACTTACTAGCTCTATGAAACTGG + Intronic
922972597 1:229755501-229755523 ATTTAGCAGCTGTGTAACCCCGG + Intergenic
923512231 1:234662391-234662413 ATTCAGGAGGTGGATGAACCAGG + Intergenic
923539887 1:234880663-234880685 ATTTAGTAGCTGTGTGACTTTGG - Intergenic
923732632 1:236567400-236567422 ATTTATTTTCTGTATGAAACAGG + Intronic
924154564 1:241162822-241162844 ATTTATTAGCTGTGTGAACTCGG - Intronic
924288394 1:242511715-242511737 ATTTAGTTGCTGTGTGTCCCTGG - Intronic
1063210394 10:3875596-3875618 ATTTAGTAGCTGTGTGAATTGGG + Intergenic
1064216849 10:13407700-13407722 ACTTACTAGCTGTATGACCTCGG - Intergenic
1064662394 10:17618608-17618630 TTTTATTAGCTGTGTGAACTTGG + Intergenic
1065104587 10:22369597-22369619 ATTTAGTTGCTGTGTGACCTCGG + Intronic
1065448268 10:25825246-25825268 ATTTAATAGCTGGATGATCTTGG + Intergenic
1066244995 10:33574157-33574179 ATTTTGTAGTTATATGAACTTGG - Intergenic
1066593717 10:37024846-37024868 ATTTACTAGCTGTGTGACCTGGG + Intergenic
1067759291 10:49031256-49031278 ATTTACTAGCTGTGTGACCTCGG + Intronic
1067907544 10:50309416-50309438 ACTTACTAGCTCTATGACCCTGG - Intronic
1068012951 10:51477491-51477513 ATTTACTAGCTGTGTGTCCCTGG + Intronic
1068574274 10:58666639-58666661 ATTTATTAGCTGTATGCTCTTGG + Intronic
1069625586 10:69865897-69865919 ATTTACTAGCTGCATGGCCCTGG + Intronic
1069681195 10:70286731-70286753 ATTTGTTAGCTGTGTGACCCAGG + Intergenic
1070438186 10:76414106-76414128 ATTGACTAGCTATATGAACTTGG + Intronic
1070444893 10:76487784-76487806 ACTTAGTAGCTGTGTGATCTTGG - Intronic
1070662755 10:78319398-78319420 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1070694292 10:78550676-78550698 ATTTAGAAGCTGTGTGACCTTGG - Intergenic
1071080014 10:81799678-81799700 ATTTAGTAGCAGTGTGAATGTGG + Intergenic
1071232025 10:83599170-83599192 ATTTACTAGCTCCATGACCCTGG - Intergenic
1071427615 10:85575100-85575122 AGTTATTAGCTGTGTGAACTTGG - Intergenic
1071720017 10:88134089-88134111 ATTAAGTACCTGTATGAGCTTGG + Intergenic
1071794763 10:88992078-88992100 ATTTACTAGCTGTGTGATCTTGG - Intronic
1072289022 10:93945500-93945522 ATTTTGTATCTGCATGAAACTGG - Intronic
1072496527 10:95966518-95966540 ATGTATTAGATGTGTGAACCTGG - Intronic
1072626571 10:97116164-97116186 ATTCAGTACCTGTCTGACCCAGG - Intronic
1073145205 10:101276265-101276287 ACTTACTAGCTGTATGATCTTGG - Intergenic
1073643164 10:105273623-105273645 ATTTATTAGCTGTATGGTCTTGG + Intergenic
1074053153 10:109898173-109898195 ACTTACTAGCTGGGTGAACCTGG + Intronic
1074314430 10:112348553-112348575 TCTTAGCAGCTGTATGCACCAGG - Intergenic
1074903676 10:117841206-117841228 TTTTAGTAGCTGTATTGGCCAGG + Intergenic
1075189731 10:120295953-120295975 ACTTACTAGCTGTATGACCGTGG - Intergenic
1076961556 10:133766109-133766131 TATTAGTAGCTGTGTGACCCTGG - Intergenic
1077617187 11:3684987-3685009 ATTTACTAGCTGTGTGACCTTGG + Intronic
1077636856 11:3847702-3847724 ATTTACTTGCTGTGTGATCCTGG + Intergenic
1077801895 11:5547520-5547542 ATTTACTAGCTATGTGAATCTGG + Intronic
1078480364 11:11670239-11670261 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1078532653 11:12148983-12149005 ATTTACTAGGTGTGTGAGCCTGG - Intronic
1078566681 11:12420824-12420846 ATTTACTAGCTGTGTGAACATGG - Intronic
1078634516 11:13036554-13036576 ATTTACTAGCTGTGTGATGCTGG + Intergenic
1078904248 11:15669647-15669669 ATTTATTAGCTGTGTGACCCTGG - Intergenic
1079145971 11:17852210-17852232 ACTTAGTAGCTGAATGACCTTGG - Intronic
1079302673 11:19292701-19292723 AATTACTAGCTGTATGATCTCGG + Intergenic
1079384535 11:19967134-19967156 CTTTAGTAGCAGTATGACCTTGG - Intronic
1079400856 11:20105248-20105270 ATTAACTAGCTGTTTGATCCTGG + Intronic
1079432401 11:20405525-20405547 ATTTACCAGCTGTGTGACCCTGG + Intronic
1079508972 11:21187889-21187911 CTTTAGTAGATGTATAAACTTGG + Intronic
1080029706 11:27647632-27647654 ATTTATTAACTGTATGACCTTGG + Intergenic
1080057122 11:27917800-27917822 ATTCACTAGATGTATGAACTTGG - Intergenic
1080399457 11:31920644-31920666 CATTAGTAGCTGTATGACCTTGG - Intronic
1080425546 11:32150826-32150848 ATTTACTAGCTGTATGACTTTGG - Intergenic
1080925526 11:36752209-36752231 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1080960840 11:37158024-37158046 ATTTAATAGCCCTATGAACCAGG - Intergenic
1083078928 11:60070972-60070994 ACTTATTACCTGTATGAACATGG + Exonic
1083132290 11:60636306-60636328 ATCTAGTAGTTTTATGAATCTGG - Intergenic
1083226916 11:61291064-61291086 ATTTACCAGCTGTGTGACCCCGG + Intronic
1083796713 11:65021186-65021208 ATTTAGTGGCTGTGTGACCTGGG - Intronic
1084854307 11:71972060-71972082 ATTAAGTACCTGTAGGAACTTGG + Intronic
1084906715 11:72354112-72354134 ATTTAATAGCTATGTGATCCAGG - Intronic
1085005403 11:73083941-73083963 ACTTACTAGCTGTATGACCTTGG + Intronic
1085760849 11:79240088-79240110 ATTTAATAGCTGTGTGACCCTGG + Intronic
1085817800 11:79759381-79759403 ATTTAGTGGCTGTGTAAACCTGG + Intergenic
1085894592 11:80623477-80623499 ATTTACTAGCTGTGTGACCTGGG - Intergenic
1086097706 11:83067377-83067399 ATTTATTAGCTGTATGATGTTGG - Intronic
1086116740 11:83259482-83259504 ATTTAGTGGCTGTATAACCTGGG + Exonic
1086270013 11:85051694-85051716 ATTTAGCAGCTGTATAACCTTGG + Intronic
1086316930 11:85605216-85605238 ATTTAGTAGCTGTGTGATCTTGG - Intronic
1086325158 11:85691389-85691411 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1086397350 11:86430778-86430800 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1086412603 11:86557572-86557594 GTTTATTAGCTGTGTGAACTTGG + Intronic
1086930443 11:92687306-92687328 ATTTTTTAGCTGTATGGACAAGG - Intronic
1087015169 11:93547625-93547647 ATTGAGTTCCTGTATGCACCAGG - Intergenic
1087204960 11:95384654-95384676 ATTTACTAGCTGTATGACCTTGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087785686 11:102351820-102351842 ATTGAGTAGCTATGTGAACTTGG + Intronic
1087905802 11:103695593-103695615 ATTTAGTTGCTGTGTGAATTTGG - Intergenic
1087917273 11:103825491-103825513 ATTTCCTAGCTATATGCACCAGG + Intergenic
1088325727 11:108598912-108598934 ATTTATTAGCTGTGTGACCTTGG + Intergenic
1088530777 11:110806968-110806990 ATTTACTAGCTTTGTGAACCTGG - Intergenic
1088935728 11:114398398-114398420 ATTTACTAGCTATATGACCTTGG + Intronic
1090091357 11:123701237-123701259 ATTAACTAGCTGTATGATTCTGG + Intergenic
1090092586 11:123711672-123711694 ACTTACTAGCTGTATGACCTTGG - Intergenic
1090130237 11:124134624-124134646 ATTTAGTAGTTGCATGATCTTGG + Intronic
1091379646 12:48187-48209 ACTTAGTAGCTGTGTGATCTTGG + Intergenic
1091574349 12:1719463-1719485 ATTTAGTAACTATATGAACATGG + Intronic
1091631357 12:2163373-2163395 ATTTACTTACTGTATGAACCTGG - Intronic
1091865433 12:3831434-3831456 TTTTAGAAGCTGTAGCAACCTGG + Intronic
1092702634 12:11249021-11249043 ATTTAAAAGCTTTATGAACTAGG - Intergenic
1092829101 12:12426775-12426797 ATTTATTAGCTGTGTGAATCTGG - Intronic
1092835006 12:12479012-12479034 ATTTAGTAGCTGTGTGATTTTGG - Intronic
1093942900 12:25074060-25074082 ACTTATTAGCTGTGTGAACTTGG + Intronic
1094211298 12:27895714-27895736 ATTTACTAGCTGTATGACATTGG - Intergenic
1095884267 12:47172626-47172648 ATTTCCTAGCTTTATGAACTTGG + Intronic
1095943868 12:47742771-47742793 ATTTACTAGCTGTGTGATGCTGG - Intronic
1096245029 12:49979814-49979836 ACTTAGCAGCTGTGTGAACTTGG + Intronic
1096613931 12:52821052-52821074 ACTTACTAGCTGTATGACCTCGG - Intergenic
1097380140 12:58885164-58885186 AGTTAGTAGCTGTCAGAAGCAGG - Intronic
1098084794 12:66830750-66830772 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
1098599372 12:72312140-72312162 TTTTACTAGCTGTGTGACCCTGG - Intronic
1098931449 12:76419509-76419531 ATTTACTAGCTGTATGACATTGG + Intronic
1098945867 12:76588890-76588912 ATTTACTAGCTGTATGATGTTGG + Intergenic
1099164426 12:79285427-79285449 ATTTACTAGCTGTGTGATCTTGG - Intronic
1099193478 12:79585599-79585621 ATTCAGTAGCCGTATGTGCCAGG - Exonic
1099609009 12:84841628-84841650 ATTTATTAGCATTATGAACTTGG + Intergenic
1099856448 12:88173848-88173870 ATTTACTAGCTGTGTGATCTTGG - Intronic
1100956906 12:99918530-99918552 ACTTACTAGCTGTGTGACCCTGG - Intronic
1100986581 12:100207474-100207496 ATTAAATAGCTCTATGAACTTGG + Intronic
1101170186 12:102084116-102084138 ACTTAGTAGCTGTGTGACCTTGG + Intronic
1101248844 12:102911446-102911468 ATTTACTAGCTGTTTGACCTTGG + Intronic
1101478357 12:105073236-105073258 ACTTACTAGCTGTATGACCTTGG - Intronic
1101576096 12:105997888-105997910 ATTTACAAGCTGTGTGAACTTGG - Intergenic
1101845873 12:108362634-108362656 ACTTACTAGCTGTATGATCTTGG + Intergenic
1101929868 12:109005262-109005284 ATTCAGTACCTGTGTGACCCTGG + Intronic
1102467176 12:113136580-113136602 ATTTGGTAGCTGTCTGGACTTGG + Intergenic
1102742666 12:115222154-115222176 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1103014951 12:117486970-117486992 ATTTAGTGGCTGTGTGACCTTGG + Intronic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1103187959 12:118977907-118977929 ACTTTGTAGCTGTATGAGCTTGG - Intergenic
1103326598 12:120125487-120125509 ATTTACTAGCCATATGACCCTGG + Intergenic
1103730697 12:123025948-123025970 ATTTAGTAACTGTGTGACCTTGG - Intronic
1104226787 12:126842747-126842769 ATTTAGGAGATGTATGGACGTGG - Intergenic
1105346745 13:19580044-19580066 ACTTATTAGCTGTATGAAGTTGG - Intergenic
1106517528 13:30468014-30468036 ACTTACTAGCTGTATGATCTTGG + Intronic
1106693210 13:32142286-32142308 ATTTATTAGCTGTGTGACCTTGG + Intronic
1107627433 13:42304120-42304142 ATTTCATAGCTCTATGAACTTGG - Intronic
1107710780 13:43148591-43148613 ATTTAATGGCTGCATGATCCTGG + Intergenic
1108339240 13:49480776-49480798 ATTTACTAGCTGTATTATCTTGG - Intronic
1109757420 13:66778756-66778778 AATTAGTACCTCTATGAATCAGG - Intronic
1109845320 13:67981616-67981638 ATTCAGTAGCTCTCAGAACCGGG + Intergenic
1110256402 13:73438552-73438574 ACTTAGCAGCTATATGAACATGG - Intergenic
1110754800 13:79160232-79160254 ATTTAGTAGCTGTCCGAGTCTGG + Intergenic
1111770398 13:92588821-92588843 TTTTATTTGCTGTATGACCCAGG - Intronic
1112527324 13:100163345-100163367 ACTTAGTAGCTGTGTGATCTTGG + Intronic
1112656490 13:101456973-101456995 ACTTAATAGCTGTATGAACTTGG + Intronic
1112853088 13:103731152-103731174 TTTTACTAGCTGTGTGACCCTGG - Intergenic
1113179312 13:107607719-107607741 ACTTACTAGCTGTGTGACCCTGG + Intronic
1115385074 14:32788250-32788272 ACTTAGTAGCTGTGTGATCATGG + Intronic
1115447953 14:33513581-33513603 ACTTCGTAGCTGTGTGAACTTGG - Intronic
1115525049 14:34271507-34271529 ATTTACTAGCTGTATGCCCTTGG - Intronic
1115544204 14:34450223-34450245 AATTAGTAGCAGGATGAACTTGG - Intronic
1115650091 14:35396928-35396950 ATTTACTGGCTGTGTGACCCAGG + Intergenic
1116860693 14:49993257-49993279 ATTTAGCAGCTGTGTGATCTTGG + Intronic
1117108847 14:52427702-52427724 ATTTAGTAACTGAAAGAACGTGG - Intergenic
1117151779 14:52896528-52896550 ATTTATTAGCTGTGTGACTCTGG + Intronic
1117155820 14:52939650-52939672 ATATACTAGCTGTATGACCTTGG - Intronic
1117432539 14:55682697-55682719 ATTTATTAGCCGTATGACCTTGG - Intronic
1117434710 14:55704889-55704911 ACTTAGTAGCTGTATGATCTTGG - Intergenic
1117449095 14:55833619-55833641 ACTTAATAGCTGTATGATCTTGG + Intergenic
1117787264 14:59299299-59299321 ATTTACTAGTTGTATGACCTGGG + Intronic
1117831862 14:59759357-59759379 ATTTACAAGCTGTGTGACCCTGG + Intronic
1118138075 14:63049631-63049653 ACTTACTAGCTATATGACCCAGG + Intronic
1118426631 14:65671478-65671500 ATTTATAAGCTGTATGACCCTGG - Intronic
1118435685 14:65769203-65769225 ACTTACTAGCTGTATGACCTTGG - Intergenic
1118637743 14:67763287-67763309 ACTTAGTAGCTCTATGACCTGGG + Intronic
1118693401 14:68361284-68361306 ATTTGTTAGCTCTATGACCCTGG - Intronic
1118812358 14:69284637-69284659 ACTTACTAGCTGTGTGAACATGG + Intronic
1119569773 14:75660395-75660417 ACTTAGTAGCTGTGTGACCCTGG + Intronic
1119576271 14:75725560-75725582 ATTTATTAGCTGCATGACCTAGG - Intronic
1119946761 14:78703472-78703494 ATCTAGAAGCTGTATCATCCTGG + Intronic
1120477482 14:85006638-85006660 ATTTATAAGCTGTGTGAACATGG + Intergenic
1121192310 14:92041391-92041413 ACTTACTAGCTGTATGACCTTGG - Exonic
1121212121 14:92215103-92215125 GTTTAGCAGCTGTGTGAACCTGG - Intergenic
1121457577 14:94048460-94048482 ACTTACTAGCTGTATGATCTTGG + Exonic
1121768519 14:96508901-96508923 ATTTAGTACCTTTATGACCTTGG - Intronic
1122243910 14:100387674-100387696 ATTTACTAGCTGTGTGACCACGG - Intronic
1124230546 15:27942150-27942172 ATTTATTAGCTGTTTGACCTAGG - Intronic
1124259092 15:28171491-28171513 AGTTACTGGCTGTATGAACTGGG - Intronic
1124612445 15:31217277-31217299 ACTTAGTAGCTGTGTGATCCTGG - Intergenic
1125065816 15:35485170-35485192 ATTTACTAGCTGTGTGATCCTGG - Intronic
1125119226 15:36133340-36133362 ATCTACTAGCTGTATGAACTTGG - Intergenic
1125441412 15:39707783-39707805 ACTTAGTAGCTGTGTGACCTTGG - Intronic
1125556878 15:40593188-40593210 ATTTAGAAGCTGTATAACCTCGG + Intergenic
1125835421 15:42746393-42746415 ATATACTAGTTGTATGACCCTGG + Intronic
1126136100 15:45393350-45393372 ACTTACTAGCTGTGTGAACTTGG + Intronic
1126313954 15:47348257-47348279 AGTTACTAGCAGTATGACCCTGG + Intronic
1126323944 15:47454902-47454924 ATTTATTAACTGTGTGAACTGGG + Intronic
1126540594 15:49818116-49818138 ATTTATTAGCTGTATGAAACTGG + Intergenic
1126831092 15:52606406-52606428 ATTTATTAGCTTTGTGACCCTGG + Intronic
1127439359 15:58990935-58990957 ATTGAGTACCTGTAGAAACCTGG - Intronic
1127716449 15:61653542-61653564 ACTTACTAGCTGTGTGATCCTGG + Intergenic
1127751973 15:62054982-62055004 ATTTATTAGCTGTGGGACCCTGG - Intronic
1128694770 15:69752729-69752751 AGTTACTAGCTATATGAACTTGG + Intergenic
1128698446 15:69786666-69786688 ATTTACCAGCTGTGTGACCCTGG - Intergenic
1130723588 15:86414885-86414907 ATTTACTAGCTGTGTGACCTTGG + Intronic
1131961555 15:97794657-97794679 ATTTACTAGCTGGGTGACCCTGG - Intergenic
1131978991 15:97977433-97977455 ATTTAGAAGATGTATGAAATAGG - Intergenic
1133782495 16:8950674-8950696 ATTCAGAAGCTGTATGTGCCTGG + Intronic
1133897286 16:9941911-9941933 ATTTTCTACCTGTACGAACCTGG - Intronic
1134341451 16:13350502-13350524 GTTTAGAAGCTGTATTAATCAGG - Intergenic
1134363656 16:13556292-13556314 ATCTACTAGTTGTATGAACTTGG - Intergenic
1134885060 16:17783478-17783500 ACTTATTAGCTGTGTGACCCTGG + Intergenic
1135150490 16:20001037-20001059 ATTTATTAGCTGTGTGATTCTGG + Intergenic
1135170868 16:20182164-20182186 GTTTATTAGCTGTGTGACCCTGG - Intergenic
1135295381 16:21275201-21275223 ACTTATTAGCTGTGTGATCCTGG + Intronic
1135527540 16:23225611-23225633 ACTTATTAGCTGTATGACTCTGG + Intergenic
1135717747 16:24787040-24787062 ATTTACTAGCTGTGTGACCATGG - Intronic
1137880026 16:52036261-52036283 ACTTACTAGCTGCATGAACCTGG + Intronic
1137995521 16:53206550-53206572 ATTCAGTAGCTGTGTGATCTTGG + Intronic
1138101806 16:54257945-54257967 ATTTAGCAGCAGTATGAAAACGG + Intronic
1138110263 16:54318221-54318243 CTCTATTAGCTGTATGACCCTGG - Intergenic
1138417272 16:56878607-56878629 ATTCAGTGGCTGTGTGACCCTGG - Intronic
1138441336 16:57036775-57036797 ACTTAGTAGCATTGTGAACCTGG + Intronic
1138523919 16:57590889-57590911 ACTGAGTAGCTGTATGACCCTGG - Intronic
1138541469 16:57690238-57690260 ACTTAGGAGCTGTGTGATCCTGG + Intergenic
1138926319 16:61595717-61595739 ATTTTGTAGGTGAATGAACTAGG - Intergenic
1138954572 16:61955045-61955067 ATTTAGTAGGTCTATGGACTTGG - Intronic
1139745180 16:69068410-69068432 CATTACTAGCTGTGTGAACCTGG + Intronic
1140960989 16:79912753-79912775 ATTTACCAGCTGTGTGATCCTGG + Intergenic
1140962439 16:79929446-79929468 ATTTACTAGCTATATGAGCTTGG - Intergenic
1141284430 16:82658553-82658575 GCTTATTAGCTGTATGAACTTGG + Intronic
1141537949 16:84696310-84696332 ACTCACTAGCTGTGTGAACCTGG - Intergenic
1141898760 16:86976567-86976589 ACTTAGTAGCTGTGTGACCCTGG - Intergenic
1142270644 16:89087612-89087634 AGTTAGTAGCTGCATGATACTGG - Intergenic
1142515617 17:426454-426476 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1143066017 17:4248054-4248076 ATTTACTAGCTGTGTGACCTTGG + Intronic
1143859719 17:9879895-9879917 ACTTAGTGTCTGTATGACCCTGG + Intronic
1144025154 17:11270954-11270976 ATTTTATAGCTGGTTGAACCAGG + Intronic
1144286084 17:13776021-13776043 ATTTTGAAGCTGTGTGAACTTGG - Intergenic
1145860950 17:28209462-28209484 TTTTAATAGCTGAATGAACTGGG - Intergenic
1146193331 17:30789601-30789623 ATTTACTAGCTGTGTGACACTGG + Intronic
1146300542 17:31685780-31685802 ATTTATTAGCTGTATGAACTTGG - Intergenic
1146318509 17:31827841-31827863 ATTTATTGGCTATATGACCCTGG + Intergenic
1146410012 17:32574878-32574900 ACTTGCTAGCTGTATGACCCTGG + Intronic
1146655751 17:34633923-34633945 ATTTACTAGCTGTGTAAACTTGG + Intronic
1146976615 17:37118678-37118700 ATTTTGTAGCTGAATGAGCTTGG + Intronic
1147166189 17:38594730-38594752 ATTTCCTAGCTGTGTGAGCCTGG - Intronic
1147316042 17:39620905-39620927 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1147549667 17:41430848-41430870 ATTTATTAGCTGTGTGAACTTGG + Intergenic
1149040555 17:52183395-52183417 ACTTAGTAGCTGTATGACTGTGG - Intergenic
1149150988 17:53563788-53563810 ATTTAGTAGCTTTATGGCCTTGG - Intergenic
1149260244 17:54872648-54872670 AATTAGTAGCTGTGTGTAGCTGG - Intergenic
1149774581 17:59347238-59347260 ATTTACTAGCTGTGTGACCTTGG - Intronic
1150039929 17:61849803-61849825 ATTTAATAACTGTATGATACTGG - Intronic
1150041816 17:61870859-61870881 ATTTAGTAAATGTCAGAACCAGG - Intronic
1150352432 17:64456115-64456137 ATTTACTAGCTGTGTGACCTTGG + Intronic
1150470909 17:65436856-65436878 GCTTAGTAGCTGTATGAAATTGG - Intergenic
1150690770 17:67365313-67365335 CTTTACTAGCTGTATGATCTTGG + Intronic
1150770092 17:68033567-68033589 ATTTACTGGCTGTGTGACCCTGG + Intergenic
1151160386 17:72160076-72160098 ACTTTTTAGCTGTATGACCCTGG + Intergenic
1152282338 17:79392324-79392346 ACTTACTAGCTGTGTGATCCTGG + Intronic
1152358521 17:79818600-79818622 ACTCAGTAGCTGTGTGACCCTGG + Intergenic
1152964745 18:104749-104771 TCTTAGTAGCTGTGTGACCCTGG + Intergenic
1153054623 18:933966-933988 ATGTAATGGCTATATGAACCAGG + Intergenic
1153106294 18:1531544-1531566 ATTTATTACCTGCATGAACTTGG - Intergenic
1153356840 18:4146316-4146338 ATTTATTAACTGTGTGAACGTGG - Intronic
1153403972 18:4714398-4714420 TTTGAGTAGCTGTATGCTCCTGG - Intergenic
1153430682 18:5013380-5013402 TTTAACTATCTGTATGAACCTGG + Intergenic
1153611163 18:6886709-6886731 ATTTAGTCGCTGTGTGACCTGGG - Intronic
1153764369 18:8361541-8361563 ATTAACTAGCTGTATGAAGTTGG - Intronic
1154494573 18:14946070-14946092 CCTTAGTAGCTGTGTGATCCTGG - Intergenic
1155246477 18:23915124-23915146 ATTTACTAGCTGTATGACTGTGG - Intronic
1156039553 18:32805127-32805149 ACTTATAAGCTGTATGAACCTGG + Intergenic
1156115263 18:33779916-33779938 ATTTAGTAGCTGAATGCCCTTGG + Intergenic
1156159094 18:34338109-34338131 ATTTTGTAGCTGGGTGAACAAGG + Intergenic
1157043548 18:44067616-44067638 ATTTACTAGATGGATGTACCAGG - Intergenic
1157151703 18:45224746-45224768 ACTTACTAGCTGTATGAACTTGG - Intronic
1157332068 18:46711394-46711416 ATTTACTAGCTGAATGACCTTGG - Intronic
1157365674 18:47061983-47062005 ATTTATTAGCTGTGTGGCCCTGG + Intronic
1158110311 18:53933386-53933408 ATTTAGTACCTGTATTACTCAGG + Intergenic
1158456280 18:57610910-57610932 ATTTAGTAGTTGTATTAATTTGG + Intronic
1158937196 18:62375664-62375686 GCTTACTAGCTGTATGATCCTGG - Intronic
1159161686 18:64650502-64650524 ATTTAGGAGCTGTGTGACCTTGG - Intergenic
1159876128 18:73813152-73813174 ACTTACTAGCTGTGTGAACTTGG + Intergenic
1162997900 19:14348144-14348166 ATTTTCTGGCTCTATGAACCTGG + Intergenic
1163065161 19:14786929-14786951 ATTTTCTGGCTCTATGAACCTGG - Intergenic
1163086452 19:14983939-14983961 ATTTAGTTTCTGTAAGCACCTGG - Intronic
1165223808 19:34339732-34339754 ATTCAGTAACTGTAAGAACATGG - Intronic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
1166663211 19:44660991-44661013 CTTTAGGAGCTGTGTGAACTTGG - Intronic
1168359933 19:55730991-55731013 ATTTAGTAACTATGTGACCCTGG + Intronic
1168726728 19:58587131-58587153 TCTTAGTAGCTGTGTGACCCTGG - Intergenic
924958928 2:16364-16386 TCTTAGTAGCTGTGTGACCCTGG + Intergenic
925178784 2:1803197-1803219 ATTTAGTTGCTTTATGAATTGGG - Intronic
925245460 2:2378624-2378646 GTTTAATAGCTGTATGATCTTGG + Intergenic
925812839 2:7717986-7718008 ATTTACTAGTTGTGTAAACCTGG - Intergenic
926383133 2:12311131-12311153 ATTTAGCAGCCATTTGAACCTGG + Intergenic
926385263 2:12329603-12329625 ATTTAGTAGCTGTGTGAATTGGG - Intergenic
926412346 2:12617410-12617432 ATTTAGTAGCTGTCTGATGTTGG - Intergenic
926618123 2:15020048-15020070 AAATAGTAGCTGTATGAACTTGG - Intergenic
927049517 2:19313309-19313331 ATTTACTAGCTGTGTGACCTTGG + Intergenic
927341462 2:21988421-21988443 ATATAGTATCTGCATTAACCTGG - Intergenic
927723595 2:25403962-25403984 ATTTACTAGCTGTGTGATCTTGG + Intronic
928148908 2:28808918-28808940 TTTTACTAGCTGTATGAACGTGG - Intronic
928912683 2:36438858-36438880 ATTTACTAGCTGTGTGACCTTGG + Intronic
928917046 2:36483528-36483550 ACTTATGAGCTGTATGACCCTGG - Intronic
930045870 2:47172333-47172355 ATTTAATAGCTGTGTGACCTTGG + Intronic
930144411 2:47986662-47986684 ATTTATTTACTGAATGAACCAGG + Intergenic
930366149 2:50442149-50442171 ACTTAATAGCTCTATGATCCTGG + Intronic
930623925 2:53675010-53675032 ATTAACTAGCTGTGTGACCCTGG + Intronic
931079787 2:58755635-58755657 ATTTATTAGCTGTATGGCCTTGG + Intergenic
931255350 2:60567337-60567359 CTATAGTAGCTGTATCAAGCTGG + Intergenic
931874611 2:66498369-66498391 ACTTAATAGCTGTGTGACCCTGG - Intronic
932355712 2:71067124-71067146 ATTTACTAGCTGGATGAGCTTGG - Intronic
932452337 2:71820020-71820042 TTTTAGTAGCTGTATTAACTAGG - Intergenic
933279287 2:80314960-80314982 ATTTAGAAGCTGTGTGATCTGGG + Intronic
933299479 2:80525893-80525915 ACTTATTAGCTGTATGATCTGGG + Intronic
933413985 2:81961221-81961243 ATTTAATAGGTGTTTGAACTTGG + Intergenic
935375815 2:102396165-102396187 ATTTACTAGCTGTGTGACTCTGG + Intronic
935503698 2:103872838-103872860 ACTCAGTAGCTGTATGGACAAGG + Intergenic
935550832 2:104451932-104451954 ATTTACTAATTGTATGAACTTGG + Intergenic
935817920 2:106864601-106864623 ATTTATTAGCTGTATCAACTTGG + Intronic
936564214 2:113570638-113570660 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
936571827 2:113624075-113624097 TCTTAGTAGCTGTGTGACCCTGG + Intergenic
936771703 2:115921148-115921170 ATTTACTAGCTGTGTGATCTCGG + Intergenic
937235259 2:120427902-120427924 ATTTACTAGCTGTGTGACCTTGG - Intergenic
938038156 2:128053565-128053587 ACTTAGTAACAGTTTGAACCGGG - Intergenic
938190603 2:129276666-129276688 AGTTAGTAGCTGCATGTAGCAGG + Intergenic
938506889 2:131894395-131894417 ATTCAGTATCTGGCTGAACCTGG + Intergenic
938607732 2:132913371-132913393 ATTTATTAGCTGTGTGATCTCGG + Intronic
939320245 2:140610532-140610554 CTTTACTAGCTATATGATCCTGG + Intronic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
939994076 2:148903737-148903759 ATTTAGTAGCTATGTGACCTTGG - Intronic
940115326 2:150202226-150202248 ATTTACAAGCTGTGTGACCCTGG - Intergenic
940161855 2:150722002-150722024 ATTAAGTAGCTATATGAGTCTGG - Intergenic
940236209 2:151513313-151513335 ATTAAGTAGCTGTTTGGAGCTGG - Intronic
940497800 2:154455634-154455656 ATTTAGTAGCAGTTCGAACATGG - Intergenic
940656840 2:156497582-156497604 ATTTAGTTACTTTATGTACCTGG + Intronic
940702067 2:157057828-157057850 ACTTATTAGCTGTGTGACCCTGG - Intergenic
942197926 2:173541100-173541122 ATTTACTAGCTGCGTGAACTTGG + Intergenic
942423249 2:175830494-175830516 ATTTACTAGCTGTGTGACCTGGG + Intergenic
942505919 2:176641638-176641660 ATTTACTAGCTGTGTGACCTTGG - Intergenic
942520211 2:176795994-176796016 ATTTACTAACTGTATAAACTTGG + Intergenic
942717610 2:178911395-178911417 ATTTATTAGCTCTATGACCTTGG - Intronic
942973312 2:181983278-181983300 ATATATTAGCTGGATGACCCCGG + Intronic
943083187 2:183281372-183281394 ATTTAATAGCTGTATGGCCTCGG + Intergenic
943330331 2:186551249-186551271 ACTTACTAGCTGTGTGAACTTGG - Intergenic
943784586 2:191863111-191863133 ATCTGGTAGATGGATGAACCAGG - Intergenic
943918187 2:193665236-193665258 ATTTATTAACTGTGTGAACTTGG - Intergenic
944415576 2:199476178-199476200 ATTTACTAGCTGTGTAAACTTGG + Intergenic
944843781 2:203648596-203648618 ATTTGTTAGATCTATGAACCTGG + Intergenic
945733069 2:213564853-213564875 ATTTAGTAGCTGTTTCACCTTGG - Intronic
946018667 2:216624161-216624183 ATTTACTAGCTGTGTAAACTCGG - Intergenic
946247136 2:218394327-218394349 ACTTGCTAGCTGTGTGAACCTGG - Intronic
946478933 2:220035048-220035070 ATTTGCTAGCTGTATGATCTTGG + Intergenic
946583014 2:221151035-221151057 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
946797202 2:223368085-223368107 ATTTAGCACCTGTAAAAACCAGG + Intergenic
946904133 2:224399947-224399969 ACTTAGTAGCTGTATGACTGTGG - Intronic
947010925 2:225565816-225565838 ATTTAGTAGTTGTATAACCTTGG - Intronic
947164732 2:227250386-227250408 ATTTAAAAATTGTATGAACCAGG + Intronic
947579050 2:231300631-231300653 ACTTATTAGCTGTGTGAACTTGG - Intronic
1168969939 20:1924119-1924141 ACTAAGTAGCTGTGTGACCCTGG - Intronic
1168983336 20:2026396-2026418 ATCTAGTAGCTCCTTGAACCAGG - Intergenic
1169484353 20:6014254-6014276 ACTTAGTAGCTGTGTGATCTTGG - Intronic
1169487884 20:6048513-6048535 ATTTACTAGCTATGTGAACTGGG + Intronic
1170959085 20:21009114-21009136 ATTCAGTAGCTGTGTGACCTTGG + Intergenic
1172195879 20:33091110-33091132 ATTTATTAGCTGTGTGACCTTGG - Intronic
1172539194 20:35698196-35698218 ACTTAGTAACTGTGTGAACTTGG - Intronic
1173701645 20:45077118-45077140 ATTTACTAGCTGCATGACCTTGG - Exonic
1173908490 20:46646271-46646293 GTTTAGTAGCTGTGTGACCTTGG + Intronic
1174224804 20:48989074-48989096 ACTTAGTAATTGTATGACCCTGG + Intronic
1174478544 20:50814652-50814674 ATTTATTAGCTGTGTGAGCTTGG + Intronic
1174511747 20:51058632-51058654 ATTTTCTAGCGGTGTGAACCTGG + Intergenic
1176786745 21:13265890-13265912 ATTCAGTATCTGGCTGAACCTGG - Intergenic
1177235166 21:18379743-18379765 ACTTAGTACCTGTGTGACCCTGG + Intronic
1177833446 21:26165873-26165895 AATTAATAGCTTTATGAAACAGG - Intronic
1177985354 21:27967978-27968000 ATTCAGTATCTGGCTGAACCTGG - Intergenic
1179055586 21:37929034-37929056 CTTTTGTAGCTGCATGAATCTGG - Intergenic
1181617858 22:24067035-24067057 ATTCAGCGGCTGTATGAAGCAGG + Exonic
1181930352 22:26395970-26395992 ATGTACCAGCTGTGTGAACCTGG - Intergenic
1182373962 22:29832478-29832500 GGTTAGTAGGTGCATGAACCAGG - Intronic
1182916560 22:34038227-34038249 AGTTACTAGCTGTAGGACCCTGG - Intergenic
1183130827 22:35834191-35834213 TCTTAGTAGCTGTCTGAACTTGG + Intronic
1183159487 22:36102435-36102457 ACTTACTAGCTGTATGATCTTGG - Intergenic
1185428368 22:50786814-50786836 TCTTAGTAGCTGTGTGACCCTGG - Intergenic
949095813 3:84172-84194 ATTTATTAGCTGTATAACCCTGG + Intergenic
949444649 3:4120847-4120869 ATTTACTAACTGTATGACCATGG + Intronic
949573374 3:5314753-5314775 ATTTACTAGCTGTGTGACCTTGG + Intergenic
949719115 3:6967972-6967994 GTTTAGTAGCTGTGTGAATTAGG + Intronic
949977145 3:9471322-9471344 ATTTACTAGCTGTGTGACCACGG - Intronic
950298348 3:11851389-11851411 ATTTAATAGCTGTGTGACCTTGG + Intergenic
951281498 3:20755639-20755661 ATTTATTAGCTGTATAACTCTGG + Intergenic
951761116 3:26148404-26148426 ATTTAGTAACAATTTGAACCAGG + Intergenic
952083690 3:29792559-29792581 ACTTACTAGCTGTATGACCTGGG + Intronic
953529731 3:43729511-43729533 ACTCATTAGCTGTATGATCCTGG - Intronic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
954090663 3:48281481-48281503 ACTTATTAGCTGTGTGAACATGG - Intronic
954987544 3:54809094-54809116 ACTTAGTAGCCATAAGAACCTGG - Intronic
955147653 3:56336186-56336208 ATTTATTAGCTGTGTGGCCCCGG + Intronic
955608986 3:60737671-60737693 ATTTAATAGATGGAGGAACCAGG + Intronic
955798846 3:62665767-62665789 ACTTAGTAGCTGTGTGACCTTGG + Intronic
956486649 3:69730102-69730124 ATTTATTGGCTGTATGACCTTGG - Intergenic
956791353 3:72682578-72682600 ACTCAGTAGCTGTGTGAACTTGG + Intergenic
956925898 3:73988057-73988079 ATTTACCAGCTGTGTGACCCTGG - Intergenic
957484588 3:80841998-80842020 ATTTACTAGCTATATGTCCCTGG + Intergenic
958555506 3:95670713-95670735 ACTTACTAGCTGTGTGAACATGG - Intergenic
959395248 3:105829171-105829193 TTTTAGGAGCTATATGAACTGGG - Intronic
959572879 3:107904225-107904247 ATTTTTTAACTGTTTGAACCAGG - Intergenic
959623467 3:108423729-108423751 ATTTAATAGCTGTGTGAATTTGG - Intronic
959633289 3:108533349-108533371 ATTTACTAGCTCTAGGATCCTGG + Intergenic
960351726 3:116602163-116602185 ATTTAGTAGCTGCATAACACTGG - Intronic
960535762 3:118812992-118813014 ATTTATTAGCTGCATGACCTTGG - Intergenic
960964200 3:123093293-123093315 AGTTAGTATCTGAATGAATCTGG - Intronic
961026865 3:123565973-123565995 ATTTACCAGCTGTATGAGCTGGG + Intronic
961813149 3:129533232-129533254 ATTTTCTAGCTGTATGGCCCTGG + Intronic
962158635 3:132976024-132976046 ATTTACTAGCTGCATGACCCTGG - Intergenic
962391210 3:134974340-134974362 ACTTACTAGCTGTATGACCTTGG + Intronic
962549813 3:136478873-136478895 ATTTACTAGCTGTGTGACCTTGG + Intronic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
962848963 3:139293722-139293744 ATTTATTAGCTGTGTGACCCTGG + Intronic
963212419 3:142707942-142707964 ATTTAGTATCTGTGTGACCATGG + Intronic
963679768 3:148359662-148359684 ATTTATTAGCTGTATGATCTTGG + Intergenic
963819600 3:149874357-149874379 ATTTACTAGCAGTATGATCTTGG + Intronic
963821376 3:149898507-149898529 ACCTAGTAGCTGTATGACCTTGG + Intronic
964811518 3:160669465-160669487 ATTTTCTCTCTGTATGAACCTGG - Intergenic
965573788 3:170197489-170197511 ATTTACTAGCTGTGTGACCTTGG - Intergenic
967655155 3:192039230-192039252 ATTAAATAGCTGTATGACCTTGG - Intergenic
967838347 3:193982964-193982986 ATTTAATAGCGGTATGACCTTGG + Intergenic
968374401 4:26749-26771 TCTTAGTAGCTGTGTGACCCTGG + Intergenic
969107664 4:4819932-4819954 GTTTATTAGCTGTGTGACCCTGG + Intergenic
970310659 4:14778960-14778982 ATTTATTAGCTGGGTGACCCTGG + Intergenic
970330674 4:14980713-14980735 ATTTACTAGGTGTGTGAACTTGG + Intergenic
970377280 4:15471671-15471693 ATTTATTAGCTGTGTGATCTTGG - Intronic
970422156 4:15915409-15915431 ATCTAGTAGCAGAATGATCCAGG - Intergenic
970835398 4:20399379-20399401 ATTTAGGAGCTGTGTGTCCCTGG + Intronic
971421084 4:26474737-26474759 ATTCACTAGCTGTCTGACCCTGG + Intergenic
972500052 4:39669570-39669592 ATTTACTAGCTGCATGACCTTGG + Intergenic
972631243 4:40843841-40843863 ATGTAGTAGCTGTGTGACCTTGG - Intronic
972712975 4:41616839-41616861 ATCTACTAGCTGTGTGACCCTGG - Intronic
972734276 4:41825481-41825503 ACTTATTAGCTGTGTGACCCTGG - Intergenic
972982045 4:44716126-44716148 ACTTAGTATCTGTATGACCTGGG - Intronic
973122654 4:46541945-46541967 ATTTCTTAGGTGTATGACCCTGG + Intergenic
973339948 4:48993709-48993731 CTTTACTAGCTGTGTGAACTTGG + Intronic
973621662 4:52732681-52732703 ACTTAGTAGCTGTGGGAACTTGG + Intronic
973665049 4:53150650-53150672 AATTACTAGCTGTATGACCTTGG + Intronic
974686486 4:65237948-65237970 ATTTAGAAGCTGAATGACCTGGG - Intergenic
974890452 4:67875661-67875683 ATTTATTTGCTGTGTGAACCTGG + Intronic
974936643 4:68416617-68416639 ATTTACTAGCTGTGTGACCTAGG - Intergenic
975145234 4:70959743-70959765 ATTTAATAGCTATATGACCTAGG - Intronic
975189307 4:71441102-71441124 ATTTACTAACTGTATGACCTTGG - Intronic
975783518 4:77863910-77863932 ATTTACTAGTTATATGAACTTGG - Intronic
975784363 4:77872150-77872172 ATTTAGTAGCTCTCTGACCTTGG - Intronic
975804082 4:78094816-78094838 ATTTAGTAGCTGTTGGACCTTGG + Intronic
975957201 4:79855858-79855880 AATTACTAGCTGTGTGAACTTGG - Intergenic
976133808 4:81913323-81913345 TTTTCCTAGCTGTATGACCCTGG + Intronic
976146833 4:82050449-82050471 ATATAGTAGCTGTGTAAACTTGG - Intergenic
976232063 4:82854634-82854656 ACTTAGTAGCTGTATGATCTAGG - Intronic
976391132 4:84504985-84505007 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
976540301 4:86266312-86266334 ACTTAATAGCTGTATGACCTCGG + Intronic
976588692 4:86827283-86827305 ATTTTCTAGCTCTATGAACTTGG + Intronic
976776352 4:88710453-88710475 ATTTACTAGCTGTTTGACCTTGG + Intergenic
977194510 4:94042872-94042894 AATTAAGAGCTGTATGAACAGGG - Intergenic
977309778 4:95371551-95371573 ATTTAGTACCTGTGTGAATTTGG + Intronic
977405172 4:96588717-96588739 ATTGGGTAGCTGTATCTACCAGG - Intergenic
977743083 4:100510721-100510743 ACTTACTAGCTGTATAAACTTGG - Intronic
978042079 4:104079444-104079466 ATGTTGTAGCTGTATAAACTTGG - Intergenic
978921457 4:114188110-114188132 ACATAGTAGCTGTGTGACCCTGG - Intergenic
979277026 4:118825560-118825582 ACTTATTAGTTGTATGAACCTGG + Intronic
979503080 4:121462014-121462036 ATTTAGTTGCTATAAGAACTTGG + Intergenic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
979746173 4:124215968-124215990 ATCTACTTGCTGTGTGAACCTGG - Intergenic
979922706 4:126521431-126521453 AATTACTTGCTGTATGAACTTGG - Intergenic
981298373 4:143158834-143158856 ATTTACTAGCTATATGACCTTGG - Intergenic
981309311 4:143281056-143281078 ATTTACTAGCTGTGTAATCCTGG - Intergenic
981728909 4:147876918-147876940 ATTTAGTAGTTGTATGACCTAGG - Intronic
982974768 4:162041848-162041870 ATTTAGAAGTTATATGAAGCAGG + Intronic
983520918 4:168708078-168708100 ATTTATTAGCTGTGTGACCTTGG + Intronic
983872771 4:172841408-172841430 AAATAGTAGCTGCATGAACTTGG - Intronic
984239995 4:177206770-177206792 ATTTATTAGCTGTGTGACCTTGG - Intergenic
985460327 4:190099514-190099536 TCTTAGTAGCTGTGTGACCCTGG - Intergenic
985464785 4:190183591-190183613 TATTAGTAGCTGTGTGACCCTGG - Intronic
986540229 5:8837808-8837830 ATTTAGGATCTTTATGACCCAGG + Intergenic
986696101 5:10355771-10355793 ATTTACTACCTGTATTATCCTGG - Intronic
987146808 5:14999394-14999416 ATTTAATAGCTGCATGCTCCTGG + Intergenic
988851679 5:35187037-35187059 ATTCAGTAGCTGCAGGATCCTGG + Intronic
989336106 5:40318822-40318844 ATTTTCTAGCTGTATGATCTTGG + Intergenic
989776938 5:45220318-45220340 ATGTAGTAGCTATGTGATCCTGG + Intergenic
990227301 5:53668884-53668906 ATTTAGTAACTCTGTGAAGCAGG + Intronic
990366323 5:55074403-55074425 ATTTATTAGCTGTGTGAACTAGG + Intergenic
991562484 5:67968764-67968786 TTTTATTAGCTGTATGACCTTGG + Intergenic
991900050 5:71451765-71451787 AATTAGTAGCTGTGTCAACTTGG + Intergenic
992463236 5:76982576-76982598 AATGAGTAGCTGTATGACCTTGG - Intergenic
992481701 5:77158089-77158111 ACTTACTAGCTGCATGACCCAGG - Intergenic
992969941 5:82046058-82046080 ATTTAGAAGCTGTTCCAACCTGG - Intronic
993861979 5:93147267-93147289 ATTAAGTAGATGTGTGAATCTGG + Intergenic
995209974 5:109526573-109526595 ATTTACTAGCTGTGTGATCTTGG + Intergenic
995568484 5:113455951-113455973 GTTTATTAGCTGTATGATCTTGG - Intronic
995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG + Intergenic
996021623 5:118596988-118597010 ATTTATTAGCTGTATGACCTTGG - Intergenic
997622878 5:135310772-135310794 TCTTATTAGCTGTATGACCCTGG - Intronic
997843380 5:137263027-137263049 AGTTACTAGCTGTGTGATCCTGG - Intronic
998471244 5:142385604-142385626 ATTTATTAGCTGTGTGATTCTGG + Intergenic
998760481 5:145426725-145426747 GCTTAGTAGCTGTATGATCTTGG - Intergenic
998861232 5:146446322-146446344 ATTTAGTAGATGTGTGACCTTGG + Intergenic
998923588 5:147098220-147098242 ATTTACTAGCTGTGTGGTCCTGG + Intergenic
999517959 5:152320010-152320032 ACTTACTAGCTGTATGACCTTGG - Intergenic
999630908 5:153570366-153570388 GTTTGATAGCTGTATGATCCAGG - Intronic
999858172 5:155617755-155617777 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1000396137 5:160776552-160776574 ACTCAGTAGCTGTGTCAACCTGG - Intronic
1000446203 5:161324596-161324618 ATTTTATAGCTATATGAACTGGG - Intronic
1000680448 5:164177338-164177360 ATATACTAGCTATATGATCCTGG - Intergenic
1001092313 5:168750533-168750555 ACTCAGTAGCTGTGTGAAGCGGG + Intronic
1001134860 5:169094106-169094128 ATTTATTAGCTGTGTGATCTTGG - Intronic
1001141397 5:169146866-169146888 ACTTACTAGCTGTGTGAACTTGG + Intronic
1001377622 5:171277760-171277782 ACTTATTAGCTGTATGATACTGG - Intronic
1001787381 5:174425514-174425536 ATTTACTGGCTCTGTGAACCTGG - Intergenic
1003516305 6:6821690-6821712 ACTTAGTAGCTGTGTGATCTTGG + Intergenic
1003821500 6:9902601-9902623 ATTTACTAGCTGTGTGACCCTGG - Intronic
1003866067 6:10363931-10363953 ATTTAGTTGCTGTTTTAACTGGG - Intergenic
1004210245 6:13633562-13633584 ATTTACTAGCTGTGTGACCTTGG - Intronic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1005136358 6:22572817-22572839 ATTTACTAGTTGTATGACCTTGG - Intergenic
1006139839 6:31921626-31921648 GCTTAGTACCTGTATGAACCTGG + Intronic
1006810020 6:36814019-36814041 ATTTACTAACTGTATGACCTAGG - Intronic
1007070555 6:39034745-39034767 ACTTAGTAGCTGTGAGAACTTGG - Intergenic
1007252328 6:40504248-40504270 ACTTAGTAGCTGTGTGACCTTGG + Intronic
1007903615 6:45436360-45436382 ATTTATTAGTTGTATGAACTTGG + Intronic
1008122212 6:47631708-47631730 AATGAGTAGCTGTGTGAACTTGG + Intergenic
1008140867 6:47830622-47830644 AATAAGTAGCAGAATGAACCAGG + Intronic
1008542733 6:52559313-52559335 ATTTACTAGCTGTATCATCTAGG + Intronic
1008888116 6:56453424-56453446 ATTTTCTAGCTGTGTGATCCTGG + Intergenic
1009654961 6:66532192-66532214 CTTTAGTATCTGTGTAAACCTGG - Intergenic
1009853037 6:69222304-69222326 ATTTAGTGGTTGTATGGACAAGG - Intronic
1010606602 6:77897111-77897133 ATTTACTAGCTATATGATCTGGG - Intronic
1010642624 6:78348020-78348042 ATTTAGTTGCAGTATGATCTTGG - Intergenic
1011046574 6:83090291-83090313 ACTTAGCAGCTGTATGACCTTGG - Intronic
1011535672 6:88373592-88373614 ACTTACTATTTGTATGAACCTGG + Intergenic
1011743291 6:90385049-90385071 ATTTACTGGCTGTATGACCTTGG + Intergenic
1011911052 6:92439221-92439243 GTTTACTAGCTGTTTGACCCAGG + Intergenic
1012010566 6:93779154-93779176 ATTTAGAAGCTGCCTGAAACAGG + Intergenic
1012996972 6:105984054-105984076 ATTTACTAGCTCTATGACCTTGG - Intergenic
1013877277 6:114847701-114847723 ATTTATTAGCTGAATAAACTTGG - Intergenic
1014408506 6:121083747-121083769 AGTTACTAGATGTATGAACTTGG + Intronic
1014857018 6:126415508-126415530 ATTTAGTAGCTCTGTGAATGTGG - Intergenic
1014944469 6:127480305-127480327 ATATACCAGCTGTATGAACTTGG - Intronic
1015403339 6:132811560-132811582 ATTTATTAGCTGTGTGATCTTGG + Intergenic
1015452401 6:133385957-133385979 GTTTAGTAGCTTTAGGAAACAGG - Intronic
1017205522 6:151800729-151800751 ATTGATTAGCTGTATTTACCAGG - Intronic
1017475182 6:154783639-154783661 ATCTGGTAGCTGTATGTACATGG + Intronic
1017529834 6:155278662-155278684 ACTTACTAGCTGTGTGAACTTGG - Intronic
1020497422 7:8873730-8873752 ATTTAGTAGCTTTATTTTCCAGG - Intergenic
1020512270 7:9072649-9072671 CTTTACCAGCTGTTTGAACCTGG + Intergenic
1021097797 7:16552904-16552926 ATGTAGTAGCTGTATAATCGTGG + Intronic
1021392008 7:20104140-20104162 ATTCAGTAGCTGTGTGACCTTGG + Intergenic
1022186033 7:27969970-27969992 ATTTATTAGCTGTGTAAACTTGG + Intronic
1022375906 7:29810769-29810791 ATTTATTTGCTGTATGATCTTGG + Intronic
1022715687 7:32895901-32895923 ATTCAGTAGCTGTATGATTCTGG + Intergenic
1022853787 7:34295572-34295594 ACTTACTAGCTATATGAACTTGG + Intergenic
1022963643 7:35453824-35453846 ATTTACTAGCTGTAGGACCTTGG - Intergenic
1023148965 7:37181716-37181738 ACTTACTAGCTGTGTGACCCTGG - Intronic
1024510526 7:50200623-50200645 ATTTATTAGCTGTGTGACCGTGG + Intergenic
1025044972 7:55684780-55684802 ACTGAGTAGCTGTGTGACCCTGG + Intergenic
1026095226 7:67341514-67341536 ATTTACCAGCTGTGTGACCCTGG + Intergenic
1026230864 7:68482821-68482843 ATTCACTAGCTGTATTAGCCAGG + Intergenic
1026288061 7:68981074-68981096 CTTTGGAAGCTGAATGAACCAGG + Intergenic
1026577928 7:71589752-71589774 ATTTATTAGCTGTAAGACCTTGG - Intronic
1027339669 7:77192352-77192374 ATTTGCAAGCTGTATGATCCTGG - Intronic
1027514332 7:79123380-79123402 ATTTACCAGCTGCATGAACTTGG + Intronic
1028265505 7:88719074-88719096 ATTTACCAGCTGAATGACCCTGG - Intergenic
1028305771 7:89262413-89262435 ATTTATTAGCTATATGACCATGG + Intronic
1028427802 7:90709858-90709880 ATTCAGTTGCTGTATGAGCCTGG + Intronic
1028656206 7:93210364-93210386 ATTTAATAGCTATATGACCATGG - Intronic
1028932136 7:96425273-96425295 ACTTAGTAGCTCTGTGACCCTGG + Intergenic
1030020509 7:105270720-105270742 TTTTAATAGCTGTATGACCTTGG + Intronic
1030023276 7:105296891-105296913 ATTTGCTAGCTGTATGACCTTGG - Intronic
1030131885 7:106208643-106208665 ACTTAATAGCTGTGTGAACTTGG + Intergenic
1030219373 7:107080898-107080920 ATTTATTAGCTGTGTGACCTTGG + Intronic
1030508013 7:110449052-110449074 TCTTAGTAGCTGCATGAACTTGG - Intergenic
1030525503 7:110648602-110648624 ACTTACTAGCTGTGTGACCCTGG + Intergenic
1031166060 7:118228433-118228455 ATTTATAAACTGTATGAATCAGG - Intronic
1031623458 7:123965110-123965132 ACTTATTAGCTGTCTGACCCAGG - Intronic
1032233710 7:130101074-130101096 ATTTAGCAACTGTATGACCTTGG + Intronic
1032655632 7:133926219-133926241 ACTTAGTGGCTGTGTGAACTTGG - Intronic
1032948014 7:136873593-136873615 ACTTACTAGCTGTATGATCTCGG - Intronic
1033010407 7:137616179-137616201 ATTTAATAACTATATGACCCTGG + Intronic
1033834221 7:145289169-145289191 TCTTATTAGCTGTATGAACTTGG - Intergenic
1036040482 8:5074500-5074522 ACTTAGTAAATGTATGATCCTGG - Intergenic
1036498455 8:9292076-9292098 ATTTGGAAGATTTATGAACCTGG + Intergenic
1036704284 8:11035026-11035048 ATTTAGTAGTAGTGTGACCCTGG + Intronic
1036909769 8:12746758-12746780 AATTACTAGCTGTATGATCATGG - Intronic
1039966480 8:42287739-42287761 ATTTACTAGCTGTGTGACCTTGG - Intronic
1039994004 8:42515579-42515601 ACTTAGTGGCTGTGTGACCCTGG - Intronic
1040023963 8:42764693-42764715 ATTTTGTAGTTGTATGACCCTGG + Intronic
1041432646 8:57800617-57800639 ATTTACTAGCTGTATGACCTTGG - Intergenic
1041854837 8:62439429-62439451 ATTTAGCAGGTGTTTGAGCCTGG + Intronic
1041980740 8:63856102-63856124 ATTGACTAGGTGTATCAACCAGG + Intergenic
1042106085 8:65327579-65327601 AGTTAGTAGCTGTGTGATCTTGG - Intergenic
1042518721 8:69687223-69687245 ATTTAGTAGCTATGTGACCTTGG + Intronic
1042575321 8:70211648-70211670 ATTTAGGAGCTTTTTGAACCTGG - Intronic
1042693627 8:71531347-71531369 TTTTACTAGCTGTATGACCTGGG - Intronic
1043478066 8:80624819-80624841 ATTTACTAACTGTATGACCATGG - Intergenic
1043488217 8:80720025-80720047 ATTTAATAGCTGTGTGACCTTGG - Intronic
1044404255 8:91809674-91809696 ATTTATTAGTTGTGTGAACTTGG - Intergenic
1044724049 8:95178119-95178141 ATTGAGCAGCAGTCTGAACCAGG - Intergenic
1045372152 8:101535151-101535173 ATTTTGTAGCTGTGTTACCCTGG + Intronic
1045807690 8:106184328-106184350 AGTTACTAGCTGTGTGAACTTGG - Intergenic
1046054971 8:109068459-109068481 ATTTACTAGCTGTGTGACCTTGG - Intergenic
1046480225 8:114807520-114807542 CTTTAGTAGCTGCATCATCCTGG - Intergenic
1046732530 8:117740712-117740734 ATTTATTAACAGTATGATCCTGG + Intergenic
1047228719 8:122977941-122977963 ACTTACTAGCTGTATGACCTTGG + Intergenic
1047338429 8:123957605-123957627 ATTTATTAGCTGTGTGACCTGGG - Intronic
1047355319 8:124115802-124115824 ATTTACTAGCTGTGTGATCTTGG - Intronic
1047362605 8:124182991-124183013 ACTTAGTGGCTGTGTGAACATGG + Intergenic
1047517957 8:125571343-125571365 ATTTATTAGCTGTGTTACCCTGG - Intergenic
1048052672 8:130833260-130833282 ATTTACTGGCCGTGTGAACCTGG + Intronic
1048172226 8:132118174-132118196 ATTTACTAGCTATGTGACCCTGG + Intergenic
1048281459 8:133108587-133108609 ACTTCTTAGCTGTATGAACTTGG - Intronic
1048486430 8:134852071-134852093 ATTTAGAAGCTGTTTGATCTTGG + Intergenic
1048720712 8:137321116-137321138 ATTTATTAGCTGTGTGAACCTGG + Intergenic
1050494383 9:6225449-6225471 ATTTACTAGCTGTGTGACCTTGG + Intronic
1050664268 9:7917636-7917658 ATTTGGTAGCTGAATGACCCTGG + Intergenic
1051141150 9:13980133-13980155 ACTTGGTAGCTGTGTGACCCGGG + Intergenic
1051198040 9:14585530-14585552 ACTTATTAGCTGTGTGACCCTGG - Intergenic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1051681932 9:19616405-19616427 ATTTACTAGCTGTGTGACCTCGG - Intronic
1051908124 9:22119994-22120016 AGTTAGTAGCTGTGTGATCTTGG + Intergenic
1051973516 9:22920825-22920847 ATTTATTAGCTGTGTAAACTTGG - Intergenic
1052109226 9:24559969-24559991 ATGTATTAACTGTATGAACGTGG + Intergenic
1052249569 9:26381534-26381556 ATTTACTAGCTGTAGGATCTTGG + Intergenic
1052356201 9:27507209-27507231 ACTTACTAGCTGTATGACCACGG - Intronic
1052458706 9:28734552-28734574 ATTTAGCAGCTGTATGACCTTGG - Intergenic
1052476179 9:28962336-28962358 ATTTACTATCTGTATGAATTTGG - Intergenic
1053309002 9:37003526-37003548 TCTTATTAGCTGTATGATCCTGG - Intronic
1053562754 9:39212781-39212803 GTTTGCTAGCTGTATGAACTTGG - Intronic
1053828557 9:42050749-42050771 ATTTGCTAGCTGTATGAACTTGG - Intronic
1054134396 9:61406261-61406283 GTTTGCTAGCTGTATGAACTTGG + Intergenic
1054602004 9:67136705-67136727 ATTTGCTAGCTGTATGAACTTGG + Intergenic
1054919888 9:70531909-70531931 ATTTAGCATCTTTGTGAACCGGG - Exonic
1055058353 9:72044177-72044199 ATTTAGAAGCTGTATTATTCAGG + Intergenic
1055652672 9:78422088-78422110 ATTTAGTTGCTGTGTGATCTTGG + Intergenic
1055751247 9:79507722-79507744 ATTTATTAGCTGTATGGTCTTGG - Intergenic
1056542764 9:87588076-87588098 ATTTACTAGCTGTGTGATCTTGG - Intronic
1056547590 9:87625696-87625718 ATTTAGCAGCTGTGTGGCCCTGG - Intronic
1056884407 9:90427330-90427352 GTTTAGTAGTTACATGAACCAGG + Intergenic
1057158642 9:92868392-92868414 ATTCAGGAGCTGTATGATCTTGG + Intronic
1057475153 9:95393652-95393674 ATTTACTAGCTATATGACCTTGG + Intergenic
1057810650 9:98254476-98254498 ACTTACTAGCTGTGTGACCCTGG - Intronic
1058123404 9:101164210-101164232 ACTTATCAGCTGTGTGAACCTGG + Intronic
1058457750 9:105153785-105153807 ATTTACTAGCTGCATGAACTTGG - Intergenic
1058486863 9:105450422-105450444 ATTTATAAGCTGTATGAGCTGGG + Intronic
1058757004 9:108092040-108092062 ACTTAGTATCTGTGTGATCCTGG - Intergenic
1058923115 9:109637053-109637075 ATTTACTAGCTTTGTGAACTTGG - Intergenic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059944558 9:119395757-119395779 ATTTACTACCTGTGTGACCCTGG + Intergenic
1060139698 9:121199830-121199852 ATTTAGTAGTAGTATGACCACGG - Intronic
1060814815 9:126629475-126629497 ATTTACTAGCTGTGTGACCTTGG - Intronic
1060870613 9:127037006-127037028 ACTTATTAGCTGTATGATCTTGG + Intronic
1060950754 9:127600883-127600905 ATTTATTGGCTGTGTGACCCCGG + Intergenic
1062694034 9:137863332-137863354 ATTGACTAGCTGTATGACCCGGG - Intronic
1203574821 Un_KI270744v1:167402-167424 TCTTAGTAGCTGTGTGACCCTGG - Intergenic
1186250801 X:7663939-7663961 ATTTTGTAGCTGTAGGAGTCTGG + Intergenic
1186762946 X:12742220-12742242 ATTGAGTTGCTGTGTGCACCAGG - Intergenic
1186799327 X:13077562-13077584 ATTTAGTAGCTGTGTGTCCTTGG + Intergenic
1187311366 X:18146560-18146582 ATTAAGTAGCTGTATAACACTGG - Intergenic
1188186412 X:27120981-27121003 ACTTAGTACCTGTATGATCTTGG - Intergenic
1188353207 X:29157671-29157693 ATTTATTAGCTGTATGACTTTGG + Intronic
1188444825 X:30245476-30245498 ACTTACTAGCTGTGTGAACTTGG - Intronic
1188564787 X:31513903-31513925 ATTTATTAGCTGTGTGAACCTGG - Intronic
1189141928 X:38616293-38616315 ACTTACTAGCTGTATAACCCTGG - Intronic
1189193871 X:39135301-39135323 ATTTCCTAGCTCTATGAATCTGG - Intergenic
1190118726 X:47643061-47643083 ACTTATTAGCTGTGTGACCCTGG + Intronic
1190751147 X:53362658-53362680 ATTTATTAGCTCTGTGACCCTGG + Intergenic
1190760847 X:53436831-53436853 ATTTACTAGCCGAATGACCCTGG + Intergenic
1190938406 X:55017220-55017242 ATTTACTAGCTGTGTGACCTTGG + Intronic
1191025872 X:55912618-55912640 ACTTACTAGCTGTATGATCTTGG - Intergenic
1191720985 X:64228462-64228484 ATTTAGTAGCTGTGTGACCTGGG + Intronic
1192050097 X:67716931-67716953 AATTACTAGCTGTATGATCTTGG + Intronic
1192089512 X:68138803-68138825 ACTTAGTAGCTGTATGACCTTGG - Intronic
1192226578 X:69232366-69232388 ATTTATTAGGTGTATGATCTTGG + Intergenic
1192373595 X:70536421-70536443 ATTTATTAGCTGTATGACTTTGG - Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1192928349 X:75779672-75779694 ACTTACTAGCTGTGTGAACTTGG - Intergenic
1193770513 X:85582109-85582131 ACTTACTAGCTGTGTGATCCTGG - Intergenic
1193787183 X:85773330-85773352 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1193892663 X:87069837-87069859 ATTTACTAGCTGTATGATGCTGG + Intergenic
1194650325 X:96506584-96506606 ATTTACCGGCTGTGTGAACCTGG + Intergenic
1194714091 X:97270431-97270453 ACTTAGTAGCTGTGTGACCTTGG - Intronic
1194774961 X:97951872-97951894 TTTTGGTAGCTGTATTATCCTGG - Intergenic
1194908965 X:99615347-99615369 ATTTAGAAGCAGTATGACACTGG - Intergenic
1194918908 X:99739769-99739791 ATTTACCAGCTGTGTGACCCTGG - Intergenic
1194956764 X:100190143-100190165 ATTTACTAGCTGTGTGACCTTGG - Intergenic
1195008350 X:100709569-100709591 ATTTACTAGCTGTGTGACCTTGG + Intronic
1195381532 X:104275839-104275861 ATTTACTAACTATATAAACCAGG - Intergenic
1195772063 X:108361988-108362010 ATTAAGTAGCTATATGAACTTGG + Intronic
1196027091 X:111052628-111052650 ACTCAGTAGCTGTATGAATCAGG - Intronic
1196329601 X:114455541-114455563 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1196480184 X:116139355-116139377 ATTTATTAGCTGTATCATCCTGG - Intergenic
1196580479 X:117373597-117373619 ATTTAGTAGCTATGTGATCTTGG + Intergenic
1196827023 X:119749333-119749355 AATTACTAGCTGTGTGAACGTGG + Intergenic
1197118430 X:122861509-122861531 ATTTACTAGCTGTGTGAATTTGG + Intergenic
1197652503 X:129081105-129081127 ATTTACTAGCTGTGTGACCATGG - Intergenic
1197822578 X:130555913-130555935 ATTTACTGGCTGTGTGAACCTGG + Intergenic
1198006477 X:132499638-132499660 ACTTACTAGCTGTGTGATCCTGG + Intergenic
1198209398 X:134502674-134502696 ACTTACTAGCTGTGTGATCCTGG - Intronic
1198776358 X:140183611-140183633 ATTTACTAGATGTATGACCTTGG + Intergenic
1199058248 X:143323461-143323483 ATTTACTAGCTATATGATCTTGG + Intergenic
1199117604 X:144010727-144010749 ATTTATTAGCTGTGTGAAATTGG + Intergenic
1199426780 X:147711358-147711380 AGTTATTAGCTGTATGAAGTTGG - Intergenic
1199475952 X:148245491-148245513 ACTTACTAGCTCTATGAACTTGG + Intergenic
1199510486 X:148616247-148616269 ATTTACTAGCCGTATGATCTTGG + Intronic
1199571471 X:149271042-149271064 ATTTGCTGGCTGTATAAACCTGG + Intergenic
1199675176 X:150182690-150182712 ACTTAGTAGCTGTATGACTTAGG - Intergenic
1200374364 X:155764221-155764243 ACTTACTAGCTGTATGATCTTGG + Intergenic