ID: 979659517

View in Genome Browser
Species Human (GRCh38)
Location 4:123237788-123237810
Sequence GATGAACTAGTCACCCCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1202
Summary {0: 1, 1: 0, 2: 1, 3: 82, 4: 1118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979659517_979659522 1 Left 979659517 4:123237788-123237810 CCAACTGGGGTGACTAGTTCATC 0: 1
1: 0
2: 1
3: 82
4: 1118
Right 979659522 4:123237812-123237834 CATTGGGACTGGTTGGACAGTGG 0: 373
1: 970
2: 954
3: 753
4: 712
979659517_979659520 -10 Left 979659517 4:123237788-123237810 CCAACTGGGGTGACTAGTTCATC 0: 1
1: 0
2: 1
3: 82
4: 1118
Right 979659520 4:123237801-123237823 CTAGTTCATCTCATTGGGACTGG 0: 14
1: 493
2: 1054
3: 876
4: 532
979659517_979659524 14 Left 979659517 4:123237788-123237810 CCAACTGGGGTGACTAGTTCATC 0: 1
1: 0
2: 1
3: 82
4: 1118
Right 979659524 4:123237825-123237847 TGGACAGTGGGTGCAGCCCACGG 0: 495
1: 805
2: 644
3: 418
4: 401
979659517_979659521 -6 Left 979659517 4:123237788-123237810 CCAACTGGGGTGACTAGTTCATC 0: 1
1: 0
2: 1
3: 82
4: 1118
Right 979659521 4:123237805-123237827 TTCATCTCATTGGGACTGGTTGG 0: 420
1: 658
2: 435
3: 525
4: 436
979659517_979659523 2 Left 979659517 4:123237788-123237810 CCAACTGGGGTGACTAGTTCATC 0: 1
1: 0
2: 1
3: 82
4: 1118
Right 979659523 4:123237813-123237835 ATTGGGACTGGTTGGACAGTGGG 0: 369
1: 925
2: 910
3: 710
4: 757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979659517 Original CRISPR GATGAACTAGTCACCCCAGT TGG (reversed) Intronic
900038942 1:441019-441041 GATGAACCAGGTACCTCAGTTGG - Intergenic
900060374 1:675995-676017 GATGAACCAGGTACCTCAGTTGG - Intergenic
901091797 1:6646581-6646603 GATGTACTAGTGACCACAGCTGG + Intronic
902134311 1:14291716-14291738 GATGAACCAGGTACCTCAGTTGG + Intergenic
902200547 1:14830343-14830365 GATGAACACGTCACCCAAGTTGG - Intronic
902965182 1:19995891-19995913 GATGAACAGGGTACCCCAGTTGG + Intergenic
902965200 1:19996013-19996035 GATGAACCTGATACCCCAGTTGG - Intergenic
903625096 1:24724828-24724850 AAAGAACTAGTTACCCCTGTTGG + Intergenic
904447323 1:30585638-30585660 GATGAACCAGGTACCTCAGTTGG + Intergenic
905355529 1:37381096-37381118 GATGAACCAGGTACCTCAGTTGG + Intergenic
905843383 1:41205155-41205177 GATGAACCAGATACCTCAGTTGG - Intronic
905897131 1:41555527-41555549 GATGAACCAGGTACCTCAGTTGG + Intronic
906835106 1:49074423-49074445 GATGAACCAGGTACCTCAGTTGG + Intronic
906839602 1:49122241-49122263 GATGAACCAGGTACCTCAGTTGG + Intronic
906843190 1:49161406-49161428 GATGAACTGGTTACCTCAGTTGG + Intronic
907857822 1:58321373-58321395 GATGAACCAGGTACCTCAGTTGG - Intronic
908178417 1:61579183-61579205 GATGAACCAGGTACCTCAGTTGG + Intergenic
908576766 1:65468070-65468092 GATGAACCAGGTACCTCAGTTGG + Intronic
908611501 1:65865735-65865757 GATGAACTGGGTACCTCAGTTGG + Intronic
908913792 1:69102567-69102589 GATGAACTTGGTACCTCAGTTGG + Intergenic
909403200 1:75257836-75257858 GATGTACTGGTTACCTCAGTTGG - Intronic
909557382 1:76969132-76969154 GATGAACCAGGAACCTCAGTTGG - Intronic
909558320 1:76981103-76981125 GATGAACCAGGTACCTCAGTTGG - Intronic
909668091 1:78158788-78158810 GATGAACCAGGTACCTCAGTTGG - Intergenic
909807972 1:79894629-79894651 GATGAACCAGGTACCTCAGTTGG + Intergenic
910383542 1:86657527-86657549 GATGAACCAGGTACCTCAGTTGG - Intergenic
910606352 1:89088889-89088911 GATGAACTGGGTACCTCAGTTGG + Intergenic
910930307 1:92436789-92436811 GATGAACCTGTTACCTCAGTTGG + Intergenic
910956823 1:92715572-92715594 GATGAACCAGGTACCTCAGTTGG - Intronic
911079751 1:93916677-93916699 GATGAACCAGGTACCTCAGTTGG + Intergenic
911218055 1:95216884-95216906 GATGAACCAGGTACCTCAGTTGG + Intronic
911284708 1:95975268-95975290 GATGAACTGGGTACCTCAGTTGG + Intergenic
911339322 1:96617887-96617909 GATGAACCAGGTACCTCAGTTGG + Intergenic
911342025 1:96651344-96651366 GATGAACCAGGTACCTCAGTTGG - Intergenic
911517240 1:98881627-98881649 GATGAACCAGGTACCTCAGTTGG + Intergenic
911676967 1:100669015-100669037 GATGAACCAGGTACCTCAGTTGG + Intergenic
911689755 1:100820043-100820065 GATGAACCAGGTACCTCAGTTGG - Intergenic
912463164 1:109851148-109851170 GATGAACCAGCTACCTCAGTTGG - Intergenic
912646112 1:111393847-111393869 GATGAACCAGGTACCTCAGTTGG - Intergenic
912675700 1:111679175-111679197 GATGAACTGGGTACCTCAGTTGG - Intronic
913342260 1:117769992-117770014 GATGAACCAGGTACCTCAGTTGG + Intergenic
913408077 1:118517817-118517839 GATGAACCAGGTACCTCAGTTGG + Intergenic
913428394 1:118760975-118760997 GATGAACTGGGTACCTCAGTTGG - Intergenic
913430202 1:118781635-118781657 GATGAACCAGGTACCTCAGTTGG + Intergenic
913473642 1:119215443-119215465 GATGAACCAGGTACCTCAGTTGG + Intergenic
913512434 1:119573960-119573982 GATGAACCAGGTACCTCAGTTGG - Intergenic
913607348 1:120478248-120478270 GATGAACCAGGTACCTCAGTTGG - Intergenic
913933939 1:125015340-125015362 GATGAACTCGGTACCTCAGTTGG - Intergenic
914209086 1:145561891-145561913 GATGAACCAGGTACCTCAGTTGG + Intergenic
914268005 1:146054257-146054279 GATGAACCAGGTACCTCAGTTGG + Intergenic
914369090 1:147006602-147006624 GATGAACGAGGTACCTCAGTTGG - Intergenic
914458678 1:147861718-147861740 GAGGAACCAGGCACCTCAGTTGG - Intergenic
914583846 1:149043586-149043608 GATGAACCAGGTACCTCAGTTGG + Intronic
915061457 1:153189006-153189028 GATGAACCAGGTACCTCAGTTGG + Intergenic
915865681 1:159495407-159495429 GATGAACTGGGTACCTCAGTTGG + Intergenic
915876432 1:159616160-159616182 GATGAACTGGATACCTCAGTTGG - Intergenic
915976180 1:160390929-160390951 GATGAACCAGGTACCTCAGTTGG + Intergenic
916038441 1:160941933-160941955 GATGAACCAGGTACCTCAGTTGG + Intergenic
916140451 1:161692949-161692971 GATGAACTGGTTACCTCAGTTGG - Intergenic
916469572 1:165109598-165109620 GATGAACCAGGCACCTCAGTTGG + Intergenic
916543900 1:165784043-165784065 GATGAACCCGGCACCTCAGTTGG + Intronic
916645956 1:166785190-166785212 GATGAACCAGGTACCTCAGTTGG + Intergenic
916878819 1:168998922-168998944 GATGAACCAGGTACCTCAGTTGG + Intergenic
916973353 1:170048624-170048646 GATGAACTGGGTACCTCAGTTGG - Intronic
917006967 1:170426259-170426281 GATGAACTTGGTACCTCAGTTGG - Intergenic
917030902 1:170690333-170690355 GATGAACTTGTCAGCTCAGTGGG + Intronic
917041535 1:170810834-170810856 GATGAACCAGGTACCTCAGTTGG - Intergenic
917192366 1:172431701-172431723 GATGAACCAGATACCTCAGTTGG - Intronic
917308849 1:173656135-173656157 GATGAACCAGGTACCTCAGTCGG + Intronic
917323829 1:173811777-173811799 GATGAACCAGTTACCTCAGTTGG - Intronic
917743628 1:177986112-177986134 GATGAACCAGGTACCTCAGTTGG - Intergenic
917764202 1:178199334-178199356 GATGAACCAGGTACCTCAGTTGG + Intronic
917904051 1:179572098-179572120 GGTGAACCAGTTACCTCAGTTGG + Intronic
918159249 1:181882313-181882335 GATGAACCAGGTACCTCAGTTGG - Intergenic
918159934 1:181889170-181889192 GATGAACTGGGTACCTCAGTTGG - Intergenic
918253044 1:182721709-182721731 GCTGAACGAGTCAGCACAGTGGG - Intergenic
918301548 1:183208636-183208658 TATGAACCAGCCACCCCATTAGG - Intronic
918360486 1:183751904-183751926 GATGAACTGGGTACCTCAGTTGG + Intronic
918537132 1:185586490-185586512 GATGAACCAGGTACCTCAGTTGG - Intergenic
918632167 1:186730865-186730887 GATGAACCAGGTACCTCAGTTGG + Intergenic
918832575 1:189416553-189416575 GATGAACCAGGCACCTCAGTTGG + Intergenic
918968281 1:191378839-191378861 GATGAACCATGCACCTCAGTTGG + Intergenic
919063981 1:192668991-192669013 GATGAACCAGGTACCTCAGTTGG + Intergenic
919387713 1:196942001-196942023 GATGAACCAGGTACCTCAGTTGG + Intronic
919391673 1:196992556-196992578 GATGAACCAGATACCTCAGTTGG + Intronic
920588756 1:207196048-207196070 GATGAACCAGGTACCTCAGTTGG - Intergenic
920993207 1:210959938-210959960 GATGAACCAGGTACCTCAGTTGG + Intronic
921341775 1:214140994-214141016 GTTAAGCTTGTCACCCCAGTTGG - Intergenic
921916082 1:220611589-220611611 GATGAACCAGGTACCTCAGTTGG + Intronic
921976241 1:221206669-221206691 GATGAACTGGGTACCTCAGTTGG - Intergenic
922253510 1:223871501-223871523 GATGAACTGGGTACCTCAGTTGG + Intergenic
922380125 1:225014309-225014331 GATGAACCAGGTACCTCAGTTGG + Intronic
922393097 1:225168268-225168290 GATGAACCCGTTACCTCAGTTGG - Intronic
922406312 1:225316706-225316728 GATGAACCAGGTACCTCAGTTGG + Intronic
922715916 1:227871975-227871997 GATGAACCAGGCACTTCAGTTGG - Intergenic
923067075 1:230527626-230527648 GATGAACTAGGTTCCTCAGTTGG + Intergenic
923853330 1:237820309-237820331 GATGAACTGGGTACCTCAGTTGG - Intronic
924295915 1:242586726-242586748 GATGAACTAGGTACCTCAGTTGG - Intergenic
924829104 1:247573543-247573565 GATGAACTGGGTACCTCAGTTGG + Intronic
924865912 1:247979687-247979709 GATGAACCAGGTACCTCAGTTGG + Intronic
924878131 1:248128392-248128414 GATGAACTGGGGACCTCAGTTGG - Intergenic
924894131 1:248317319-248317341 GATGAACTGGGGACCTCAGTTGG + Intergenic
1064087925 10:12359383-12359405 CATGAACTAATCACCCCTGTTGG - Intronic
1064518695 10:16177625-16177647 GATGAACCAGGTACCTCAGTTGG + Intergenic
1065076096 10:22080651-22080673 GATGAACTGGGTACCTCAGTTGG + Intergenic
1065076862 10:22089362-22089384 GATGAACCAGGTACCTCAGTTGG - Intergenic
1065119450 10:22514402-22514424 GATGAACCAGTTACCTCAGTTGG + Intergenic
1065121081 10:22530813-22530835 GATGAACTGGGTACCTCAGTTGG + Intergenic
1065364543 10:24922757-24922779 GATGAACCAGCTACCTCAGTTGG - Intronic
1065427317 10:25619269-25619291 GATGAACTGGGTACCTCAGTTGG - Intergenic
1065799068 10:29334738-29334760 GATGAACCAGGTACCTCAGTTGG - Intergenic
1066157826 10:32697291-32697313 GATGAACTCGGTACCTCAGTTGG - Intronic
1066158674 10:32705050-32705072 GATGAACCCGGCACCTCAGTTGG + Intronic
1066751203 10:38659272-38659294 GATGAACCAGGTACCTCAGTTGG - Intergenic
1066755023 10:38703121-38703143 GATGAACCAGGTACCTCAGTTGG - Intergenic
1066965841 10:42263819-42263841 GATGAACCAGGTACCTCAGTTGG + Intergenic
1067127665 10:43533511-43533533 GATGAACCAGGTACCTCAGTTGG + Intergenic
1067579657 10:47434170-47434192 GATGAACTGGGTACCTCAGTTGG + Intergenic
1068086186 10:52375580-52375602 GATGAACTGGGTACCTCAGTTGG + Intergenic
1068126403 10:52846665-52846687 GATGAACCAGGTACCTCAGTTGG + Intergenic
1068169024 10:53370202-53370224 GATGAACCAGGTACCTCAGTTGG - Intergenic
1068210052 10:53909618-53909640 GATGAATTAGGTACCTCAGTTGG - Intronic
1068609582 10:59043883-59043905 GATGAACCAGTTACCTCAGTTGG + Intergenic
1068651545 10:59528283-59528305 GATGAACCAGGTACCTCAGTTGG - Intergenic
1069140011 10:64810790-64810812 GATGAACTGGGTACCTCAGTTGG + Intergenic
1069300280 10:66899463-66899485 GATGAACTAGGTACCTCAGTTGG - Intronic
1070064635 10:73021602-73021624 GATGAACCAGGTACCTCAGTTGG - Intronic
1070343711 10:75521740-75521762 GATGAACCAGGTACCTCAGTTGG + Intronic
1070604538 10:77889503-77889525 GCTGAACCAGTCAACCCAGTCGG + Intronic
1070851802 10:79570475-79570497 GATGAACCACTTACCTCAGTTGG - Intergenic
1070936708 10:80304141-80304163 GATGAACCAGTTACCTCAGTTGG - Intergenic
1071189958 10:83088986-83089008 GATGAACCAGGTACCTCAGTTGG - Intergenic
1071207114 10:83294359-83294381 GATGAACTGGGTACCTCAGTTGG - Intergenic
1071244467 10:83747227-83747249 GATGAACCAGGTACCTCAGTTGG + Intergenic
1071838522 10:89444717-89444739 GATGAACCAGGTACCTCAGTTGG - Intronic
1071844264 10:89505537-89505559 GATGAACCAGGTACCTCAGTTGG - Intronic
1071922950 10:90371851-90371873 GATGAACCAGGTACCTCAGTTGG + Intergenic
1072365453 10:94704084-94704106 GATGAACCGGGCACCTCAGTTGG + Intronic
1072370236 10:94758459-94758481 GATGAACAAGATACCTCAGTTGG + Intronic
1072374541 10:94801050-94801072 GATGAACAAGGTACCGCAGTTGG + Intronic
1072394366 10:95023531-95023553 GATGAACCAGGTACCTCAGTTGG + Intergenic
1072477663 10:95778176-95778198 GATGAACCAGGTACCTCAGTTGG + Intronic
1072775120 10:98183070-98183092 GATGAACCAGGTACCTCAGTTGG + Intronic
1072872202 10:99132529-99132551 GATGAACCAGGTACCTCAGTTGG - Intronic
1073998182 10:109339663-109339685 AATGAACCAGGCACCTCAGTTGG + Intergenic
1074017236 10:109546382-109546404 GATGAACCAGGTACCTCAGTTGG - Intergenic
1074631515 10:115259647-115259669 GATGAACCAGGTACCTCAGTTGG + Intronic
1074933435 10:118153245-118153267 GATGAGTTAGTCACCTCAGCAGG + Intergenic
1075489442 10:122853864-122853886 GATGAAGTAGTCACCCCCATGGG - Intronic
1075805410 10:125185014-125185036 GATGAACCAGGTACCTCAGTTGG + Intergenic
1076591015 10:131582002-131582024 GATGAACCAGGTACCTCAGTTGG + Intergenic
1076965149 11:76930-76952 GATGAACCAGGTACCTCAGTTGG - Intergenic
1077655737 11:4017103-4017125 GATGAACCAGGTACCTCAGTTGG + Intronic
1077710428 11:4531519-4531541 GATGAACCAGATACCTCAGTTGG - Intergenic
1078119264 11:8490030-8490052 GATGAACCAGGTACCTCAGTTGG - Intronic
1078686287 11:13535020-13535042 GATGAACTGGGTACCTCAGTTGG + Intergenic
1078689951 11:13569930-13569952 GATGAACCAGGTACCTCAGTTGG - Intergenic
1078733001 11:13992908-13992930 GATGAACCAGGTACCTCAGTTGG + Intronic
1078993990 11:16678563-16678585 GATGAACCAGGTACCTCAGTTGG - Intronic
1079463755 11:20708368-20708390 GATGAACTGGGTACCGCAGTTGG + Intronic
1079585461 11:22121507-22121529 GATGAACCAGGTACCTCAGTTGG + Intergenic
1079714803 11:23731678-23731700 GATGAACCAGGTACCTCAGTTGG - Intergenic
1079957428 11:26882284-26882306 GATGAACCAGGTACCTCAGTTGG - Intergenic
1080117632 11:28638750-28638772 GATGAACCAGGTACCTCAGTTGG - Intergenic
1080235898 11:30067654-30067676 GATGAACCAGGTACCTCAGTTGG + Intergenic
1081241469 11:40711224-40711246 GATGAACCAGGTACCTCAGTTGG + Intronic
1081252449 11:40851490-40851512 GATGAACTGGCTACCTCAGTTGG + Intronic
1081597811 11:44471344-44471366 GATGAAGTAGTCAGCTCTGTAGG + Intergenic
1081958986 11:47119486-47119508 GATGAACCAGGTACCTCAGTTGG + Intronic
1082249528 11:49963428-49963450 GATGAACCAGGTACCACAGTTGG - Intergenic
1082561438 11:54624922-54624944 GATGAACCAGGTACCTCAGTTGG + Intergenic
1082860156 11:57847939-57847961 GATGAACCAGGTACCTCAGTTGG - Intergenic
1082924296 11:58529822-58529844 GATGAACCGGTTACCTCAGTTGG - Intronic
1083008539 11:59372118-59372140 GATGAACCAGGTACCTCAGTTGG - Intergenic
1083531513 11:63427873-63427895 GATGAACCAGGTACCTCAGTTGG - Intergenic
1085003274 11:73061098-73061120 GATGAACCAGGTACCTCAGTTGG - Intronic
1085536612 11:77224224-77224246 GATGAACCAGGTACCTCAGTTGG + Intronic
1085800657 11:79586181-79586203 GATGAACCAGGTACCTCAGTTGG - Intergenic
1085827561 11:79864490-79864512 GATGAACCGGGCACCTCAGTTGG - Intergenic
1086117266 11:83266218-83266240 GATGAACCAGGTACCTCAGTTGG - Intronic
1086409078 11:86525972-86525994 GATGAACTCGGTACCTCAGTTGG - Intronic
1086425966 11:86682607-86682629 GTGGAACTTGTCACCCCAGCTGG + Intergenic
1087305656 11:96486916-96486938 GATGAACTGGGTACCTCAGTTGG - Intronic
1087332130 11:96793580-96793602 GATGAACCAGGTACCTCAGTTGG + Intergenic
1087482465 11:98718508-98718530 GATGAACCAGGTACCTCAGTTGG + Intergenic
1087545995 11:99583862-99583884 GATGAACTCGGTACCTCAGTTGG + Intronic
1087703891 11:101467060-101467082 GATGAACTGGGTACCTCAGTTGG + Intronic
1087780995 11:102301393-102301415 GATGAACCAGGTACCTCAGTTGG + Intergenic
1087925044 11:103910384-103910406 GATGAACTGGGTACCTCAGTTGG - Intronic
1088152222 11:106758532-106758554 GATGAACCAGGTACCTCAGTTGG + Intronic
1088381114 11:109193377-109193399 GATGAACCAGGTACCTCAGTTGG + Intergenic
1088852279 11:113714696-113714718 GATGAACCAGGTACCTCAGTTGG + Intergenic
1090307394 11:125703230-125703252 GATGAACTGGGTACCTCAGTTGG - Intergenic
1090312601 11:125755709-125755731 GATGAACTGGGTACCTCAGTTGG - Intergenic
1090722929 11:129493566-129493588 GATGAACCAGGTACCTCAGTTGG - Intergenic
1091090131 11:132763168-132763190 GATGAACTGGGTACCTCAGTTGG + Intronic
1091213623 11:133885604-133885626 GATGAACCAGGTACCTCAGTTGG + Intergenic
1091958649 12:4672028-4672050 GATGAACCAGGCACCTCAGTTGG - Intronic
1092327017 12:7543716-7543738 GATGAACCAGGTACCTCAGTTGG - Intergenic
1092440309 12:8495690-8495712 GATGAACCAGGTACCTCAGTTGG - Intergenic
1092517195 12:9226737-9226759 GATGAACCAGGTACCTCAGTTGG + Intergenic
1092629047 12:10358886-10358908 GATGAACTGGTCACCTCATTTGG + Intergenic
1092638799 12:10481459-10481481 GATGAACTGGCTACCTCAGTTGG - Intergenic
1092661978 12:10748265-10748287 GATGAACCAGGTACCTCAGTTGG + Intergenic
1093085993 12:14867377-14867399 GATGAACCAGGTACCTCAGTTGG + Intronic
1093402207 12:18760739-18760761 GATGAACTGGGTACCTCAGTTGG - Intergenic
1093597742 12:20981761-20981783 GATGAACCAGATACCTCAGTTGG + Intergenic
1093992939 12:25610369-25610391 GATGAACCAGGTACCTCAGTTGG + Intronic
1093998272 12:25665984-25666006 GATGAACCAGGTACCTCAGTTGG + Intergenic
1094311770 12:29092460-29092482 GATGAACTAGGTACCTCAGTTGG - Intergenic
1094430812 12:30367386-30367408 GATGAACCAGGTACCTCAGTTGG + Intergenic
1094453195 12:30603937-30603959 GATGAACTAGGTACCTCAGTTGG - Intergenic
1094579316 12:31719204-31719226 GATGAACCAGGTACCTCAGTTGG + Intronic
1094755305 12:33462540-33462562 GATGAACTGGGTACCTCAGTTGG - Intergenic
1094759916 12:33520828-33520850 GATGAACCAGGTACCTCAGTTGG - Intergenic
1094791578 12:33920956-33920978 GATGAACCAGGTACCTCAGTTGG + Intergenic
1095186573 12:39207832-39207854 GATGAACCAGGTACCTCAGTTGG - Intergenic
1095547461 12:43388379-43388401 GATGAACTGGGTACCTCAGTTGG + Intronic
1095674146 12:44897405-44897427 GATGAATTGGGCACCTCAGTTGG - Intronic
1095706503 12:45242604-45242626 GATGAACCAGGTACCTCAGTTGG + Intronic
1095720156 12:45391963-45391985 GATGAACCAGGTACCTCAGTTGG - Intronic
1095793853 12:46195983-46196005 GATGAACCAGGTACCTCAGTTGG + Exonic
1095798382 12:46246118-46246140 GATGAACCAGGTACCTCAGTTGG - Intronic
1095831006 12:46586357-46586379 GATGAACCAGGTACCTCAGTTGG + Intergenic
1095920714 12:47526929-47526951 GATGAACTGGGTACCTCAGTTGG + Intergenic
1097412037 12:59267707-59267729 GATGAACTGGGTACCTCAGTTGG - Intergenic
1097619411 12:61922387-61922409 GATGAACTGGGTACCTCAGTTGG - Intronic
1097749535 12:63336972-63336994 GATGAACCAGGTACCTCAGTTGG - Intergenic
1097752891 12:63377869-63377891 GATGAACTGGGTACCTCAGTTGG - Intergenic
1097912218 12:64982394-64982416 GATGAACAAGTTACCTTAGTTGG + Intergenic
1098438883 12:70497550-70497572 GATGAACTGGGTACCTCAGTTGG + Intergenic
1098840088 12:75467461-75467483 GATAAACTGGTTACCTCAGTTGG + Intergenic
1098993947 12:77096487-77096509 GATGAACCAGGTACCTCAGTTGG + Intergenic
1099239026 12:80116404-80116426 GATGAACTGGGTACCTCAGTTGG + Intergenic
1099523604 12:83693683-83693705 GATGAACCAGGTACCTCAGTTGG - Intergenic
1099699021 12:86061146-86061168 GATGAACCAGGTACCTCAGTTGG - Intronic
1099878341 12:88436758-88436780 GATGAACCAGGTACCTCAGTTGG - Intergenic
1100073980 12:90755661-90755683 GATGAACCAGGCACCTCAGTTGG + Intergenic
1100375198 12:94008361-94008383 GAAGAACTAGGTACCTCAGTTGG + Intergenic
1100417092 12:94389583-94389605 GATGAACCAGGTACCTCAGTTGG - Intronic
1100739946 12:97581176-97581198 GATGAACTGGGTACCTCAGTTGG - Intergenic
1100900746 12:99238010-99238032 GATGAACCAGGTACCTCAGTTGG - Intronic
1101361759 12:104034252-104034274 GATGAACGAGGTACCTCAGTTGG - Intronic
1101628669 12:106471496-106471518 GATGAACCAGGTACCTCAGTTGG + Intronic
1103255492 12:119538447-119538469 GATGAACCAGGTACCTCAGTTGG + Intronic
1104175429 12:126326680-126326702 GATGAACCAGGTACCTCAGTTGG + Intergenic
1105243916 13:18630956-18630978 GATGAACTAGGTACCTCATTTGG - Intergenic
1106336682 13:28789521-28789543 GATGAACTGGGTACCTCAGTTGG + Intergenic
1106650773 13:31688016-31688038 GATGAACTGGGTACCTCAGTTGG - Intergenic
1106816822 13:33418050-33418072 GATGAACCAGATACCTCAGTTGG - Intergenic
1107674176 13:42777303-42777325 GATGAACCAGGTACCTCAGTTGG + Intergenic
1108170284 13:47734872-47734894 GATGAACCAGGTACCTCAGTTGG - Intergenic
1108188036 13:47908048-47908070 GATGAACCAGGTACCTCAGTTGG - Intergenic
1109216013 13:59590763-59590785 GATGAACCAGGTACCTCAGTTGG - Intergenic
1109385983 13:61629350-61629372 GATGAACCAGGTACCTCAGTTGG + Intergenic
1109465883 13:62730241-62730263 GATGAACCAGGTACCTCAGTTGG + Intergenic
1109659076 13:65435498-65435520 GATGAACCAGGTACCTCAGTTGG - Intergenic
1109669371 13:65585257-65585279 GATGAACCAGGTACCTCAGTTGG - Intergenic
1109731457 13:66419441-66419463 GATGAACTGGGTACCTCAGTTGG - Intronic
1109806584 13:67452362-67452384 GATGAACAAGGTACCTCAGTTGG - Intergenic
1110135423 13:72062204-72062226 GATGAACTGGGTACCTCAGTTGG - Intergenic
1110247784 13:73346199-73346221 GATGAACCAGGTACCTCAGTTGG + Intergenic
1110818482 13:79887116-79887138 GATGAACCAGGTACCTCAGTTGG - Intergenic
1110876463 13:80516947-80516969 GATGAACCAGGTACCTCAGTTGG - Intergenic
1111055983 13:82952400-82952422 GATGAACTGGGTACCTCAGTTGG - Intergenic
1111634980 13:90892482-90892504 GATGAGCTAGGTACCTCAGTTGG - Intergenic
1111655252 13:91143636-91143658 GTTGAGCTAGTCATCCCAGAAGG - Intergenic
1112412106 13:99173350-99173372 GATGAACCAGGTACCTCAGTTGG + Intergenic
1113276985 13:108741171-108741193 GATGAACTCGGTACCTCAGTTGG + Intronic
1113300985 13:109018851-109018873 GATGAACCAGCTACCTCAGTTGG + Intronic
1114341851 14:21753861-21753883 GATGAACCAGGTACCTCAGTTGG - Intergenic
1114342526 14:21760151-21760173 GATGAACCAGGTACCTCAGTTGG - Intergenic
1114573286 14:23690582-23690604 GATGAACCAGGTACCTCAGTTGG + Intergenic
1114747596 14:25167176-25167198 GATGAACCAGGTACCTCAGTTGG - Intergenic
1114785018 14:25586231-25586253 GATGAACCAGGTACCTCAGTTGG + Intergenic
1114872138 14:26671615-26671637 AGTGAACTAATCTCCCCAGTAGG - Intergenic
1114964316 14:27939045-27939067 GATGAACCAGGTACCTCAGTTGG - Intergenic
1114981237 14:28168080-28168102 GATGAACCAGGTACCTCAGTTGG - Intergenic
1115008272 14:28512122-28512144 GATGAACCAGGTACCTCAGTTGG + Intergenic
1115116717 14:29889340-29889362 GATGAACCAGGTACCTCAGTTGG - Intronic
1115265285 14:31494212-31494234 GATGAACTGGGTACCTCAGTTGG - Intronic
1115294717 14:31812666-31812688 GATGAACCAGGTACCTCAGTTGG + Intronic
1115338986 14:32272517-32272539 GATGAACTGGGTACCTCAGTTGG - Intergenic
1115584540 14:34797769-34797791 GATGAACCAGGTACCTCAGTTGG - Intronic
1115818385 14:37187847-37187869 GATGAACCAGGTACCTCAGTTGG - Intergenic
1115842840 14:37490804-37490826 GATGAACCAGGTACCTCAGTAGG + Intronic
1116009357 14:39332774-39332796 GATGAACCAGGTACCTCAGTTGG + Intronic
1116236542 14:42285674-42285696 GATGAACCAGGTACCTCAGTTGG + Intergenic
1116433693 14:44873988-44874010 GATGAACCAGGTACCTCAGTTGG + Intergenic
1116482734 14:45411493-45411515 GATGAACCAGGCACCTCAGTTGG - Intergenic
1116515122 14:45795854-45795876 GATGAACTCGGTACCTCAGTTGG - Intergenic
1116644519 14:47509617-47509639 GATGACATTTTCACCCCAGTGGG + Intronic
1116663173 14:47738485-47738507 TATGACCTAGTCACCACAGAAGG - Intergenic
1116796191 14:49393009-49393031 GATGAACCAGGTACCTCAGTTGG - Intergenic
1117169981 14:53084737-53084759 GATGAACCAGGTACCTCAGTTGG - Intronic
1117172731 14:53117256-53117278 GATGAACCAGGTACCTCAGTTGG - Intronic
1117624119 14:57618323-57618345 GATGAACCAGGTACCTCAGTTGG - Intronic
1117887594 14:60381713-60381735 GATGAACCAGGTACCTCAGTTGG - Intergenic
1117892597 14:60443134-60443156 GATGAACCAGGTACCTCAGTTGG - Intronic
1117900686 14:60529321-60529343 GATGAACCAGGTACCTCAGTTGG + Intergenic
1117930640 14:60837574-60837596 GATGAACCAGGTACCTCAGTTGG + Intronic
1117932285 14:60855658-60855680 GATGAACTGGGTACCTCAGTTGG + Intronic
1118559944 14:67067985-67068007 GATGAACTGGGTACCTCAGTTGG + Intronic
1118830017 14:69422036-69422058 GATGAACCAGGTACCTCAGTTGG + Intronic
1119100848 14:71878721-71878743 GATGAACTTGGTACCTCAGTTGG + Intergenic
1119930624 14:78542719-78542741 GATGAACCAGGTACCTCAGTTGG + Intronic
1120137184 14:80884444-80884466 GATGAACTTGATACCTCAGTTGG - Intronic
1120554209 14:85908325-85908347 GATGAGCTGGTTACCTCAGTTGG + Intergenic
1120559698 14:85975089-85975111 GATGAACCAGGTACCTCAGTTGG + Intergenic
1120619957 14:86751033-86751055 GATGAACCAGGCACCTCAATTGG + Intergenic
1122033743 14:98932798-98932820 GATGAGCTGATCACCCCAGGAGG - Intergenic
1122443418 14:101750282-101750304 GATGAACCAGGTACCTCAGTTGG + Intergenic
1124084107 15:26531136-26531158 GATGAACCAGGTACCTCAGTTGG - Intergenic
1124724729 15:32145952-32145974 GATGAACCAGGTACCTCAGTTGG + Intronic
1124893843 15:33757929-33757951 GATGAACTGGGTACCTCAGTTGG - Intronic
1124917984 15:33995793-33995815 GATGAACCAGGTACCTCAGTTGG - Intronic
1124935451 15:34166048-34166070 GATGAACCAGGTACCTCAGTTGG - Intronic
1124948466 15:34293045-34293067 GATGAACCAGGTACCTCAGTTGG + Intronic
1125219464 15:37317164-37317186 GATGAACCGGACACCTCAGTTGG - Intergenic
1125352214 15:38779608-38779630 GATGAACCAGGTACCTCAGTTGG + Intergenic
1125837312 15:42764218-42764240 GATGAACCAGGTACCTCAGTTGG - Intronic
1125984663 15:44038640-44038662 GATGAACTGGGTACCTCAGTTGG - Intronic
1126087106 15:45021117-45021139 GATGAACCAGGTACCTCAGTTGG + Intergenic
1126476265 15:49068638-49068660 GATGAACCAGGTACCTCAGTTGG - Intergenic
1126500671 15:49340475-49340497 GATGAACCAGGTACCTCAGTTGG + Intronic
1126742016 15:51786939-51786961 GATGAACCAGATACCTCAGTTGG - Intronic
1126952296 15:53894194-53894216 GATGAACTGGATACCTCAGTTGG + Intergenic
1127137955 15:55944099-55944121 GATGAACCAGGCACCTCAGGTGG - Intronic
1127157948 15:56149489-56149511 GATGAACCAGGTACCTCAGTTGG - Intronic
1127179383 15:56399071-56399093 GATGAACCAGGTACCTCAGTTGG - Intronic
1127253934 15:57271620-57271642 GATGAACCAGGTACCTCAGTTGG + Intronic
1127452593 15:59131415-59131437 GATGAACCAGGTACCTCAGTTGG - Intergenic
1127525079 15:59784714-59784736 GATGAACCAGATACCTCAGTTGG + Intergenic
1127570565 15:60237258-60237280 GATGAACAAGGTACCTCAGTTGG - Intergenic
1128857611 15:71032332-71032354 GATGAACTGGGTACCTCAGTTGG + Intronic
1129126668 15:73447779-73447801 GATGAACCAGGTACCTCAGTTGG - Intronic
1129578443 15:76779992-76780014 GATGAACCAGGTACCTCAGTTGG - Intronic
1130703729 15:86211871-86211893 GATGAACCAGGCACCTCAGTTGG + Intronic
1130728764 15:86467836-86467858 GATGAACCAGGTACCTCAGTTGG + Intronic
1130800951 15:87262607-87262629 GATGAACCAGGTACCTCAGTTGG + Intergenic
1132007124 15:98237542-98237564 CATGGAATAGTTACCCCAGTGGG - Intergenic
1132096310 15:98987771-98987793 GATGAACTGGGTACCTCAGTTGG - Intronic
1132287995 15:100679589-100679611 GATGAACCAGGTACCTCAGTTGG + Intergenic
1132442978 15:101886588-101886610 GATGAACCAGGTACCTCAGTTGG + Intergenic
1134652076 16:15917537-15917559 GATGAACCAGGTACCTCAGTTGG - Intergenic
1134767687 16:16775088-16775110 GATGAACCCGGTACCCCAGTTGG + Intergenic
1135512013 16:23093959-23093981 GATGAACCAGGTACCTCAGTTGG - Intronic
1136727655 16:32373720-32373742 GATGAACCAGGTACCTCAGTTGG + Intergenic
1136731520 16:32417833-32417855 GATGAACCAGGAACCTCAGTTGG + Intergenic
1137370059 16:47896931-47896953 GATGAACCAGGTACCTCAGTTGG - Intergenic
1137461565 16:48668672-48668694 GATGAACCAGGTACCTCAGTTGG + Intergenic
1137471009 16:48758773-48758795 GATGAACCAGGCACCTCAGTTGG - Intergenic
1137891007 16:52161806-52161828 GATGAACCAGGTACCTCAGTTGG + Intergenic
1138151455 16:54661448-54661470 GATGAACCAGGTACCTCAGTTGG - Intergenic
1138491975 16:57382310-57382332 GAGGAACCAGTCACGCCCGTCGG - Exonic
1140147366 16:72324471-72324493 GATGAACCAGGTACCTCAGTTGG - Intergenic
1141246201 16:82309770-82309792 GATGAACTGGGTACCTCAGTTGG + Intergenic
1142220375 16:88851471-88851493 GATGAACCAGGCACCTCAGTTGG - Intronic
1202998779 16_KI270728v1_random:144030-144052 GATGAACCAGATACCTCAGTTGG - Intergenic
1203130377 16_KI270728v1_random:1680438-1680460 GATGAACCAGGTACCTCAGTTGG - Intergenic
1142937039 17:3343288-3343310 GATGAACCAGGTACCTCAGTTGG + Intergenic
1143427237 17:6849556-6849578 GATGAACTGGGTACCTCAGTTGG + Intergenic
1144293969 17:13855578-13855600 GATGAACCAGGCACCTCAGTTGG - Intergenic
1145738281 17:27249295-27249317 GATGAACCAGGTACCTCAGTTGG - Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148950270 17:51305030-51305052 GATGAACTAGGTATCTCAGTTGG - Intergenic
1148967279 17:51446758-51446780 GATGAACTGGGTACCTCAGTTGG - Intergenic
1149192915 17:54085731-54085753 GATGAACCAGGTACCTCAGTTGG - Intergenic
1149240082 17:54639279-54639301 GATGAACCAGGTACCTCAGTTGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149886260 17:60342955-60342977 GATGAACCAGGTACCTCAGTTGG + Intronic
1149932109 17:60767226-60767248 GATGAACCAGGTACCTCAGTTGG + Intronic
1150025791 17:61673135-61673157 GATGAACCAGGTACCTCAGTTGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150884527 17:69070379-69070401 GATGAACTGGGTACCTCAGTTGG - Intergenic
1153064980 18:1035336-1035358 GATGAACCAGGTACCTCAGTTGG + Intergenic
1153419358 18:4886548-4886570 GATGAACCAGGTACCTCAGTTGG + Intergenic
1153562340 18:6383664-6383686 GATGAACTGGGTACCTCAGTTGG + Intronic
1154101640 18:11479770-11479792 GATGAACCAGGCACCTCAGTTGG + Intergenic
1155006596 18:21735173-21735195 GATGAACCAGGTACCTCAGTTGG - Intronic
1155114126 18:22748396-22748418 GATGAACCAGGTACCTCAGTTGG - Intergenic
1155384833 18:25266536-25266558 GATGAACTGGGTACCTCAGTTGG - Intronic
1155665274 18:28299869-28299891 GATGAACCAGGTACCTCAGTTGG + Intergenic
1156084471 18:33382474-33382496 GATGAACTGGGTACCTCAGTTGG - Intronic
1156188476 18:34690488-34690510 GATGAACTGGGTACCTCAGTTGG + Intronic
1156328958 18:36101390-36101412 GATGAACTGGGTACCTCAGTTGG + Intergenic
1156434407 18:37111639-37111661 GATGAACCAGGCGCCTCAGTTGG - Intronic
1156908404 18:42381781-42381803 GATGAACCAGGTACCTCAGTTGG + Intergenic
1157036698 18:43984071-43984093 GATGAACCAGGTACCTCAGTTGG - Intergenic
1157066655 18:44357557-44357579 GATGAACCAGGTACCTCAGTTGG + Intergenic
1157658821 18:49420623-49420645 GATGAACCAGGTACCTCAGTTGG - Intronic
1158145776 18:54310118-54310140 GATGAACCAGGTACCTCAGTTGG + Intronic
1158399130 18:57104859-57104881 GATGAACTGGGTACCTCAGTTGG + Intergenic
1158703650 18:59771445-59771467 GATGAACCAGGTACCTCAGTTGG - Intergenic
1159143405 18:64424360-64424382 GATGAACCTGTTACCTCAGTTGG - Intergenic
1159386065 18:67726381-67726403 GATGAACTAGGTACCTCAGTTGG + Intergenic
1159645881 18:70917090-70917112 GATGAACCAGGTACCACAGTTGG + Intergenic
1159661317 18:71098475-71098497 GATGAACTGGGTACCTCAGTTGG + Intergenic
1159684463 18:71401100-71401122 TGTGAATTAGTCAGCCCAGTCGG + Intergenic
1159805281 18:72949830-72949852 GATAAAATAATCACCACAGTAGG - Intergenic
1160289465 18:77577837-77577859 GATGAACCAGGTACCTCAGTTGG - Intergenic
1160295943 18:77637202-77637224 GATGAACCAGGTACCTCAGTTGG - Intergenic
1160641954 19:146560-146582 GATGAACCAGGTACCTCAGTTGG - Intergenic
1163251254 19:16127621-16127643 GACGAGTTGGTCACCCCAGTGGG + Intronic
1163380181 19:16961126-16961148 GATGAACCAGGTACCTCAGTTGG - Intronic
1163989789 19:20987984-20988006 GATGAACTGGGTACCTCAGTTGG - Intergenic
1164047639 19:21555990-21556012 GATGAACTGGGTACCTCAGTTGG + Intronic
1164085686 19:21899987-21900009 GATGAACCAGATACCTCAGTTGG + Intergenic
1164152442 19:22566507-22566529 GATGAACTGGGTACCTCAGTTGG + Intergenic
1164394755 19:27852784-27852806 GATGAACCAGGTACCTCAGTTGG - Intergenic
1164406295 19:27949718-27949740 GATGAACCAGGTACCTCAGTTGG + Intergenic
1164416500 19:28050323-28050345 GATGAACTGGGTACCTCAGTTGG - Intergenic
1164560229 19:29286715-29286737 GATGAATAAGCCACCTCAGTAGG - Intergenic
1165003815 19:32787968-32787990 GATGAACCAGGTACCTCAGTTGG + Intronic
1165972996 19:39649297-39649319 GATGAACCAGGTACCTCAGTTGG - Intergenic
1166163738 19:40971499-40971521 GATGAACCAGGTACCTCAGTTGG + Intergenic
1166179614 19:41098620-41098642 GATGAACTAGGTACCTCAGTTGG - Intergenic
1166240221 19:41486444-41486466 GATGAACAAGGTACCTCAGTTGG - Intergenic
1168530952 19:57128120-57128142 GATGAACTGGGTACCTCAGTTGG + Intronic
1202709235 1_KI270714v1_random:7989-8011 GATGAACCAGGTACCTCAGTTGG - Intergenic
925627960 2:5860923-5860945 GATGAACTGGGTACCTCAGTTGG + Intergenic
926366644 2:12139508-12139530 GATGAACCAGGTACCTCAGTTGG + Intergenic
926483548 2:13428143-13428165 GATGAACTGGGTACCTCAGTTGG + Intergenic
926648517 2:15316334-15316356 GATGAACCAGGTACCTCAGTTGG - Intronic
926941803 2:18145182-18145204 GATGAACCAGGTACCTCAGTTGG + Intronic
927021421 2:19020846-19020868 GATGAACTGGTTACCTCAGTTGG + Intergenic
927221166 2:20711499-20711521 GATGAACCAGGTACCTCAGTTGG - Intronic
927564027 2:24095221-24095243 GATGAATCAGTTACCTCAGTCGG - Intronic
928481070 2:31684063-31684085 GATGAACCAGGTACCTCAGTTGG + Intergenic
928487600 2:31748614-31748636 GATGAACCAGGTACCACAGTTGG - Intergenic
929025792 2:37600223-37600245 GATGAACCAGGTACCTCAGTTGG + Intergenic
930143105 2:47973609-47973631 GATGAACCAGGTACCTCAGTTGG - Intergenic
930217060 2:48708057-48708079 GATGAACCAGGTACCTCAGTTGG + Intronic
930266806 2:49209985-49210007 GATGAACCAGTTGCCTCAGTTGG - Intergenic
930274764 2:49298555-49298577 GATGAACCAGGTACCGCAGTTGG - Intergenic
930803003 2:55462247-55462269 GATGAACCAGGTACCTCAGTTGG - Intergenic
930840250 2:55837576-55837598 GATGAACCAGGTACCTCAGTTGG + Intergenic
931204721 2:60136237-60136259 GATGAACCAGGTACCTCAGTTGG + Intergenic
931212186 2:60207668-60207690 GATGAACCAGGTACCTCAGTTGG + Intergenic
931305114 2:61021131-61021153 GATGAACCAGGTACCTCAGTTGG - Intronic
931306503 2:61034419-61034441 GATGAACTAGGTACCTCAGTTGG - Intronic
931594447 2:63926598-63926620 GATGAACCAGGTACCTCAGTTGG - Intronic
931814742 2:65889771-65889793 GATGAGCCAGGCACCTCAGTTGG - Intergenic
931885811 2:66615657-66615679 GATGAACCAGGTACCTCAGTTGG + Intergenic
931971186 2:67589016-67589038 GATGAACTAGGTACCTCAGTTGG - Intergenic
931986235 2:67744997-67745019 GATGAACCAGGTACCTCAGTTGG + Intergenic
932051627 2:68403906-68403928 GATGAACAAGTTACCTCAGTTGG + Intergenic
932539913 2:72641176-72641198 GATGAACCAGGTACCTCAGTTGG - Intronic
932899406 2:75681216-75681238 GATGAACTGGGTACCTCAGTTGG - Intronic
934314199 2:91901441-91901463 GATGAACCAGGTACCTCAGTTGG - Intergenic
934531544 2:95092829-95092851 GATGAACCAGGTACCTCAGTTGG - Intronic
934617020 2:95778558-95778580 GATGAACCAGGAACCTCAGTTGG - Intergenic
934643873 2:96046001-96046023 GATGAACCAGGAACCTCAGTTGG + Intergenic
934837290 2:97602095-97602117 GATGAACCAGGAACCTCAGTTGG + Intergenic
935118326 2:100157697-100157719 GATGAACTGGGTACCTCAGTTGG + Intergenic
935273991 2:101460274-101460296 GATGAACCAGGAACCTCAGTTGG + Intronic
935565897 2:104607424-104607446 GATGAACCAGGTACCTCAGTTGG - Intergenic
936448425 2:112615252-112615274 GATGAACCAGGTACCTCAGTTGG + Intergenic
937606237 2:123804602-123804624 GATGAACCAGCTACCTCAGTTGG + Intergenic
937679225 2:124626361-124626383 GATGAACTGGGTACCTCAGTTGG - Intronic
938224370 2:129602936-129602958 GATGAACCAGGTACCTCAGTTGG + Intergenic
938559436 2:132458162-132458184 GATGAACCAGGTACCTCAGTTGG + Intronic
939019988 2:136947015-136947037 GATGAACCAGTTACCTCAGTTGG + Intronic
939055498 2:137360328-137360350 GATGAACCAGGTACCTCAGTTGG - Intronic
939180293 2:138795735-138795757 GATGAACCAGGTACCTCAGTTGG - Intergenic
939193432 2:138943010-138943032 GATGAACTAGGTACCTCAGTTGG + Intergenic
939208694 2:139142775-139142797 GATGGACCAGTCAGCCCAGAAGG + Intergenic
939876806 2:147586812-147586834 GATGAACCAGGTACCTCAGTTGG + Intergenic
940124762 2:150311104-150311126 GATGAACTGGGTACCTCAGTTGG - Intergenic
940437264 2:153669640-153669662 GATGAACAAGATACCACAGTTGG - Intergenic
940528298 2:154844981-154845003 GATGAACCAGGTACCTCAGTTGG + Intronic
940565255 2:155351886-155351908 GATCAACTGGGCACCTCAGTTGG + Intergenic
940720804 2:157279849-157279871 GATGAACCAGGTACCTCAGTTGG + Intronic
940821310 2:158359468-158359490 GATGAGCCAGGCACCTCAGTTGG - Intronic
940891679 2:159041816-159041838 GATGAACCAGGCACCTCAGTTGG + Intronic
942010964 2:171761888-171761910 GATGAACCAGGTACCTCAGTTGG + Intergenic
942065856 2:172270762-172270784 GATGAACCAGTTACCTCAGTTGG + Intergenic
942434581 2:175957670-175957692 GATGAACCAGGTACCTCAGTTGG - Intronic
942475203 2:176311932-176311954 GATGAACTAGGTACCTCAGCTGG + Intronic
942744060 2:179212109-179212131 GATGAACCAGGTACCTCAGTTGG - Intronic
942753519 2:179314579-179314601 GATGAACCTGTAACCTCAGTTGG - Intergenic
942873530 2:180765187-180765209 GATGAACCAGGTACCTCAGTTGG - Intergenic
942951983 2:181731735-181731757 GATGAACCAGGTACCTCAGTTGG - Intergenic
942958768 2:181804600-181804622 GATGAACCAGGTACCTCAGTTGG + Intergenic
943147783 2:184066492-184066514 GATGAACTGGGTACCTCAGTTGG + Intergenic
943240480 2:185377373-185377395 GATGAACTGGGTACCTCAGTTGG + Intergenic
943359683 2:186902172-186902194 GATGAATCAGTTACCTCAGTTGG + Intergenic
943660382 2:190553950-190553972 GATGAACTGGGTACCTCAGTTGG - Intergenic
943866565 2:192931192-192931214 GATGAACCAGGTACCTCAGTTGG + Intergenic
944374715 2:199028562-199028584 GATGAACCAGGTACCTCAGTTGG - Intergenic
944607825 2:201369394-201369416 GATGAACCAGGTACCTCAGTTGG - Intergenic
944764249 2:202848924-202848946 GATGAACTGGGTACCTCAGTTGG - Intronic
945161929 2:206900262-206900284 GATGAACCAGGTACCTCAGTTGG + Intergenic
945533819 2:210987341-210987363 GATGAACTGGGTACCTCAGTTGG + Intergenic
945597522 2:211813075-211813097 GATGAACCAGGTACCTCAGTTGG + Intronic
945776747 2:214114837-214114859 GATGAACCAGGTACCTCAGTTGG + Intronic
946045291 2:216815981-216816003 TATGAACTAGTCACCACTGTAGG - Intergenic
946065418 2:216983052-216983074 GATGAACTGGGTACCTCAGTTGG + Intergenic
946787173 2:223259448-223259470 GATGAACCAGATACCTCAGTTGG + Intergenic
946912891 2:224484919-224484941 GATGAACCAGGTACCTCAGTTGG - Intronic
947440646 2:230118149-230118171 GATGAACCAGGTACCTCAGTTGG + Intergenic
947493944 2:230619344-230619366 GATGAACCAGGTACCTCAGTTGG - Intergenic
947681518 2:232037889-232037911 GATGAACCAGGTACCTCAGTTGG + Intronic
947902912 2:233737588-233737610 GATGAACCAGGTACCTCAGTTGG + Intronic
1169421425 20:5463722-5463744 GATGAACTGGGTACCTCAGTTGG + Intergenic
1169795777 20:9461369-9461391 GATGAACCAGGTACCTCAGTTGG - Intronic
1170543353 20:17411196-17411218 GATGAACCAGATACCTCAGTTGG - Intronic
1171050441 20:21853524-21853546 GATGAACCAGGTACCTCAGTTGG - Intergenic
1171081780 20:22194217-22194239 GATGAACCAGGTACCTCAGTTGG - Intergenic
1171194355 20:23185941-23185963 GATGAACCAGGTACCTCAGTTGG + Intergenic
1171513498 20:25707064-25707086 GATGAACTGGGTACCTCAGTTGG + Intergenic
1171514818 20:25720761-25720783 GATGAACCAGGTACCTCAGTTGG + Intergenic
1173155183 20:40602593-40602615 CATCAACTAGACACTCCAGTTGG + Intergenic
1173318741 20:41968535-41968557 GATGAACTGGGTACCTCAGTTGG + Intergenic
1173771859 20:45666454-45666476 GATGAACCAGGTACCACAGTTGG + Intronic
1174224131 20:48983027-48983049 GATGAACCAGGTACCTCAGTTGG + Intronic
1174990238 20:55500907-55500929 GATGAACCAGGTACCTCAGTTGG + Intergenic
1176928399 21:14778987-14779009 GATGAACCAGGTACCTCAGTTGG - Intergenic
1177111449 21:17034221-17034243 GATGAACCAGGTACCTCAGTTGG - Intergenic
1177517830 21:22177725-22177747 GATGAACTGGGTACCTCAGTTGG - Intergenic
1177694482 21:24554676-24554698 GATGAACTGGGTACCTCAGTTGG - Intergenic
1180306497 22:11131037-11131059 GATGAACCAGGTACCTCAGTTGG - Intergenic
1180540955 22:16447307-16447329 GATGAACCAGTTACCTCAGTTGG - Intergenic
1180545016 22:16493220-16493242 GATGAACCAGGTACCTCAGTTGG - Intergenic
1181327015 22:22057625-22057647 GATGAACCAGGTACCTCAGTTGG + Intergenic
1182204394 22:28609368-28609390 GATGAACCAGGTACCTCAGTTGG - Intronic
1183520862 22:38295374-38295396 GATGAACTAGGTAACGCAGTCGG - Intronic
949154910 3:816285-816307 GATGAACTGCTTACCTCAGTTGG - Intergenic
949160415 3:875367-875389 GATGAACTCGGTACCTCAGTTGG + Intergenic
949173972 3:1035483-1035505 GATGAACCAGGTACCTCAGTTGG + Intergenic
949428189 3:3941914-3941936 GACGAACCAGTTACCTCAGTTGG + Intronic
949456686 3:4246291-4246313 GATGAACCAGGTACCTCAGTTGG + Intronic
949579783 3:5376617-5376639 GATGAACCAGGTACCTCAGTTGG - Intergenic
949580695 3:5384593-5384615 GATGAGCTAGGTACCTCAGTTGG + Intergenic
949632625 3:5944606-5944628 GATGAACCAGATACCTCAGTTGG + Intergenic
949683508 3:6541834-6541856 GATGAACTGGGTACCTCAGTTGG + Intergenic
949846022 3:8371899-8371921 GATAAACTAGGTACCTCAGTTGG - Intergenic
950050824 3:9987480-9987502 GATGAACTAGTCCAGGCAGTCGG + Intronic
950299937 3:11868028-11868050 GATGAACCAGGTACCTCAGTTGG + Intergenic
950597567 3:13997644-13997666 GATGAACCAGGTACCTCAGTTGG + Intronic
951006275 3:17618932-17618954 GATGAACCAGGTACCTCAGTTGG + Intronic
951012104 3:17693195-17693217 GATGAACCAGGTACCTCAGTTGG - Intronic
951237811 3:20255035-20255057 GATGAACTGGGTACCTCAGTTGG + Intergenic
951347337 3:21561500-21561522 GATGAACTGGGTACCTCAGTTGG + Intronic
951368241 3:21812313-21812335 GATGAACCAGGTACCTCAGTTGG - Intronic
951434326 3:22643794-22643816 GATGAACTGGGTACCTCAGTTGG + Intergenic
951439573 3:22707410-22707432 GATGAACCAGGTACCTCAGTTGG + Intergenic
951687691 3:25362826-25362848 GATGAACCAGGTACCTCAGTTGG + Intronic
951741585 3:25931267-25931289 GATGAACTGGGTACCTCAGTTGG - Intergenic
951759595 3:26130510-26130532 GATGAACTAGGTTCCTCAGTTGG + Intergenic
952550621 3:34472261-34472283 GATGAACCAGTTACCTCAGTTGG + Intergenic
952814041 3:37431413-37431435 GATGAACCAGATACCTCAGTTGG + Intronic
952863940 3:37838898-37838920 GATGAACCAGGTACCTCAGTTGG - Intergenic
953286546 3:41616429-41616451 GATGAACTGGGTACCTCAGTTGG - Intronic
953522788 3:43659168-43659190 GATGAACCAGGTACCTCAGTTGG - Intronic
953653171 3:44824043-44824065 GATGAACCAGGTACCTCAGTTGG + Intronic
954827892 3:53391238-53391260 GATGAACCAGGTACCTCAGTTGG - Intergenic
954836555 3:53473973-53473995 GATGAACCAGGTACCTCAGTTGG + Intergenic
955175204 3:56606635-56606657 GATGAACTAGGTACCTAAGTTGG + Intronic
955454063 3:59100863-59100885 GATGAACTGGGTACCTCAGTTGG + Intergenic
956048398 3:65220760-65220782 GATGAACCAGGTACCTCAGTTGG + Intergenic
956207817 3:66772176-66772198 GATGAGCTGGGCACCTCAGTTGG + Intergenic
956302003 3:67781970-67781992 GATGAACTGGATACCTCAGTTGG + Intergenic
956373302 3:68587175-68587197 GATGAACCAGGTACCTCAGTTGG + Intergenic
956477452 3:69637381-69637403 GATGAACCAGGTACCTCAGTTGG + Intergenic
957786072 3:84885061-84885083 GATGAACCAAGTACCCCAGTTGG - Intergenic
957811650 3:85229486-85229508 GATGAACCAGATACCTCAGTTGG + Intronic
957917920 3:86709397-86709419 GATGAACCAGGTACCTCAGTTGG + Intergenic
957993352 3:87654227-87654249 GATGAACTGGGTACCTCAGTTGG + Intergenic
958036937 3:88182034-88182056 GATGAACCAGGTACCTCAGTTGG - Intergenic
958191799 3:90193655-90193677 GATGAACCAGGTACCTCAGTTGG + Intergenic
958414020 3:93852791-93852813 GATGAACCAGGTACCTCAGTTGG + Intergenic
958479672 3:94630713-94630735 GATGAACCAGGTACCTCAGTTGG - Intergenic
958618428 3:96526752-96526774 GATGAACCAGGTACCTCAGTTGG - Intergenic
959097467 3:101971454-101971476 GATGAACCAGGTACCTCAGTTGG + Intergenic
959100845 3:102008292-102008314 GATGAACCTGGCACCTCAGTTGG - Intergenic
959170892 3:102842319-102842341 GATGAACCAGGTACCTCAGTTGG + Intergenic
959278121 3:104304098-104304120 GTTGAACTGGGCACCTCAGTTGG - Intergenic
959290758 3:104469873-104469895 GATGAACCAGGTACCTCAGTTGG + Intergenic
959308318 3:104697012-104697034 GATGAACCAGATACCTCAGTTGG + Intergenic
959505832 3:107155808-107155830 GATGAACTGGGTACCTCAGTTGG - Intergenic
959692865 3:109218680-109218702 GATGAACCAGGTACCTCAGTTGG - Intergenic
959724620 3:109529227-109529249 GATGAACGAGGTACCTCAGTTGG + Intergenic
959736419 3:109664829-109664851 GATGAACCAGGTACCTCAGTTGG - Intergenic
959815742 3:110671522-110671544 GATGAACCAGATACCTCAGTTGG - Intergenic
960276860 3:115738523-115738545 GATGAACCAGGTACCTCAGTTGG + Intergenic
960478747 3:118162688-118162710 GATGAACCAGGTACCTCAGTTGG - Intergenic
960508046 3:118516819-118516841 GATGAACCAGGTACCTCAGTTGG - Intergenic
960653873 3:119981309-119981331 GATGAACCAGGTACCTCAGTTGG - Intronic
960787744 3:121392434-121392456 GATGAACCAGTTACCTCAGTTGG + Intronic
960827792 3:121811072-121811094 GATGAACTGGGTACCTCAGTTGG - Intronic
960860101 3:122143117-122143139 GATGAACCCGTTACCTCAGTTGG + Intergenic
960911197 3:122651045-122651067 GATGAACCAGGTACCTCAGTTGG - Intergenic
961310483 3:125996337-125996359 GATGAACCAGGTACCTCAGTTGG - Intergenic
961977416 3:131041889-131041911 GATGAACCAGGTACCTCAGTTGG - Intronic
961991996 3:131202207-131202229 GATGAACCAGGCATCTCAGTTGG - Intronic
962137184 3:132747205-132747227 GATGAACCAGGTACCTCAGTTGG + Intergenic
962291406 3:134139964-134139986 GATGAACCAGATACCTCAGTTGG - Intronic
962602854 3:137007818-137007840 GATGAACCAGGTACCTCAGTTGG + Intronic
962624412 3:137211115-137211137 GATGAACCAGGTACCTCAGTTGG - Intergenic
962640229 3:137377645-137377667 GATGAAATAGGTACCTCAGTTGG + Intergenic
962645063 3:137430590-137430612 GATGAACCAGGTACCTCAGTTGG - Intergenic
962665949 3:137653993-137654015 GATGAACCAGGTACCTCAGTTGG - Intergenic
962766918 3:138574054-138574076 GATGAACCAGGTACCTCAGTTGG - Intronic
962861255 3:139404647-139404669 GATGAACGAGGTACCTCAGTTGG - Intergenic
962980624 3:140485983-140486005 GATGAACTCGGTACCTCAGTTGG + Intronic
963048543 3:141122973-141122995 GATGAACCAGGTACCTCAGTTGG + Intronic
963160035 3:142141400-142141422 GATGAACCAGGTACCTCAGTTGG + Intronic
963340242 3:144024019-144024041 GATGAACCCGGCACCTCAGTTGG + Intronic
963410947 3:144926852-144926874 GATGAACTGGGTACCTCAGTTGG + Intergenic
963898571 3:150711922-150711944 GATGAACTGGGTACCTCAGTTGG - Intergenic
963984489 3:151575755-151575777 GATGAACCAGGTACCTCAGTTGG + Intergenic
964053002 3:152419362-152419384 GATGAACTGGGTACCTCAGTTGG - Intronic
964063469 3:152553854-152553876 GGTGAATTAGTCACCCTACTGGG - Intergenic
964232388 3:154486583-154486605 GATGAACTGGATACCCCAGTTGG - Intergenic
964371462 3:156004440-156004462 GATGAGCTGGGTACCCCAGTTGG + Intergenic
964578187 3:158198701-158198723 GATGAACTTGGTACCTCAGTTGG + Intronic
964649203 3:158991925-158991947 GATGAACTGGGTACCTCAGTTGG + Intronic
964701761 3:159575134-159575156 GATGAACCAGGTACCTCAGTTGG + Intronic
965001983 3:162966104-162966126 GATGAACCAGGTACCTCAGTTGG - Intergenic
965221344 3:165931185-165931207 GATGAACCAGGTACCTCAGTTGG - Intergenic
965392988 3:168128377-168128399 GATGAACCAGGTACCTCAGTTGG - Intergenic
965497174 3:169413141-169413163 GATGAACTGGGTACCTCAGTTGG - Intronic
966494079 3:180560011-180560033 GATGAACCAGGTACCTCAGTTGG - Intergenic
967181602 3:186909903-186909925 GATGAACTGGGTACCTCAGTTGG + Intergenic
967419666 3:189259352-189259374 GATGAACTGGGTACCTCAGTTGG + Intronic
967638514 3:191834260-191834282 GATGAACCAGTTACCTCAGTTGG - Intergenic
968155904 3:196380590-196380612 GATGAACCAGGTACCTCAGTTGG - Intronic
968408672 4:365367-365389 GATGAACCAGGTACCTCAGTTGG + Intronic
968860707 4:3166970-3166992 GATGAACTAGGTACCTCAGTTGG + Intronic
969164914 4:5299151-5299173 GATGAACTGGGTACCTCAGTTGG + Intronic
969591407 4:8123780-8123802 CAGGACCTTGTCACCCCAGTTGG - Intronic
970496212 4:16628715-16628737 GATGAACCAGGTACCTCAGTTGG - Intronic
970655446 4:18225401-18225423 GATGAACCAGGTACCTCAGTTGG + Intergenic
970678843 4:18484183-18484205 GATGAACTAGTCTCCTCTCTTGG - Intergenic
970784560 4:19780426-19780448 GATGAACTGGGTACCTCAGTTGG + Intergenic
970792045 4:19868862-19868884 GATGAACCAGGTACCTCAGTTGG + Intergenic
970975781 4:22041219-22041241 GATGAACCAGGTACCTCAGTTGG + Intergenic
971438722 4:26655909-26655931 GATGAACCTGGCACCTCAGTTGG + Intronic
971560698 4:28077048-28077070 GATGAACCAGGTACCTCAGTTGG - Intergenic
972157668 4:36184525-36184547 GATGAACTATACACCACAGAAGG + Intronic
972493641 4:39612282-39612304 GTTGCACTCGTTACCCCAGTTGG + Intronic
972685549 4:41349546-41349568 GATGAACCAGGTACCTCAGTTGG - Intergenic
973137663 4:46727758-46727780 GATGAACCAGGTACCTCAGTTGG + Intergenic
973326809 4:48870623-48870645 GATGAACTTGGTACCTCAGTTGG + Intergenic
973341894 4:49013523-49013545 GATGAACCAGGTACCTCAGTTGG + Intronic
973598929 4:52521962-52521984 GATGAACCAGGTACCTCAGTTGG - Intergenic
973798294 4:54450985-54451007 GATGAACCAGGTACCTCAGTTGG - Intergenic
973835703 4:54807159-54807181 GATGAACCAGTTACCTCAGTTGG - Intergenic
973883489 4:55297241-55297263 GATGAACCAGTTACCTCAGTTGG - Intergenic
974115308 4:57571457-57571479 GATGAACAAGGTACCTCAGTTGG + Intergenic
974176480 4:58332369-58332391 GATGAACCAGGTACCTCAGTTGG - Intergenic
974301973 4:60081104-60081126 GATGAACTGGGTACCTCAGTTGG - Intergenic
974491731 4:62572270-62572292 GATGAACCAGGCACCTCAGTTGG + Intergenic
974566852 4:63589690-63589712 GGTGAACCAGTTACCTCAGTTGG - Intergenic
974719819 4:65724763-65724785 GATGAACCAGGTACCTCAGTGGG - Intergenic
974813865 4:66981530-66981552 GATGAACTTGGTACCTCAGTTGG - Intergenic
974838055 4:67274234-67274256 GATGAACCAGGTACCTCAGTTGG + Intergenic
974871699 4:67652637-67652659 GATGAACCAGATACCTCAGTTGG - Intronic
975064362 4:70041939-70041961 GATGAACCAGGTACCTCAGTTGG + Intergenic
975177806 4:71308510-71308532 GATGAACTGGCTACCTCAGTTGG - Intronic
975219502 4:71797701-71797723 GATGAACCAGGTACCGCAGTTGG + Intronic
975245763 4:72119565-72119587 GATGAACTGGGTACCTCAGTTGG - Intronic
975286927 4:72632142-72632164 GATGAACTCGGTACCTCAGTTGG - Intergenic
975365016 4:73518867-73518889 GATGAACAAGGTACCTCAGTTGG + Intergenic
975367256 4:73544239-73544261 GATGAACCAGGTACCTCAGTTGG - Intergenic
975500611 4:75080286-75080308 GATGAACCAGGTACCTCAGTTGG + Intergenic
975528687 4:75378314-75378336 GATGAACCTGTTACCTCAGTTGG - Intergenic
975751157 4:77524751-77524773 GATGAACCAGGTACCTCAGTTGG + Intronic
975844080 4:78506781-78506803 GATGAACCAGGTACCTCAGTTGG + Intronic
976092617 4:81473466-81473488 GATGAACTGGGTACCTCAGTTGG - Intronic
976167507 4:82271561-82271583 GATGAACCAGGTACCTCAGTTGG - Intergenic
976263029 4:83164143-83164165 GATGAACCAGGTACCTCAGTTGG - Intergenic
976449188 4:85166864-85166886 GATGAACCAGGTACCTCAGTTGG + Intergenic
976506524 4:85853507-85853529 GATGAACCAGGTACCTCAGTTGG + Intronic
976552633 4:86413948-86413970 GATGAACCAGGTACCCCAGTTGG + Intronic
976580568 4:86730835-86730857 GATGAACCAGGTACCTCAGTTGG + Intronic
976585323 4:86790955-86790977 GATGAACCAGGCACCTCAGTTGG - Intronic
976790209 4:88870245-88870267 GATGAACCAGGTACCTCAGTTGG - Intronic
976861400 4:89671212-89671234 GATGAACTGGGTACCTCAGTTGG - Intergenic
976975930 4:91165962-91165984 GATGAACCAGGTACCTCAGTAGG + Intronic
977029562 4:91864348-91864370 GATGAACCTGTTACCTCAGTTGG + Intergenic
977057371 4:92210947-92210969 GATGAACCAGGTACCTCAGTCGG - Intergenic
977194675 4:94044582-94044604 GATGAACCAGGTACCTCAGTTGG - Intergenic
977203915 4:94148558-94148580 GATGAACCAGGTACCTCAGTTGG + Intergenic
977219849 4:94325814-94325836 GATGAACCAGGTACCTCAGTTGG + Intronic
977561446 4:98537345-98537367 GATGAACCGGGCACCTCAGTTGG + Intronic
977829666 4:101576160-101576182 GATGAACCAGGTACCTCAGTTGG - Intronic
977887784 4:102272741-102272763 GATGAACTGGGTACCTCAGTTGG - Intronic
977946414 4:102919519-102919541 GATGAACCAGGTACCTCAGTTGG - Intronic
977950806 4:102968642-102968664 GATGAACCAGGTACCTCAGTTGG - Intronic
978237019 4:106471934-106471956 GATGAACCAGGTACCTCAGTTGG + Intergenic
978245259 4:106564127-106564149 GATGAACCTGGCACCTCAGTTGG + Intergenic
978464483 4:108994067-108994089 GATGAACCAGGTACCTCAGTTGG - Intronic
978548629 4:109900327-109900349 GATGAACTCGGCACCTCAGTTGG + Intergenic
978552224 4:109939571-109939593 GATGAACCAGGTACCTCAGTTGG + Intronic
978906725 4:114013525-114013547 GATGAACTGGGTACCTCAGTTGG + Intergenic
979042073 4:115811763-115811785 GATGAACCAGGTACCTCAGTTGG - Intergenic
979272924 4:118783135-118783157 GATGAACCAGGTACCTCAGTTGG + Intronic
979462745 4:121002043-121002065 GATGAACCAGGTACCTCAGTTGG + Intergenic
979510747 4:121550710-121550732 GATGAACCAGGTACCTCAGTTGG + Intergenic
979581296 4:122364790-122364812 GATGAACCAGGTACCTCAGTTGG - Intergenic
979659517 4:123237788-123237810 GATGAACTAGTCACCCCAGTTGG - Intronic
979668377 4:123337048-123337070 GATGAACTGGGTACCTCAGTTGG + Intergenic
979819473 4:125152189-125152211 GATGAACTGGGTACCTCAGTTGG + Intergenic
979998810 4:127464512-127464534 GATGAACCAGGTACCTCAGTTGG + Intergenic
980037870 4:127905533-127905555 GAAGAACTAGGTACCTCAGTTGG + Intergenic
980260625 4:130442916-130442938 GATGAACCAGGTACCTCAGTTGG + Intergenic
980285750 4:130776821-130776843 GATGAACTGGGTACCTCAGTTGG - Intergenic
980583991 4:134789335-134789357 GATGAACCAGTTACCTCAGTTGG - Intergenic
980594060 4:134929099-134929121 GATGAACCAGGTACCTCAGTTGG + Intergenic
980803505 4:137783742-137783764 GATGAACCAGGTACCTCAGTTGG - Intergenic
980855140 4:138431226-138431248 GATGAACTGGGTACCTCAGTTGG - Intergenic
980888236 4:138786093-138786115 GATGAGCCAGGCACCTCAGTTGG + Intergenic
981134068 4:141190180-141190202 GATGAACCAGGTACCTCAGTTGG + Intronic
981199629 4:141965791-141965813 GATGAACCACGTACCCCAGTTGG - Intergenic
981411161 4:144434718-144434740 GATGAGCTAGGTACCTCAGTTGG - Intergenic
981445763 4:144836810-144836832 GATGAACCAGGTACCTCAGTTGG - Intergenic
981512632 4:145574430-145574452 GATGAACCAGGTACCTCAGTTGG - Intergenic
981560994 4:146048334-146048356 GATGAACCAGCTACCTCAGTTGG + Intergenic
981756909 4:148149868-148149890 TATTAACTAGCCATCCCAGTAGG - Intronic
981850920 4:149229490-149229512 GATGAACCAGGCACTTCAGTTGG - Intergenic
981885238 4:149666213-149666235 GATGAACCAGGTACCTCAGTTGG - Intergenic
981939828 4:150270993-150271015 GATGAACCAGGTACCTCAGTTGG - Intronic
982625517 4:157760865-157760887 GATGAACCAGGTACCTCAGTTGG + Intergenic
982815484 4:159878279-159878301 GATGAACTGGGTACCTCAGTTGG + Intergenic
983179353 4:164630222-164630244 GATGAACCAGGTACCTCAGTTGG - Intergenic
983485999 4:168331704-168331726 GATGAACTGGGTACCTCAGTTGG + Intergenic
983594249 4:169448768-169448790 GATGAACCAGGTACCTCAGTTGG - Intronic
983602847 4:169549312-169549334 GATGAACTGGGTACCTCAGTTGG + Intronic
983949140 4:173619267-173619289 GATGAACCAGGTACCTCAGTTGG + Intergenic
983949554 4:173622913-173622935 GATGAGCTGGTTACCTCAGTTGG + Intergenic
983958904 4:173728325-173728347 GATGAGCTAGATACCTCAGTTGG + Intergenic
984434083 4:179685707-179685729 GATGAACCAGGTACCTCAGTTGG + Intergenic
985317314 4:188672282-188672304 GATGAACTGGGTACCTCAGTTGG - Intergenic
986149671 5:5115716-5115738 GATGAACCAGGTACCTCAGTTGG + Intergenic
986581562 5:9271662-9271684 GATGCACTAGGTACCTCAGTTGG - Intronic
986656427 5:10017076-10017098 GATGAACCAGGTACCTCAGTTGG + Intergenic
986664879 5:10093374-10093396 GATGAACTGGGTACCTCAGTTGG - Intergenic
986838903 5:11672958-11672980 GATGAACCAGGTACCTCAGTTGG + Intronic
986877124 5:12125738-12125760 GATGAACCAGGTACCTCAGTTGG - Intergenic
986996538 5:13613692-13613714 GATGAACTGGGTACCTCAGTTGG - Intergenic
987179848 5:15356180-15356202 GATGAACCAGGTACCTCAGTTGG - Intergenic
987279787 5:16400979-16401001 GATGAACCAGGTACCTCAGTTGG + Intergenic
988021369 5:25626745-25626767 GATGAACTGGGTACCTCAGTTGG - Intergenic
988023717 5:25655873-25655895 GATGAACCAGGTACCTCAGTTGG + Intergenic
988187885 5:27889915-27889937 GATGAACCATGCACCTCAGTTGG + Intergenic
988289714 5:29270127-29270149 GATGAACCAGGTACCTCAGTTGG - Intergenic
988402010 5:30775223-30775245 GATGAACTGGATACCTCAGTTGG - Intergenic
988671707 5:33388772-33388794 GATGAACCAGGTACCTCAGTTGG - Intergenic
988687558 5:33539909-33539931 GATGAACCAGGTACCTCAGTTGG - Intronic
988771191 5:34434813-34434835 GATGAACCAGGTACCTCAGTTGG + Intergenic
988772689 5:34448150-34448172 GATGAACTGGGTACCTCAGTTGG + Intergenic
988975130 5:36508105-36508127 GATGAACCAGGTACCTCAGTTGG - Intergenic
989226396 5:39034419-39034441 GATGAACCCGTTACCTCAGTTGG - Intronic
989345344 5:40423243-40423265 GATGAACTAGGTACCTCAGTTGG + Intergenic
989358129 5:40567417-40567439 GATGAACCAGGTACCTCAGTTGG + Intergenic
989516767 5:42353271-42353293 GATGAACCAGGTACCTCAGTTGG - Intergenic
989522516 5:42418454-42418476 GATGAACCAGGTACCTCAGTTGG + Intergenic
989614799 5:43328906-43328928 GATGAACAAGGTACCTCAGTTGG + Intergenic
989671196 5:43918459-43918481 GATGAACCAGGTACCTCAGTTGG + Intergenic
990098766 5:52156427-52156449 GATGAACTGGGTACCTCAGTTGG - Intergenic
990224345 5:53632064-53632086 GATGAACCAGGTACCTCAGTTGG + Intronic
990231275 5:53715794-53715816 GATGAACTGGGTACCTCAGTTGG - Intergenic
990234266 5:53750592-53750614 GATGAACCAGGTACCTCAGTTGG - Intergenic
990244935 5:53854729-53854751 GATGAACCAGGTACCTCAGTTGG + Intergenic
990351228 5:54918891-54918913 GATGAACCAGGTACCTCAGTTGG - Intergenic
990437659 5:55809353-55809375 GATGAACCCGGCACCTCAGTTGG + Intronic
990713051 5:58606011-58606033 GATGAACCAGGTACCTCAGTTGG - Intronic
990721411 5:58699995-58700017 GATGAACCAGGCACCTCAGTTGG + Intronic
990897690 5:60716288-60716310 GATGAACTGGGTACCTCAGTTGG + Intergenic
991200061 5:63980934-63980956 GATGAACCAGGTACCTCAGTTGG + Intergenic
991243510 5:64485025-64485047 GATGAACTAGGTACCTCAGTTGG + Intergenic
991283336 5:64940467-64940489 GATGAACCAGTTACCTCAGTTGG + Intronic
991417290 5:66405711-66405733 GATGAACCAGGTACCTCAGTTGG + Intergenic
991425035 5:66482139-66482161 GATGAACCAGGTACCTCAGTTGG - Intergenic
991496374 5:67230218-67230240 GATGAACTCGGTACCTCAGTTGG + Intergenic
991651971 5:68865038-68865060 GATGAACCAGGTACCTCAGTTGG - Intergenic
992280883 5:75175837-75175859 GATGAACTCGGTACCGCAGTTGG - Intronic
992966903 5:82011964-82011986 GAGGTAGTAGTCATCCCAGTTGG - Intronic
992977797 5:82138576-82138598 GATGAACTGGGTACCTCAGTTGG + Intronic
993251387 5:85528711-85528733 GATGAACCAGGTACCTCAGTTGG + Intergenic
993266388 5:85731950-85731972 GATGAACCAGGTACCTCAGTTGG - Intergenic
993345636 5:86778497-86778519 GATGAACCAGGTACCTCAGTTGG + Intergenic
993358323 5:86941849-86941871 GATGAACCAGGTACCTCAGTTGG + Intergenic
993366769 5:87043052-87043074 GATGAACCAGGTACCTCAGTTGG + Intergenic
993438357 5:87925009-87925031 GATGAACCAGGTACCTCAGTTGG + Intergenic
993497472 5:88623501-88623523 GATGAACCAGGTACCTCAGTTGG + Intergenic
993757725 5:91751556-91751578 GATGAACTGGGTACCTCAGTTGG + Intergenic
993888231 5:93442158-93442180 GATGAACCTGGCACCTCAGTTGG - Intergenic
993948067 5:94138479-94138501 GATGAAACAGTTACCTCAGTTGG + Intergenic
994039620 5:95244291-95244313 GATGAACCAGGTACCTCAGTTGG - Intronic
994160269 5:96549504-96549526 GATGAACCAGGTACCTCAGTTGG - Intronic
994230608 5:97306998-97307020 GATGAACCAGGTACCTCAGTTGG + Intergenic
994545585 5:101162940-101162962 GATGAACCAGGTACCTCAGTTGG - Intergenic
994575078 5:101567508-101567530 GATGAGCTGGTTACCTCAGTTGG + Intergenic
994622567 5:102179862-102179884 GATGAACTGGGTACCTCAGTTGG + Intergenic
994624054 5:102195997-102196019 GATGAACCAGGTACCTCAGTTGG + Intergenic
994636519 5:102351403-102351425 GATGAACCAGGTACCTCAGTTGG - Intergenic
995136651 5:108686290-108686312 GATGAACCAGGTACCTCAGTTGG + Intergenic
995459710 5:112390158-112390180 GATGAACCAGGTACCTCAGTTGG - Intronic
995811245 5:116109050-116109072 GATGAACTGGGTACCTCAGTTGG + Intronic
996147359 5:119992189-119992211 GATGAACCAGTTACCTCAGCTGG + Intergenic
996420783 5:123259314-123259336 GATGAACCAGGTACCTCAGTTGG + Intergenic
996426712 5:123320668-123320690 GATGAACTGGGTACCTCAGTTGG + Intergenic
996592178 5:125160481-125160503 GATGAACTGGGTACCTCAGTTGG - Intergenic
996625691 5:125568060-125568082 GATGAACTGGGTACCTCAGTTGG - Intergenic
996781936 5:127197228-127197250 GATGAACCAGGTACCTCAGTTGG - Intergenic
997004672 5:129803899-129803921 GATGAACCAGTTATCTCAGTTGG + Intergenic
997216544 5:132116559-132116581 GATGAACCAGGTACCTCAGTTGG - Intergenic
997246021 5:132349801-132349823 GATGAACCAGGTACCTCAGTTGG + Intergenic
998780249 5:145647892-145647914 GATGAACTGGGTACCTCAGTTGG + Intronic
998927580 5:147142892-147142914 GATGAACTGGGTACCTCAGTTGG + Intergenic
998934094 5:147216093-147216115 GATGAACTGGGTACCTCAGTTGG - Intergenic
999489931 5:152039661-152039683 GATGAACCAGGTACCTCAGTTGG + Intergenic
999556716 5:152751754-152751776 GATGAACTAGGTGCCTCAGTTGG - Intergenic
1000249560 5:159481158-159481180 GATTAACTAGTCAGCCAAATGGG - Intergenic
1000417578 5:160998602-160998624 GATGAACTGGGTACCTCAGTTGG + Intergenic
1000574803 5:162964720-162964742 GATGAACCAGGTACCCCAGTTGG + Intergenic
1000660437 5:163932609-163932631 GATGAACTGGGTACCTCAGTTGG - Intergenic
1002734905 5:181377924-181377946 GATGAACCAGGTACCTCAGTTGG + Intergenic
1002749621 6:96198-96220 GATGAACCAGGTACCTCAGTTGG - Intergenic
1003434456 6:6072774-6072796 GATGAACGAGTTACCTCAGTTGG + Intergenic
1003542101 6:7026947-7026969 GATGAACCAGGTACCTCAGTTGG - Intergenic
1003713602 6:8620149-8620171 GATGAACCAGGTACCTCAGTTGG + Intergenic
1003763808 6:9213573-9213595 GATGAACCAGGTACCTCAGTTGG - Intergenic
1003983190 6:11408917-11408939 GATGAACATGTCACCTCTGTGGG + Intergenic
1003987496 6:11451895-11451917 GATGAACCAGGTACCTCAGTTGG - Intergenic
1004027890 6:11836975-11836997 GATGAACCAGGTACCTCAGTTGG - Intergenic
1004056005 6:12139448-12139470 GATGAACCAGGTACCTCAGTTGG - Intronic
1004831486 6:19481831-19481853 GATGAACTTGGAACCTCAGTTGG - Intergenic
1005670375 6:28099496-28099518 GATGAACCAGGTACCTCAGTTGG + Intergenic
1005747079 6:28848531-28848553 GATGAACCAGTTACCTTAGTTGG - Intergenic
1005815302 6:29547232-29547254 GATGAACTGGGTACCTCAGTTGG - Intergenic
1006199862 6:32278997-32279019 GATGAACTGGGTACCTCAGTTGG - Intergenic
1006616562 6:35332039-35332061 GATGAACCAGGTACCTCAGTTGG - Intergenic
1008094701 6:47327919-47327941 GATGAACCAGTTACCTCAGTTGG - Intergenic
1008250567 6:49234565-49234587 GATGAAATAGTGACTCTAGTAGG - Intergenic
1008633107 6:53382813-53382835 GATGAACCAGGTACCTCAGTTGG - Intergenic
1008828990 6:55735626-55735648 GATGAACCTGGTACCCCAGTTGG - Intergenic
1008865319 6:56203753-56203775 GATGAACTGGGTACCTCAGTTGG - Intronic
1008997777 6:57679448-57679470 GATGAACTGGATACCTCAGTTGG - Intergenic
1009186268 6:60578786-60578808 GATGAACTGGGTACCTCAGTTGG - Intergenic
1009289998 6:61869649-61869671 GATGAACCAGGTACCTCAGTTGG - Intronic
1009335964 6:62491807-62491829 GATGAACCAGGTACCTCAGTTGG - Intergenic
1009455167 6:63848471-63848493 GATGAACTGGGTACCTCAGTTGG - Intronic
1009458655 6:63887443-63887465 GATGAACTGGTTACCTCAGTTGG - Intronic
1009492618 6:64311661-64311683 GATGAACTAGGTACCTCATTTGG - Intronic
1009536573 6:64896220-64896242 GATGAACTGGGTACCTCAGTTGG - Intronic
1009628608 6:66166591-66166613 GATGAACCAGGTACCTCAGTTGG - Intergenic
1009709713 6:67300984-67301006 GATGAACCAGGTACCTCAGTTGG + Intergenic
1009740340 6:67734906-67734928 GATGAACTGGGTACCTCAGTTGG + Intergenic
1009959599 6:70501816-70501838 GATGAACTGGGTACCTCAGTTGG + Intronic
1009988171 6:70806535-70806557 GATGAACCAGGTACCTCAGTTGG + Intronic
1009998217 6:70920453-70920475 GATGAACCAGGTACCTCAGTTGG + Intronic
1010003822 6:70974256-70974278 GATGAACCAGGTACCTCAGTTGG - Intergenic
1010006132 6:70997780-70997802 GATGAACTGGGTACCTCAGTTGG - Intergenic
1010171877 6:72984742-72984764 GATGAACCAGGTACCTCAGTTGG + Intronic
1010422201 6:75688425-75688447 GATGAACTAGTTACCTCAGTTGG + Intronic
1010482851 6:76375481-76375503 GATGAACTAGGTACCTCAGTTGG + Intergenic
1010574859 6:77518298-77518320 GAAGAACCAGTTACCTCAGTTGG - Intergenic
1010615267 6:78005412-78005434 GATGAACCAGGTACCTCAGTTGG - Intergenic
1010681914 6:78807996-78808018 GATGAACTGGGTACCTCAGTTGG + Intergenic
1010747191 6:79577734-79577756 GATGAACCAGGTACCTCAGTTGG - Intergenic
1010755738 6:79664197-79664219 GATGAACCAGGTACCTCAGTTGG + Intronic
1010820724 6:80411988-80412010 GATGAACAAGGTACCTCAGTTGG + Intergenic
1010837840 6:80612209-80612231 GATGAACCAGGTACCTCAGTTGG - Intergenic
1011063051 6:83293175-83293197 GATGAACCAGGTACCTCAGTTGG + Intronic
1011086425 6:83546431-83546453 GATGAACTGGGTACCTCAGTTGG - Intergenic
1011187913 6:84699424-84699446 GATGAACTTGGTACCTCAGTTGG - Intronic
1011245220 6:85314956-85314978 GATGAACCAGGTACCTCAGTTGG + Intergenic
1011288553 6:85751743-85751765 GATGAACCAGGTACCTCAGTTGG - Intergenic
1011417686 6:87139770-87139792 GATGAACCAGGTACCTCAGTTGG - Intergenic
1011831329 6:91375046-91375068 GATGAACTGGTTACCTCAGTTGG + Intergenic
1011847947 6:91590046-91590068 GATGAACCAGGTACCTCAGTTGG - Intergenic
1011884570 6:92078372-92078394 GATGAACCAGGTACCTCAGTTGG - Intergenic
1011909647 6:92420845-92420867 GATGAACCAGGTACCTCAGTTGG - Intergenic
1012207562 6:96479249-96479271 GATGAACCAGGTACCTCAGTTGG + Intergenic
1012302973 6:97612678-97612700 GATGAGCTGGTTACCTCAGTTGG + Intergenic
1012343564 6:98157502-98157524 GATGAACTGGGTACCTCAGTTGG + Intergenic
1012484123 6:99702211-99702233 GACGAACCAGGCACCTCAGTTGG - Intergenic
1012597219 6:101054503-101054525 GATGAACTGGGTACCTCAGTTGG + Intergenic
1012597942 6:101062090-101062112 GATGAACCAGGTACCTCAGTTGG - Intergenic
1012674669 6:102100541-102100563 GATGAACTGGGTACCTCAGTTGG - Intergenic
1012701053 6:102458389-102458411 GATGAACTGGGTACCTCAGTTGG - Intergenic
1012708741 6:102570700-102570722 GAAGAACTAGTCACCCTAACTGG + Intergenic
1012725919 6:102809477-102809499 GATGAACCAGGTACCTCAGTTGG + Intergenic
1012777889 6:103521648-103521670 GATGAACCAGGTACCTCAGTTGG - Intergenic
1012878374 6:104756656-104756678 GTTGAACCAGTCACCTCAGTTGG - Intronic
1013386882 6:109640463-109640485 GATGAACCAGGTACCTCAGTTGG + Intronic
1013436591 6:110116143-110116165 GATGAACCAGGTACCTCAGTTGG - Intronic
1013578368 6:111507755-111507777 GATGAACCAGGTACCTCAGTTGG + Intergenic
1013625769 6:111935313-111935335 GATGAACCAGGTACCTCAGTTGG + Intergenic
1013672531 6:112421182-112421204 GATGAACCAGGCACCTCAGTTGG - Intergenic
1013860904 6:114634012-114634034 GATGAACCAGGTACCTCAGTTGG + Intergenic
1013906112 6:115222171-115222193 GATGAACTTGGTACCTCAGTTGG - Intergenic
1013920253 6:115394951-115394973 GATGAACTGGGTACCTCAGTTGG + Intergenic
1014013246 6:116500951-116500973 GATGAACCAGGTACCTCAGTTGG - Intronic
1014184607 6:118421113-118421135 GATGAACCAGGTACCTCAGTTGG - Intergenic
1014413506 6:121154345-121154367 GATGAACCAGGTACCTCAGTTGG + Intronic
1014753603 6:125280026-125280048 GATGAACCGGATACCCCAGTTGG - Intronic
1014907065 6:127043334-127043356 GATGAACTGGGTACCTCAGTTGG - Intergenic
1014938749 6:127413630-127413652 GATGAACCAGCTACCTCAGTTGG + Intergenic
1014989265 6:128053568-128053590 GATGTTCTACTCACCCTAGTTGG + Intronic
1015290972 6:131538340-131538362 GATGAACTGGGTACCTCAGTTGG - Intergenic
1015419172 6:132986501-132986523 GATGAACCAGGTACCTCAGTTGG + Intergenic
1015533544 6:134244669-134244691 GATGAACCAGGTACCTCAGTTGG + Intronic
1015883379 6:137891762-137891784 GATGAGCTGGTTACCTCAGTTGG + Intergenic
1016006061 6:139090460-139090482 GATGAACCAGGTACCTCAGTTGG + Intergenic
1016334824 6:142993831-142993853 GATGAACCAGGTACCTCAGTTGG - Intergenic
1016338619 6:143035559-143035581 GATGAACCAGATACCTCAGTTGG + Intergenic
1016523928 6:144977763-144977785 GATGAACAAGGTACCTCAGTTGG + Intergenic
1016584868 6:145673387-145673409 GATGAACCAGGTACCTCAGTTGG - Intronic
1016655697 6:146515717-146515739 GATGAACCAGGTACCTCAGTTGG + Intergenic
1016691628 6:146943933-146943955 GATGAACTGGGTACCTCAGTTGG + Intergenic
1017302836 6:152882761-152882783 GATGAACCAGGTACCTCAGTTGG - Intergenic
1017737683 6:157380133-157380155 GAAGAACTACACATCCCAGTGGG + Intergenic
1017836581 6:158183933-158183955 GATGAACCAGGTACCTCAGTTGG + Intronic
1019203767 6:170341833-170341855 GATGAACCAGGTACCTCAGTTGG + Intronic
1019239167 6:170650241-170650263 GATGAACCAGGTACCTCAGTTGG + Intergenic
1020344224 7:7145648-7145670 GATGAACCAGGTACCTCAGTTGG + Intergenic
1020609034 7:10372641-10372663 GATGAACCAGGTACCTCAGTTGG - Intergenic
1020629652 7:10625155-10625177 GATGAACCAGGTACCTCAGTTGG - Intergenic
1020635882 7:10695677-10695699 GATGAACCAGGTACCTCAGTTGG - Intergenic
1020659562 7:10966124-10966146 GATGAACCAGGTACCTCAGTTGG + Intergenic
1020809935 7:12839594-12839616 GATGAACCAGGTACCTCAGTTGG - Intergenic
1021071593 7:16248675-16248697 GATGAACTAGGTACCTCAGTTGG - Intronic
1021224659 7:18013189-18013211 GATGAACTGGGTACCTCAGTTGG + Intergenic
1021282745 7:18740300-18740322 GATGAACCAGGTACCTCAGTTGG + Intronic
1021307127 7:19045825-19045847 GATGAACCAGGTACCTCAGTTGG - Intronic
1021483840 7:21146325-21146347 GATGAACTGGGTACCTCAGTTGG - Intergenic
1021502451 7:21345854-21345876 GATGAACTGGGTACCTCAGTTGG + Intergenic
1021661551 7:22924286-22924308 GATGAACCCGTTACCTCAGTTGG - Intergenic
1021753533 7:23828631-23828653 GATGAACCCGTTACCTCAGTTGG + Intronic
1021755169 7:23844636-23844658 GATGAACCAGGTACCTCAGTTGG - Intergenic
1021798234 7:24279023-24279045 GATGAACCAGGTACCTCAGTTGG + Intergenic
1021870607 7:25002306-25002328 GATGAACCAGGTACCTCAGTTGG + Intergenic
1022136083 7:27449577-27449599 GATGAACCAGGTACCTCAGTTGG + Intergenic
1022866929 7:34431413-34431435 GATGAACCAGGTACCTCAGTTGG - Intergenic
1022869023 7:34457022-34457044 GATGAACCAGGTACCTCAGTTGG - Intergenic
1022901368 7:34814021-34814043 GATGAACCAGGCACCTCAGTTGG - Intronic
1023034657 7:36120037-36120059 GATGAACCAGGTACCTCAGTTGG - Intergenic
1023066109 7:36379130-36379152 GATGAACCAGGTACCTCAGTTGG + Intronic
1023146172 7:37153248-37153270 GATGAACCAGGTACCTCAGTTGG - Intronic
1023310926 7:38886114-38886136 GATGAACCAGGTACCTCAGTTGG - Intronic
1023509437 7:40934953-40934975 GATGAACCAGGTACCTCAGTTGG + Intergenic
1023511137 7:40954489-40954511 GATGAACTGGGTACCTCAGTTGG + Intergenic
1023569001 7:41553177-41553199 GATGAACCAGGTACCTCAGTTGG + Intergenic
1023909995 7:44547068-44547090 GATGAACTGGGTACCTCAGTTGG - Intergenic
1024152872 7:46590809-46590831 GATGAACCAGGTACCTCAGTTGG - Intergenic
1024495350 7:50040451-50040473 GATGAACCAGGTACCTCAGTTGG - Intronic
1024591226 7:50886939-50886961 GATGAACCAGGTACCTCAGTTGG - Intergenic
1025638018 7:63340467-63340489 GATGAACTGGATACCTCAGTTGG + Intergenic
1025644678 7:63407632-63407654 GATGAACTGGATACCTCAGTTGG - Intergenic
1025714302 7:63941049-63941071 GATGAACTGGGTACCTCAGTTGG - Intergenic
1027574447 7:79915159-79915181 GATGAACAAGGTACCTCAGTTGG - Intergenic
1027864669 7:83630140-83630162 GATGAGCCAGGCACCTCAGTTGG + Intronic
1028078791 7:86548306-86548328 GATGAACCAGGGACCTCAGTTGG + Intergenic
1028080252 7:86567143-86567165 GATGAACCAGGTACCTCAGTTGG - Intergenic
1028236999 7:88373935-88373957 GATGAACCAGGTACCTCAGTTGG + Intergenic
1028396086 7:90369850-90369872 GATGAACCAGGTACCTCAGTTGG + Intronic
1028413068 7:90551562-90551584 GATGAACCAGGTACCTCAGTTGG + Intronic
1028523542 7:91758827-91758849 GATGAACTGGGTACCTCAGTTGG - Intronic
1028526270 7:91790560-91790582 GATGAACCAGGTACCTCAGTTGG - Intronic
1028544867 7:91986427-91986449 GATGAACCAGGTACCTCAGTTGG + Intronic
1029324866 7:99797088-99797110 GATGAACCAGGTACCTCAGTTGG + Intergenic
1029801631 7:102954042-102954064 GATGAACCAGGTACCTCAGTTGG - Intronic
1029850622 7:103457671-103457693 GATGAACCAGGTACCTCAGTTGG + Intergenic
1029952021 7:104596091-104596113 GATGAACCAGGTACCTCAGTTGG + Intronic
1030181011 7:106709490-106709512 GATGAACCAGGTACCTCAGTTGG - Intergenic
1030202423 7:106918890-106918912 GATGAACCAGGTACCTCAGTTGG - Intergenic
1030331793 7:108278788-108278810 GATGAACCAGGTACCTCAGTTGG + Intronic
1030771188 7:113476248-113476270 GATGAACCAGGTACCTCAGTTGG + Intergenic
1030958162 7:115881299-115881321 GATGAACCAGAAACCACAGTGGG - Intergenic
1031157025 7:118122310-118122332 GATGAACCAGGCACCTCAGTTGG - Intergenic
1031434325 7:121713504-121713526 GATGAACCAGGTACCTCAGTTGG + Intergenic
1031612584 7:123845055-123845077 GATGAACCAGGTACCTCAGTTGG + Intronic
1031619180 7:123915439-123915461 GCTGAACTATTCACATCAGTTGG - Intergenic
1031903076 7:127430640-127430662 GATGAGCTGGGTACCCCAGTTGG + Intronic
1032659848 7:133970699-133970721 GATGAGCTGGTTACCTCAGTTGG + Intronic
1033631873 7:143166244-143166266 GATGAACTCGGTACCTCAGTTGG + Intergenic
1034097580 7:148424479-148424501 GATGAACCAGGTACCTCAGTTGG - Intergenic
1034835176 7:154345322-154345344 GCTGAAATCGTCACCCTAGTGGG - Intronic
1035508605 8:156367-156389 GATGAACCAGGTACCTCAGTTGG - Intergenic
1036516317 8:9447345-9447367 GATGAACTTGGTACCTCAGTTGG + Intergenic
1036551096 8:9815756-9815778 GATGAACCAGGTACCTCAGTTGG - Intergenic
1036804551 8:11820899-11820921 GATGAACCAGGTACCTCAGTTGG + Intronic
1037664444 8:20956140-20956162 GATGAACTGGGTACCTCAGTTGG - Intergenic
1039284468 8:36026149-36026171 GATGAACCAGGTACCTCAGTGGG - Intergenic
1039347652 8:36725844-36725866 GATGAACCAGATACCTCAGTTGG - Intergenic
1039624397 8:39032701-39032723 GATGAACCAGGTACCTCAGTTGG + Intronic
1039634104 8:39144253-39144275 GATGAACCAGGTACCTCAGTTGG + Intronic
1039676819 8:39676676-39676698 GATGAACCAGGTACCTCAGTTGG + Intronic
1040364892 8:46705269-46705291 GATGAACTTGGTACCTCAGTTGG + Intergenic
1040383306 8:46894060-46894082 GATGAACCAGTTACCTCAGTTGG - Intergenic
1040473947 8:47760477-47760499 GAAGAACTAGGTACCTCAGTTGG + Intergenic
1040556651 8:48485668-48485690 GATGAAATAGATACCCCAGTTGG - Intergenic
1040607313 8:48946689-48946711 GATGAACCAGGTACCTCAGTTGG + Intergenic
1040943146 8:52852998-52853020 GATGAACTGGGTACCTCAGTTGG + Intergenic
1040968905 8:53112846-53112868 GATGAACTGGGTACCTCAGTTGG + Intergenic
1041154958 8:54976671-54976693 GATGAACTGGGTACCTCAGTTGG - Intergenic
1041349829 8:56937378-56937400 GATGAACTAAGTACCTCAGTTGG - Intergenic
1041459837 8:58098882-58098904 GATGAGCTAGGTACCTCAGTTGG + Intronic
1041909800 8:63077272-63077294 GATGAACCAGGTACCTCAGTTGG - Intronic
1041944257 8:63424156-63424178 GATGAACTTGGTACCTCAGTTGG - Intergenic
1042308773 8:67358974-67358996 GATGAACCAGGTACCTCAGTTGG + Intergenic
1042394446 8:68276392-68276414 GATGAACTCGGTACCTCAGTTGG - Intergenic
1042597576 8:70466066-70466088 GATGAACCAGGTACCTCAGTTGG + Intergenic
1042614311 8:70631921-70631943 GATGAACCAGGTACCTCAGTTGG + Intronic
1042645339 8:70980292-70980314 GATGAACCAGATACCTCAGTTGG + Intergenic
1042931245 8:74015974-74015996 GATGAACCAGGTACCTCAGTTGG - Intronic
1043036762 8:75208694-75208716 GATGAACTGGGTACCTCAGTTGG + Intergenic
1043165898 8:76902126-76902148 GATGAACCAGGTACCTCAGTTGG + Intergenic
1043368356 8:79561030-79561052 GATGAACCAGGTACCTCAGTTGG + Intergenic
1043605193 8:81991137-81991159 GATGAACTAGGTACCTCAGTTGG + Intergenic
1044312468 8:90709394-90709416 GATGAACTGGGTACCTCAGTTGG + Intronic
1044405178 8:91818544-91818566 GATGAACCAGATACCTCAGTTGG - Intergenic
1044470685 8:92562866-92562888 GATGAACCAGGTACCTCAGTTGG + Intergenic
1044597070 8:93969862-93969884 GATGAACCAGGTACCTCAGTTGG + Intergenic
1044601516 8:94009658-94009680 GATGAACTTGGTACCTCAGTTGG + Intergenic
1044799008 8:95933932-95933954 GATGAACCAGGTACCTCAGTTGG + Intergenic
1044809115 8:96039146-96039168 GATGAACCAGGTACCTCAGTTGG + Intergenic
1044940359 8:97335493-97335515 GATGAACTGGATACCTCAGTTGG + Intergenic
1045212008 8:100108460-100108482 GATGAACTGGGTACCTCAGTTGG - Intronic
1045390486 8:101710061-101710083 GATGAACTGGGTACCTCAGTTGG - Intronic
1045618810 8:103951397-103951419 GATGAACTGGGTACCTCAGTTGG - Intronic
1045883296 8:107065536-107065558 GATGAACTGGGTACCTCAGTTGG + Intergenic
1045933569 8:107654279-107654301 GATGAACCAGTTACCTCAGTTGG + Intergenic
1045949356 8:107834040-107834062 GATGAACCAGGTACCTCAGTTGG - Intergenic
1046014535 8:108589842-108589864 GATGAACTGGGTACCTCAGTTGG - Intergenic
1046115298 8:109776992-109777014 GATGAACAAGGTACCTCAGTTGG + Intergenic
1046219850 8:111200439-111200461 GATGAACTGGTTACCTCAGTTGG - Intergenic
1046879272 8:119290350-119290372 GATGAACCAGGTACCTCAGTTGG + Intergenic
1047931500 8:129732772-129732794 GATGAACCAGGTACCTCAGTTGG - Intergenic
1048149855 8:131883786-131883808 GATGAACCAGGTACCTCAGTTGG + Intergenic
1049697731 8:143991761-143991783 GATGCTCTTGTCATCCCAGTTGG - Exonic
1049872468 8:144991152-144991174 GATGAACTGGGTACCTCAGTTGG + Intergenic
1050012191 9:1196151-1196173 GATGAACCAGGTACCTCAGTTGG + Intergenic
1050031667 9:1393191-1393213 GATGAACCAGGTACCTCAGTTGG - Intergenic
1050369128 9:4902438-4902460 GATGAACTGGTTACCTCAGTTGG + Intergenic
1050386942 9:5100993-5101015 GATGAACCAGGTACCTCAGTTGG - Intronic
1050407631 9:5327007-5327029 AATGAACCAGGCACCTCAGTTGG - Intergenic
1050645260 9:7713013-7713035 GATGAACCAGGTACCTCAGTTGG - Intergenic
1050678736 9:8085511-8085533 GATGAACCAGGTACCTCAGTTGG + Intergenic
1050943261 9:11486208-11486230 GATGAGCTGGGCACCTCAGTTGG + Intergenic
1051112180 9:13651470-13651492 GATGAACTGGCTACCTCAGTTGG + Intergenic
1051308753 9:15746712-15746734 GATGAACAAGGTACCTCAGTTGG - Intronic
1051314720 9:15817298-15817320 GATGAACCCGTTACCTCAGTTGG - Intronic
1051982835 9:23045521-23045543 GATGAACTGGGTACCTCAGTTGG - Intergenic
1051998364 9:23247518-23247540 GATGAACTGGGTACCTCAGTTGG - Intergenic
1052063716 9:23991783-23991805 GATGAACTAGGTACCTCAGTTGG - Intergenic
1052125231 9:24765760-24765782 GATGAACCAGGTACCTCAGTTGG + Intergenic
1052770447 9:32684223-32684245 GATGAACCAGGTACCTCAGTTGG - Intergenic
1052799974 9:32957895-32957917 GATGAACCAGGTACCTCAGTTGG - Intergenic
1052887677 9:33666113-33666135 GATGAACCAGGTACCTCAGTTGG - Intergenic
1053608258 9:39681744-39681766 GATGAGCTGGTTACCTCAGTTGG + Intergenic
1053866098 9:42438104-42438126 GATGAGCTGGTTACCTCAGTTGG + Intergenic
1054245273 9:62660665-62660687 GATGAGCTGGTTACCTCAGTTGG - Intergenic
1054559401 9:66695196-66695218 GATGAGCTGGTTACCTCAGTTGG - Intergenic
1054889939 9:70240394-70240416 GATGAACCAGGTACCTCAGTTGG - Intergenic
1055013898 9:71595635-71595657 GATGAACCAGGTACCTCAGTTGG - Intergenic
1055053269 9:72000522-72000544 GATGAACCAGATACCTCAGTTGG + Intergenic
1055210224 9:73782828-73782850 GATGAACTGGGTACCTCAGTTGG - Intergenic
1056123637 9:83513749-83513771 GATGAACTGGGTACCTCAGTTGG - Intronic
1056366426 9:85909479-85909501 GATGAACTCTCCACCCCAGGAGG + Intergenic
1057769141 9:97951411-97951433 GATGAACCAGGTACCTCAGTTGG + Intergenic
1058034681 9:100237709-100237731 GATGAACTGGGCACCTCAGTTGG + Intronic
1058182425 9:101815306-101815328 GATGAACTAGGTACCTCAGCTGG - Intergenic
1058203048 9:102067212-102067234 GATGAACCAGGTACCTCAGTTGG + Intergenic
1058492248 9:105515469-105515491 GATGAACCGGGTACCCCAGTTGG - Intronic
1058614262 9:106809269-106809291 GATGAACCAGGTACCTCAGTTGG - Intergenic
1058926178 9:109666219-109666241 GATGAACCAGGTACCTCAGTTGG + Intronic
1059513255 9:114869459-114869481 GATAAACTGGGCACCTCAGTTGG - Intergenic
1059864726 9:118501545-118501567 GATGAACTGGGTACCTCAGTTGG + Intergenic
1061033610 9:128101517-128101539 GATGAATAAGTAACCCCTGTGGG + Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062759373 9:138330532-138330554 GATGAACCAGGTACCTCAGTTGG + Intergenic
1203599822 Un_KI270748v1:1304-1326 GATGAACCAGGTACCTCAGTTGG + Intergenic
1185806176 X:3059406-3059428 GATGAACAAGATACCTCAGTTGG - Intronic
1185911047 X:3981788-3981810 GATGAACCAGGTACCTCAGTTGG - Intergenic
1186585584 X:10869918-10869940 GATGAACCAGGTACCTCAGTTGG - Intergenic
1186774954 X:12855103-12855125 GATGAACTTGGTACCTCAGTTGG + Intergenic
1186810249 X:13181419-13181441 GATGAACCAGGTACCTCAGTTGG - Intergenic
1186866377 X:13724712-13724734 GATGAACCAGGTACCTCAGTTGG - Intronic
1186992883 X:15088498-15088520 GATGAACCAGGTACCTCAGTTGG - Intergenic
1187248421 X:17574730-17574752 GATGAACCAGCTACCTCAGTTGG + Intronic
1187525108 X:20047224-20047246 GAGGCACCAGTCACCACAGTGGG + Intronic
1187605085 X:20874350-20874372 GATGAACTGGGTACCTCAGTTGG - Intergenic
1187623874 X:21089266-21089288 GATGAACCCGTTACCTCAGTTGG - Intergenic
1187626655 X:21121998-21122020 GATGGAAAAGTCACCCCAGAGGG + Intergenic
1187705472 X:22005484-22005506 GATGAACCAGGTACCTCAGTTGG + Intergenic
1187729174 X:22235186-22235208 GATGAACTGGGTACCTCAGTTGG + Intronic
1187829220 X:23363684-23363706 GATGAACCAGCTACCTCAGTTGG + Intronic
1188922023 X:35987962-35987984 GATGAACTGGGTACCTCAGTTGG + Intronic
1188954624 X:36418894-36418916 GATGAACCAGGTACCTCAGTTGG + Intergenic
1189619150 X:42816853-42816875 GATGAACCAGGTACCTCAGTTGG + Intergenic
1189702670 X:43727848-43727870 GATGAACCAGGTACCTCAGTTGG + Intronic
1189713497 X:43840576-43840598 GATGAACTGGGTACCTCAGTTGG - Intronic
1189978519 X:46486411-46486433 GATGAACCAGGTACCTCAGTTGG + Intronic
1190622197 X:52298811-52298833 GATGAACCAGGTACCTCAGTTGG - Intergenic
1190648985 X:52550849-52550871 GATGAACCAGGTACCTCAGTTGG - Intergenic
1190944061 X:55073410-55073432 GATGAACTGGGTACCTCAGTTGG + Intergenic
1191002425 X:55674410-55674432 GATGAACCAGGCACCTCAGTTGG + Intergenic
1191012491 X:55774946-55774968 GATGAACCAGGTACCTCAGTTGG + Intergenic
1191051140 X:56194177-56194199 GATGAACCAGGTACCTCAGTTGG - Intergenic
1191094443 X:56659486-56659508 GATGAACTGGGTACCTCAGTTGG + Intergenic
1191099073 X:56705310-56705332 GATGAGCTAGGTACCTCAGTTGG + Intergenic
1191138806 X:57094424-57094446 GATGAACCAGGTACCTCAGTTGG - Intergenic
1191181116 X:57565018-57565040 GATGAACCAGGTACCTCAGTTGG - Intergenic
1191606150 X:63065416-63065438 GATGAACTGGGCACCTCAGTTGG - Intergenic
1191650871 X:63536795-63536817 GATGAACTGGGTACCTCAGTTGG - Intergenic
1191686641 X:63899223-63899245 GATGAACTGGGTACCTCAGTTGG - Intergenic
1191711331 X:64152692-64152714 GATGAACCAGGTACCTCAGTTGG - Intergenic
1191733426 X:64363701-64363723 GATGAACCAGGTACCTCAGTTGG - Intronic
1191745109 X:64477982-64478004 GATGAACCAGGTACCTCAGTTGG + Intergenic
1191766815 X:64706404-64706426 GATGAACTGGGTACCTCAGTTGG + Intergenic
1191882469 X:65856689-65856711 GATGAACCAGGTACCTCAGTTGG + Intergenic
1191886619 X:65894713-65894735 GATGAACCAGTTACCTCAGCTGG + Intergenic
1191909039 X:66127570-66127592 GATGAACTGGGTACCTCAGTTGG + Intergenic
1191928785 X:66345004-66345026 GATGAACTGGGTACCTCAGTTGG + Intergenic
1191987321 X:66995494-66995516 GATGAACTGGATACCTCAGTTGG + Intergenic
1192018366 X:67357530-67357552 GATGAACTAGGTACCTCAGTTGG - Intergenic
1192129080 X:68530820-68530842 GATGAACTGGGTACCTCAGTTGG + Intronic
1192406363 X:70890304-70890326 GATGAACCAGGTACCTCAGTTGG - Intronic
1192612863 X:72585533-72585555 GATGAACCAGGTACCTCAGTTGG - Intronic
1192629088 X:72761031-72761053 GATGAACCAGGCACCTCAGTTGG + Intergenic
1192652622 X:72959783-72959805 GATGAACCAGGCACCTCAGTTGG - Intergenic
1192654686 X:72980797-72980819 GATGAACCAGGTACCTCAGTTGG - Intergenic
1192694633 X:73401155-73401177 GATGAACCAGGTACCTCAGTTGG - Intergenic
1192701851 X:73482525-73482547 GATGAACTGGATACCTCAGTTGG + Intergenic
1192712938 X:73610422-73610444 GATGAACTGGGTACCTCAGTTGG + Intronic
1192727457 X:73768007-73768029 GATGAACCAGTTACCTCAGCTGG - Intergenic
1192843549 X:74882250-74882272 GATGAACCCGTTACCTCAGTTGG - Intronic
1192881813 X:75293164-75293186 GATGAACAAGTTACCCCTGGAGG - Intronic
1192916139 X:75652800-75652822 GATGAACTGGGTACCTCAGTTGG + Intergenic
1193065344 X:77253848-77253870 GATGAACTGGGTACCACAGTTGG - Intergenic
1193113861 X:77756690-77756712 GATGAACTGGGTACCTCAGTTGG + Intronic
1193190466 X:78564100-78564122 GATGAACTGGGTACCTCAGTTGG + Intergenic
1193338520 X:80319358-80319380 GATGAACCAGGTACCTCAGTTGG - Intergenic
1193356089 X:80521516-80521538 GATGAACCGGGCACCTCAGTTGG + Intergenic
1193398478 X:81013971-81013993 GATGAACTGGGTACCTCAGTTGG - Intergenic
1193402551 X:81063782-81063804 GATGAACCAGGTACCTCAGTTGG - Intergenic
1193419971 X:81271279-81271301 GATGAACCAGGCACCTCTGTTGG + Intronic
1193516897 X:82476755-82476777 GATGAACCAGTTACCTCATTTGG + Intergenic
1193640914 X:84008911-84008933 GATGAACCAGGTACCTCAGTTGG - Intergenic
1194242473 X:91469569-91469591 GATGAACCAGGTACCTCAGTTGG - Intergenic
1194315385 X:92369852-92369874 GATGAACTGGGTACCTCAGTTGG + Intronic
1194726873 X:97409483-97409505 GATGAACCAGGTACCTCAGTTGG - Intronic
1195345055 X:103941065-103941087 GATGAACCTGGCACCTCAGTTGG + Intronic
1195436007 X:104843747-104843769 GATGAACTGGGTACCTCAGTTGG + Intronic
1195580392 X:106494206-106494228 GATGAACTGGGCACCTCAGTCGG + Intergenic
1195621994 X:106966397-106966419 GATGAACCAGGTACCTCAGTTGG - Intronic
1195729323 X:107949582-107949604 GATGAACCAGGTACCTCAGTTGG + Intergenic
1195808312 X:108800913-108800935 GATGAACTTGGTACCTCAGTTGG - Intergenic
1195947354 X:110229618-110229640 GATGAACCAGGTACCTCAGTTGG - Intronic
1196094469 X:111784534-111784556 GATGAACCAGTTACCTCAGTTGG - Intronic
1196167524 X:112551791-112551813 GATGAACCAGGTACCTCAGTTGG + Intergenic
1196230250 X:113212566-113212588 GATGAACCAGGTACCTCAGTTGG + Intergenic
1196587111 X:117443233-117443255 GATGAACAGGGCACCTCAGTTGG - Intergenic
1197184650 X:123573297-123573319 GATGAACTGGGTACCTCAGTTGG - Intergenic
1197489735 X:127102331-127102353 GATGAACCAGCTACCTCAGTTGG - Intergenic
1197505901 X:127305604-127305626 GATGAACTGGGTACCTCAGTTGG - Intergenic
1197959579 X:131989573-131989595 GATGAACCAGGTACCTCAGTTGG - Intergenic
1198060661 X:133042549-133042571 GATGAACTGGGCACCTCAGTTGG + Intronic
1198259089 X:134950555-134950577 GATGAACCAGGTACCTCAGTTGG - Intergenic
1198571237 X:137959766-137959788 GATGAACCAGGTACCTCAGTTGG - Intergenic
1198595425 X:138230822-138230844 GATGAACCAGGTACCTCAGTTGG - Intergenic
1198645592 X:138802447-138802469 GATGAACTGGGGACCTCAGTTGG + Intronic
1198725878 X:139676354-139676376 GATGAACCAGGTACCTCAGTTGG + Intronic
1198753444 X:139958692-139958714 GATGAACTGGGTACCTCAGTTGG - Intronic
1199004218 X:142675724-142675746 GATGAACTGGGTACCTCAGTTGG + Intergenic
1199383725 X:147200383-147200405 GATGAACCAGGTACCTCAGTTGG - Intergenic
1199524989 X:148782039-148782061 GATGAACTGGGTACCTCAGTTGG + Intronic
1199796156 X:151199912-151199934 GATGAACCAGGAACCTCAGTTGG - Intergenic
1199830598 X:151545856-151545878 GATGAACTGGGTACCTCAGTTGG - Intergenic
1199939668 X:152612627-152612649 GATGAACCAGGTACCTCAGTTGG + Intergenic
1200405962 Y:2811639-2811661 GATGAACCAGTTACCTCAGTTGG + Intergenic
1200623435 Y:5481387-5481409 GATGAACTGGGTACCTCAGTTGG + Intronic
1201182106 Y:11358889-11358911 GATGAACCAGGTACCTCAGTTGG - Intergenic
1201185866 Y:11402436-11402458 GATGAACAAGGTACCTCAGTAGG - Intergenic
1201353409 Y:13071713-13071735 GATGAACCAGGTACCCGAGTTGG - Intergenic
1201459449 Y:14206279-14206301 GATGAACCAGATACCTCAGTTGG - Intergenic
1201670680 Y:16516479-16516501 GATGAACCAGGTACCTCAGTTGG + Intergenic
1201913555 Y:19158138-19158160 GATGAACCACTTACCTCAGTTGG - Intergenic
1202034784 Y:20620830-20620852 GATGAACTTGGTACCTCAGTTGG + Intergenic
1202064972 Y:20929562-20929584 GATGAACAAGGTACCTCAGTTGG - Intergenic
1202174639 Y:22086084-22086106 GATGAACCAGATACCTCAGTGGG - Intronic
1202216723 Y:22500298-22500320 GATGAACCAGATACCTCAGTGGG + Intronic
1202326464 Y:23695770-23695792 GATGAACCAGATACCTCAGTGGG - Intergenic
1202544306 Y:25974283-25974305 GATGAACCAGATACCTCAGTGGG + Intergenic